[EMBOSS] Add Needleall tool (v6) and bump version for needle to v6

tools/emboss/.shed.yml

@@ -0,0 +1,25 @@
+name: emboss
+owner: iuc
+description: "Galaxy wrappers for EMBOSS6 tools"
+categories:
+- Sequence Analysis
+- Fasta Manipulation
+homepage_url: "http://emboss.open-bio.org/"
+long_description: |
+    "The European Molecular Biology Open Software Suite (EMBOSS) is a high quality, well documented package of open source software tools for molecular biology. It includes over 200 applications for molecular sequence analysis and other common tasks in bioinformatics."
+remote_repository_url: https://github.com/galaxyproject/tools-iuc/tree/master/tools/emboss
+type: unrestricted
+
+auto_tool_repositories:
+  name_template: "{{ tool_id }}"
+  description_template: "Wrapper for EMBOSS tool: {{ tool_name }}."
+suite:
+  name: "suite_emboss"
+  description: "EMBOSS suite of tool for molecular biology"
+  long_description: |
+    "The European Molecular Biology Open Software Suite (EMBOSS) is a high
+    quality, well documented package of open source software tools for
+    molecular biology. It includes over 200 applications for molecular
+    sequence analysis and other common tasks in bioinformatics."
+
+

tools/emboss/emboss_needle.xml

@@ -0,0 +1,134 @@
+<tool id="emboss_needle" name="needle" version="@VERSION@" profile="@PROFILE@">
+  <description>Needleman-Wunsch global alignment</description>
+  <macros>
+    <import>macros.xml</import>
+  </macros>
+  <expand macro="bio_tools" />
+  <expand macro="requirements" />
+  <version_command>needle -version</version_command>
+  <command detect_errors="exit_code"><![CDATA[
+needle -asequence '$asequence'
+-bsequence '$bsequence'
+-outfile '$out_file1'
+-gapopen $gapopen
+-gapextend $gapextend
+-brief $brief
+-aformat3 $out_format1
+-auto
+#if $datafile
+-datafile $datafile
+#end if
+#if $endgap.endweight == 'yes'
+-endopen $endgap.endopen
+-endextend $endgap.endextend
+#end if
+]]></command>
+  <inputs>
+    <param argument="-asequence" type="data" format="fasta" label="Sequence 1" />
+    <param argument="-bsequence" type="data" format="fasta" label="Sequence 2" />
+
+    <expand macro="scoring_matrix"/>
+    <expand macro="gap_penalties"/>
+    <expand macro="endgap_penalties"/>
+    <expand macro="param_brief"/>
+
+    <expand macro="choose_alignment_output_format"/>
+  </inputs>
+  <outputs>
+    <data name="out_file1" format="needle" label="${tool.name} on ${on_string}: alignment output" >
+      <expand macro="change_alignment_output_format"/>
+    </data>
+  </outputs>
+  <tests>
+    <test>
+      <param name="asequence" value="2.fasta"/>
+      <param name="bsequence" value="1.fasta"/>
+      <param name="gapopen" value="10"/>
+      <param name="gapextend" value="0.5"/>
+      <param name="brief" value="yes"/>
+      <param name="out_format1" value="score"/>
+      <output name="out_file1" file="emboss_needle_out.score" ftype="score"/>
+    </test>
+    <test><!-- test with fasta output, custom matrix, and endgap penalties -->
+      <param name="asequence" value="2.fasta"/>
+      <param name="bsequence" value="1.fasta"/>
+      <param name="gapopen" value="10"/>
+      <param name="gapextend" value="0.5"/>
+      <param name="datafile" value="EPAM30"/>
+      <conditional name="endgap">
+        <param name="endweight" value="yes"/>
+        <param name="endopen" value="13.37"/>
+        <param name="endextend" value="2.5"/>
+      </conditional>
+      <param name="brief" value="yes"/>
+      <param name="out_format1" value="fasta"/>
+      <output name="out_file1" file="emboss_needle_out.fasta" ftype="fasta"/>
+    </test>
+  </tests>
+  <help><![CDATA[
+
+needle reads any two sequences of the same type (DNA or protein).
+
+This tool uses the Needleman-Wunsch global alignment algorithm to find the optimum alignment (including gaps) of two sequences when considering their entire length.
+
+- **Optimal alignment:** Dynamic programming methods ensure the optimal global alignment by exploring all possible alignments and choosing the best.
+
+- **The Needleman-Wunsch algorithm** is a member of the class of algorithms that can calculate the best score and alignment in the order of mn steps, (where 'n' and 'm' are the lengths of the two sequences).
+
+- **Gap open penalty:** [10.0 for any sequence] The gap open penalty is the score taken away when a gap is created. The best value depends on the choice of comparison matrix. The default value assumes you are using the EBLOSUM62 matrix for protein sequences, and the EDNAFULL matrix for nucleotide sequences. (Floating point number from 1.0 to 100.0)
+
+- **Gap extension penalty:** [0.5 for any sequence] The gap extension, penalty is added to the standard gap penalty for each base or residue in the gap. This is how long gaps are penalized. Usually you will expect a few long gaps rather than many short gaps, so the gap extension penalty should be lower than the gap penalty. An exception is where one or both sequences are single reads with possible sequencing errors in which case you would expect many single base gaps. You can get this result by setting the gap open penalty to zero (or very low) and using the gap extension penalty to control gap scoring. (Floating point number from 0.0 to 10.0)
+
+You can view the original documentation here_.
+
+    .. _here: http://galaxy-iuc.github.io/emboss-5.0-docs/needle.html
+
+-----
+
+**Example**
+
+- Input File::
+
+    >hg18_dna range=chrX:151073054-151073136 5'pad=0 3'pad=0 revComp=FALSE strand=? repeatMasking=none
+    TTTATGTCTATAATCCTTACCAAAAGTTACCTTGGAATAAGAAGAAGTCA
+    GTAAAAAGAAGGCTGTTGTTCCGTGAAATACTG
+
+- If both Sequence1 and Sequence2 take the above file as input, Gap open penalty equals 10.0, Gap extension penalty equals 0.5, Brief identity and similarity is set to Yes, Output alignment file format is set to SRS pairs, the output file is::
+
+    ########################################
+    # Program: needle
+    # Rundate: Mon Apr 02 2007 14:23:16
+    # Align_format: srspair
+    # Report_file: ./database/files/dataset_7.dat
+    ########################################
+
+    #=======================================
+    #
+    # Aligned_sequences: 2
+    # 1: hg18_dna
+    # 2: hg18_dna
+    # Matrix: EDNAFULL
+    # Gap_penalty: 10.0
+    # Extend_penalty: 0.5
+    #
+    # Length: 83
+    # Identity:      83/83 (100.0%)
+    # Similarity:    83/83 (100.0%)
+    # Gaps:           0/83 ( 0.0%)
+    # Score: 415.0
+    #
+    #=======================================
+
+    hg18_dna           1 TTTATGTCTATAATCCTTACCAAAAGTTACCTTGGAATAAGAAGAAGTCA     50
+                       ||||||||||||||||||||||||||||||||||||||||||||||||||
+    hg18_dna           1 TTTATGTCTATAATCCTTACCAAAAGTTACCTTGGAATAAGAAGAAGTCA     50
+
+    hg18_dna          51 GTAAAAAGAAGGCTGTTGTTCCGTGAAATACTG     83
+                       |||||||||||||||||||||||||||||||||
+    hg18_dna          51 GTAAAAAGAAGGCTGTTGTTCCGTGAAATACTG     83
+
+    #---------------------------------------
+    #---------------------------------------
+  ]]></help>
+  <expand macro="citations" />
+</tool>

tools/emboss/emboss_needleall.xml

@@ -0,0 +1,97 @@
+<tool id="emboss_needleall" name="needleall" version="@[email protected]" profile="@PROFILE@">
+  <description>Many-to-many Needleman-Wunsch global alignment</description>
+  <macros>
+    <import>macros.xml</import>
+  </macros>
+  <expand macro="bio_tools" />
+  <expand macro="requirements" />
+  <version_command>needleall -version</version_command>
+  <command detect_errors="exit_code"><![CDATA[
+needleall
+-asequence '$asequence'
+-bsequence '$bsequence'
+-outfile '$out_file1'
+-gapopen $gapopen
+-gapextend $gapextend
+-brief $brief
+-aformat3 $out_format1
+-auto
+#if $datafile
+-datafile $datafile
+#end if
+#if $endgap.endweight == 'yes'
+-endopen $endgap.endopen
+-endextend $endgap.endextend
+#end if
+-minscore $minscore
+]]></command>
+  <inputs>
+    <param argument="-asequence" type="data" format="fasta" label="Sequence set 1" />
+    <param argument="-bsequence" type="data" format="fasta" label="Sequence set 2" />
+
+    <expand macro="scoring_matrix"/>
+    <expand macro="gap_penalties"/>
+    <expand macro="endgap_penalties"/>
+    <expand macro="param_brief"/>
+
+    <param argument="-minscore" type="float" value="1.0" min="-10.0" max="100.0" label="Minimum alignment score to report an alignment." help=""/>
+
+    <expand macro="choose_alignment_output_format"/>
+  </inputs>
+  <outputs>
+    <data name="out_file1" format="needle" label="${tool.name} on ${on_string}: alignment output">
+      <expand macro="change_alignment_output_format"/>
+    </data>
+  </outputs>
+  <tests>
+    <test>
+      <param name="asequence" value="emboss_needleall_input1.fa"/>
+      <param name="bsequence" value="emboss_needleall_input2.fa"/>
+      <param name="gapopen" value="10"/>
+      <param name="gapextend" value="0.5"/>
+      <param name="brief" value="yes"/>
+      <param name="out_format1" value="score"/>
+      <output name="out_file1" file="emboss_needleall_out.score" ftype="score"/>
+    </test>
+    <test><!-- test fasta output -->
+      <param name="asequence" value="emboss_needleall_input1.fa"/>
+      <param name="bsequence" value="emboss_needleall_input2.fa"/>
+      <param name="gapopen" value="10"/>
+      <param name="gapextend" value="0.5"/>
+      <param name="brief" value="yes"/>
+      <param name="out_format1" value="fasta"/>
+      <output name="out_file1" file="emboss_needleall_out.fasta" ftype="fasta"/>
+    </test>
+     <test><!-- test with pair output, endgap penalties and custom scoring matrix -->
+      <param name="asequence" value="emboss_needleall_input1.fa"/>
+      <param name="bsequence" value="emboss_needleall_input2.fa"/>
+      <param name="gapopen" value="10"/>
+      <param name="gapextend" value="0.5"/>
+      <conditional name="endgap">
+        <param name="endweight" value="yes"/>
+        <param name="endopen" value="13.37"/>
+        <param name="endextend" value="2.5"/>
+      </conditional>
+      <param name="brief" value="yes"/>
+      <param name="datafile" value="EPAM30"/>
+      <param name="out_format1" value="pair"/>
+      <output name="out_file1" file="emboss_needleall_out.pair" lines_diff="10" ftype="pair"/>
+    </test>
+  </tests>
+  <help><![CDATA[
+
+needleall reads in two nucleotide or protein sequences inputs. Both can be one or more sequences. All sequences in the first input are aligned to all sequences in the second input.
+
+This tool uses the Needleman-Wunsch global alignment algorithm to find the optimum alignment (including gaps) of two sequences when considering their entire length.
+
+- **Optimal alignment:** Dynamic programming methods ensure the optimal global alignment by exploring all possible alignments and choosing the best.
+
+- **The Needleman-Wunsch algorithm** is a member of the class of algorithms that can calculate the best score and alignment in the order of mn steps, (where 'n' and 'm' are the lengths of the two sequences).
+
+- **Gap open penalty:** [10.0 for any sequence] The gap open penalty is the score taken away when a gap is created. The best value depends on the choice of comparison matrix. The default value assumes you are using the EBLOSUM62 matrix for protein sequences, and the EDNAFULL matrix for nucleotide sequences. (Floating point number from 1.0 to 100.0)
+
+- **Gap extension penalty:** [0.5 for any sequence] The gap extension, penalty is added to the standard gap penalty for each base or residue in the gap. This is how long gaps are penalized. Usually you will expect a few long gaps rather than many short gaps, so the gap extension penalty should be lower than the gap penalty. An exception is where one or both sequences are single reads with possible sequencing errors in which case you would expect many single base gaps. You can get this result by setting the gap open penalty to zero (or very low) and using the gap extension penalty to control gap scoring. (Floating point number from 0.0 to 10.0)
+
+  ]]></help>
+  <expand macro="citations" />
+</tool>