diff --git a/_images/q2-dev-cycle-diagram.png b/_images/q2-dev-cycle-diagram.png
index c018567..6501552 100644
Binary files a/_images/q2-dev-cycle-diagram.png and b/_images/q2-dev-cycle-diagram.png differ
diff --git a/_sources/framework/references/dev-cycle-structure.md b/_sources/framework/references/dev-cycle-structure.md
index 5af7b0a..db7c0a6 100644
--- a/_sources/framework/references/dev-cycle-structure.md
+++ b/_sources/framework/references/dev-cycle-structure.md
@@ -7,7 +7,7 @@ If you have any questions on this process, please don't hesitate to reach out on
 ## QIIME 2 Release Cycle Structure
 
 As of 2024.10, QIIME 2 Distributions are released bi-anually, on the first Wednesday of April and October.
-This schedule provides us with ample development time between releases, and provides our developer community with at least a three month notice for any external dependency changes (i.e. bumping Python, removing a deprecated package, etc).
+This schedule provides us with ample development time between releases, and provides our developer community with at least a three month notice for any interface/API changes and any external dependency changes (i.e. bumping Python, removing a deprecated package, etc).
 
 The following diagram outlines relevant timepoints between each release, with terms defined below.
 
diff --git a/framework/references/dev-cycle-structure.html b/framework/references/dev-cycle-structure.html
index 26091ab..088b28d 100644
--- a/framework/references/dev-cycle-structure.html
+++ b/framework/references/dev-cycle-structure.html
@@ -448,7 +448,7 @@ <h1>QIIME 2 Development and Release Cycle Structure<a class="headerlink" href="#
 <section id="qiime-2-release-cycle-structure">
 <h2>QIIME 2 Release Cycle Structure<a class="headerlink" href="#qiime-2-release-cycle-structure" title="Link to this heading">#</a></h2>
 <p>As of 2024.10, QIIME 2 Distributions are released bi-anually, on the first Wednesday of April and October.
-This schedule provides us with ample development time between releases, and provides our developer community with at least a three month notice for any external dependency changes (i.e. bumping Python, removing a deprecated package, etc).</p>
+This schedule provides us with ample development time between releases, and provides our developer community with at least a three month notice for any interface/API changes and any external dependency changes (i.e. bumping Python, removing a deprecated package, etc).</p>
 <p>The following diagram outlines relevant timepoints between each release, with terms defined below.</p>
 <figure class="align-center">
 <a class="reference internal image-reference" href="../../_images/q2-dev-cycle-diagram.png"><img alt="../../_images/q2-dev-cycle-diagram.png" src="../../_images/q2-dev-cycle-diagram.png" style="width: 300px;" /></a>
diff --git a/searchindex.js b/searchindex.js
index 1dd2df3..ed74406 100644
--- a/searchindex.js
+++ b/searchindex.js
@@ -1 +1 @@
-Search.setIndex({"alltitles": {"": [[9, null], [10, null], [15, null], [27, null], [50, null], [67, null], [67, null], [67, null], [70, null]], "A few additional tests": [[67, "a-few-additional-tests"]], "A first test of our plugin action": [[67, "a-first-test-of-our-plugin-action"]], "A second test of our action": [[67, "a-second-test-of-our-action"]], "A visualizer for free!": [[50, "a-visualizer-for-free"]], "Accessibility and Transferability": [[10, "accessibility-and-transferability"]], "Acknowledgements": [[24, "acknowledgements"]], "Action registration": [[57, "action-registration"]], "Actions": [[22, "actions"], [60, "actions"]], "Activate the conda environment": [[46, "activate-the-conda-environment"]], "Add a Pipeline with parallel computing support": [[68, null]], "Add a Usage Example": [[70, null]], "Add a first (real) Method": [[67, null]], "Add a first Pipeline": [[69, null]], "Add a first Visualizer": [[65, null]], "Add a local alignment search Pipeline": [[68, "add-a-local-alignment-search-pipeline"]], "Add a new Artifact Class": [[66, null]], "Add a second transformer": [[64, null]], "Add an optional input to tabulate_las_results": [[73, "add-an-optional-input-to-tabulate-las-results"]], "Add parallel computing support to search_and_summarize": [[68, "add-parallel-computing-support-to-search-and-summarize"]], "Add tests and documentation": [[69, "add-tests-and-documentation"]], "Add unit tests and update the search-and-summarize usage example": [[73, "add-unit-tests-and-update-the-search-and-summarize-usage-example"]], "Add unit tests of the new transfomer": [[64, "add-unit-tests-of-the-new-transfomer"]], "Additional Objects": [[56, "additional-objects"]], "Advanced Filtering": [[50, "advanced-filtering"]], "Amplicon distribution": [[46, "amplicon-distribution"]], "An Analogy": [[16, "an-analogy"]], "An optional exercise": [[65, "an-optional-exercise"], [66, "an-optional-exercise"], [67, "an-optional-exercise"], [69, "an-optional-exercise"]], "Anatomy of an Archive": [[9, null]], "Annotations": [[60, "annotations"]], "Archive Version 0": [[18, "archive-version-0"]], "Archive Version 1": [[18, "archive-version-1"]], "Archive Version 2": [[18, "archive-version-2"]], "Archive Version 3": [[18, "archive-version-3"]], "Archive Version 4": [[18, "archive-version-4"]], "Archive Version 5": [[18, "archive-version-5"]], "Archive Version 6": [[18, "archive-version-6"]], "Archive Version 7": [[18, "archive-version-7"]], "Archive versions": [[18, null]], "Artifact classes": [[29, "artifact-classes"], [66, "artifact-classes"]], "Associating Formats with a Type": [[11, "associating-formats-with-a-type"]], "Automate testing of your plugin": [[31, null]], "Automated Testing using Continuous Integration (CI) and Github Actions (GHA)": [[31, "automated-testing-using-continuous-integration-ci-and-github-actions-gha"]], "Automated testing of usage examples": [[70, "automated-testing-of-usage-examples"]], "Back matter": [[3, null]], "Basic types": [[59, "basic-types"]], "Binary File Formats": [[11, "binary-file-formats"]], "Building your first plugin": [[46, "building-your-first-plugin"]], "Calling the action with q2cli and the Python 3 API": [[67, "calling-the-action-with-q2cli-and-the-python-3-api"]], "Categorical Metadata Columns": [[50, "categorical-metadata-columns"]], "Choices": [[16, "choices"]], "Citations": [[53, null]], "Collections": [[59, "collections"], [60, "collections"]], "Command line interface": [[70, "command-line-interface"]], "Comments can provide context": [[49, "comments-can-provide-context"]], "Community Contributions on the QIIME 2 Forum": [[44, "community-contributions-on-the-qiime-2-forum"]], "Compare the serial versus parallel run times of the search-and-summarize": [[68, "compare-the-serial-versus-parallel-run-times-of-the-search-and-summarize"]], "Conclusion": [[71, null]], "Configure Continuous Integration (CI) testing": [[31, "configure-continuous-integration-ci-testing"]], "Configure weekly automated testing": [[31, "configure-weekly-automated-testing"]], "Contributing": [[24, "contributing"]], "Contributing to existing plugins": [[46, "contributing-to-existing-plugins"]], "Contributing to the current user documentation": [[7, "contributing-to-the-current-user-documentation"]], "Create _pipelines.py and add a Pipeline": [[69, "create-pipelines-py-and-add-a-pipeline"]], "Create a function to register as a Method": [[32, "create-a-function-to-register-as-a-method"]], "Create a function to register as a Pipeline": [[33, "create-a-function-to-register-as-a-pipeline"]], "Create a function to register as a Visualizer": [[35, "create-a-function-to-register-as-a-visualizer"]], "Create and register a Method": [[32, null]], "Create and register a pipeline": [[33, null]], "Create and register a visualizer": [[35, null]], "Create your plugin from a template": [[72, null]], "Creating and registering a Transformer": [[34, null]], "Data Goes In /data/": [[9, "data-goes-in-data"]], "Data factories for usage examples": [[49, "data-factories-for-usage-examples"]], "Decentralized retrospective provenance tracking": [[15, null]], "Define a citation for this action": [[67, "define-a-citation-for-this-action"]], "Define a transformer from skbio.DNA to q2_dwq2.SingleRecordDNAFASTAFormat": [[64, "define-a-transformer-from-skbio-dna-to-q2-dwq2-singlerecorddnafastaformat"]], "Define input data for your usage example": [[70, "define-input-data-for-your-usage-example"]], "Defining a Type": [[16, "defining-a-type"]], "Defining a new directory format": [[66, "defining-a-new-directory-format"]], "Defining a new file format": [[66, "defining-a-new-file-format"]], "Defining a new semantic type": [[66, "defining-a-new-semantic-type"]], "Defining a split Method": [[68, "defining-a-split-method"]], "Defining a usage example for nw-align": [[70, "defining-a-usage-example-for-nw-align"]], "Defining and registering a combine method": [[68, "defining-and-registering-a-combine-method"]], "Defining and registering a transformer": [[66, "defining-and-registering-a-transformer"]], "Defining different Format validation levels": [[39, null]], "Defining the usage example": [[70, "defining-the-usage-example"]], "Defining usage examples": [[49, "defining-usage-examples"]], "Defining your plugin object as an entry point": [[45, "defining-your-plugin-object-as-an-entry-point"]], "Dependent Types": [[59, "dependent-types"]], "Detailed Component Diagram": [[8, "detailed-component-diagram"]], "Developer documentation": [[5, null]], "Developing a new artifact class": [[66, "developing-a-new-artifact-class"]], "Developing with QIIME 2": [[24, null]], "Development status of this content": [[24, null]], "Developmental Best Practices": [[19, "developmental-best-practices"]], "Directory Formats": [[11, "directory-formats"]], "Discovering artifact classes": [[66, "discovering-artifact-classes"]], "Displaying usage examples": [[70, "displaying-usage-examples"]], "Distribute plugins on GitHub": [[36, null]], "Distribute plugins on QIIME 2 Library": [[37, null]], "Distribution Development": [[4, null]], "Docs Development": [[6, null]], "Dropping Empty Columns": [[50, "dropping-empty-columns"]], "Examples": [[48, "examples"]], "Exceptions": [[22, "exceptions"], [63, "exceptions"]], "Expanding on the install instructions": [[36, "expanding-on-the-install-instructions"]], "Explanations": [[13, null], [26, null]], "Extending a Type": [[16, "extending-a-type"]], "Facilitating installation of your plugin for users": [[38, null]], "File Formats": [[11, "file-formats"]], "File Formats and Directory Formats": [[11, null]], "File types (or formats) and data types (or objects)": [[29, "file-types-or-formats-and-data-types-or-objects"]], "Finding docstring sources": [[5, "finding-docstring-sources"]], "Fixed Layouts": [[11, "fixed-layouts"]], "Following A Command Through QIIME 2": [[8, "following-a-command-through-qiime-2"]], "Formats": [[55, null]], "Framework Development": [[17, null]], "Funding": [[24, "funding"]], "Garbage Collection": [[12, null]], "General Utils": [[61, "general-utils"]], "Generating metadata as output from visualizations": [[50, "generating-metadata-as-output-from-visualizations"]], "Getting Feedback on your Plugin": [[42, "getting-feedback-on-your-plugin"]], "Getting Help": [[24, "getting-help"]], "Glossary": [[2, null]], "Goals for data storage in QIIME 2": [[10, "goals-for-data-storage-in-qiime-2"]], "Handling exceptions in parallel Pipelines": [[40, null]], "Help others understand how your tool will help them": [[44, "help-others-understand-how-your-tool-will-help-them"]], "Hint": [[69, null]], "How Data is Stored": [[10, null]], "How are transformers used by a plugin?": [[28, "how-are-transformers-used-by-a-plugin"]], "How can the Metadata API Help Me?": [[50, "how-can-the-metadata-api-help-me"]], "How to play nicely with other plugins": [[43, null]], "How to test QIIME 2 plugins": [[48, null]], "How to use Metadata": [[50, null]], "How-To Guides": [[41, null]], "Importing": [[60, "importing"]], "Index": [[1, null]], "Individual Topics": [[56, "individual-topics"]], "Initializers": [[60, "initializers"]], "Input Validation (Type Checking)": [[10, "input-validation-type-checking"]], "Inputs and outputs": [[22, "inputs-and-outputs"]], "Install Prerequisites": [[46, "install-prerequisites"]], "Install and test your new plugin": [[72, "install-and-test-your-new-plugin"]], "Install the latest development version of the QIIME 2 \u201cTiny Distribution\u201d": [[46, "install-the-latest-development-version-of-the-qiime-2-tiny-distribution"]], "Install the tools needed for templating your plugin": [[72, "install-the-tools-needed-for-templating-your-plugin"]], "Installing other QIIME 2 distributions": [[46, "installing-other-qiime-2-distributions"]], "Installing your plugin on top of an existing QIIME 2 Distribution (recommended)": [[38, "installing-your-plugin-on-top-of-an-existing-qiime-2-distribution-recommended"]], "Installing your plugin using the Tiny Distribution and any custom required plugins": [[38, "installing-your-plugin-using-the-tiny-distribution-and-any-custom-required-plugins"]], "Instantiating a plugin": [[45, "instantiating-a-plugin"]], "Integrate metadata in Actions": [[73, null]], "Interface Developer Note:": [[16, null]], "Interface Development": [[21, null]], "Interface developer API reference": [[22, null]], "Interface development API": [[22, "interface-development-api"]], "Interoperability and Extension": [[10, "interoperability-and-extension"]], "Intersections": [[16, "intersections"]], "Issue/Pull Request Prefixes": [[19, "issue-pull-request-prefixes"]], "License": [[24, "license"]], "List of works cited": [[0, null]], "Making Artifacts Viewable as Metadata": [[50, "making-artifacts-viewable-as-metadata"]], "Making the new type and formats publicly importable": [[66, "making-the-new-type-and-formats-publicly-importable"]], "Maximize compatibility between your plugin(s) and existing QIIME 2 distribution(s)": [[42, null]], "Merging Metadata": [[50, "merging-metadata"]], "Metadata": [[50, "metadata"], [59, "metadata"], [60, "metadata"]], "Metadata Columns": [[50, "metadata-columns"]], "Metadata columns": [[63, "metadata-columns"]], "Metagenome distribution": [[46, "metagenome-distribution"]], "Metaprogramming": [[14, null]], "Misc/non-standard development": [[19, "misc-non-standard-development"]], "Next steps": [[46, "next-steps"]], "Normalizing TSV Files": [[50, "normalizing-tsv-files"]], "Numeric Metadata Columns": [[50, "numeric-metadata-columns"]], "Optional exercise": [[70, "optional-exercise"]], "Optionally initialize a git repository during plugin templating": [[72, null]], "Overview": [[45, "overview"]], "Pairwise sequence alignment": [[67, "pairwise-sequence-alignment"]], "Parameter Objects for Usage.action": [[60, "parameter-objects-for"]], "Pipeline Context Object": [[54, null]], "Pipeline Provenance": [[15, "pipeline-provenance"]], "Pipeline provenance example": [[15, "pipeline-provenance-example"]], "Pipeline provenance take-aways": [[15, "pipeline-provenance-take-aways"]], "Pipeline resumption \u267b\ufe0f": [[68, null]], "Plans for refactoring of user documentation": [[7, "plans-for-refactoring-of-user-documentation"]], "Plugin & Registration": [[57, null]], "Plugin API List": [[56, "plugin-api-list"]], "Plugin Development": [[51, null]], "Plugin Development API": [[56, null]], "Plugin Utils": [[61, "plugin-utils"]], "Plugin development anti-patterns": [[52, null]], "Post a pre-print": [[44, "post-a-pre-print"]], "Predicates": [[59, "predicates"], [59, "id1"]], "Primitive Types": [[16, "primitive-types"]], "Primitive types": [[59, "primitive-types"]], "Properties": [[16, "properties"]], "Provenance Goes In /provenance/": [[9, "provenance-goes-in-provenance"]], "Provenance Metadata": [[10, "provenance-metadata"]], "Provide technical support for your users": [[47, null]], "Providing input or output filepaths as parameters": [[52, "providing-input-or-output-filepaths-as-parameters"]], "Publicize your QIIME 2 plugins (or other QIIME 2-based tools)": [[44, null]], "Putting it together": [[29, "putting-it-together"]], "Python 3 API": [[70, "python-3-api"]], "QIIME 2 Development Cycle Structure": [[19, "qiime-2-development-cycle-structure"]], "QIIME 2 Development and Release Cycle Structure": [[19, null]], "QIIME 2 Library": [[44, "qiime-2-library"]], "QIIME 2 Release Cycle Structure": [[19, "qiime-2-release-cycle-structure"]], "QIIME 2 architecture overview": [[8, null]], "Range": [[16, "range"]], "References": [[20, null], [23, null], [62, null]], "Refining a Type": [[16, "refining-a-type"]], "Register a QIIME 2 plugin": [[45, null]], "Register the Method": [[32, "register-the-method"]], "Register the Pipeline": [[69, "register-the-pipeline"]], "Register the Visualizer": [[35, "register-the-visualizer"]], "Register the action in plugin_setup.py": [[67, "register-the-action-in-plugin-setup-py"]], "Register the wrapper function as a plugin action": [[67, "register-the-wrapper-function-as-a-plugin-action"]], "Register your Python function as a plugin action": [[65, "register-your-python-function-as-a-plugin-action"]], "Registering an Action that Returns an Output Collection": [[30, "registering-an-action-that-returns-an-output-collection"]], "Registering an Action that Takes an Input Collection": [[30, "registering-an-action-that-takes-an-input-collection"]], "Registering an artifact class": [[66, "registering-an-artifact-class"]], "Registering split_sequences": [[68, "registering-split-sequences"]], "Registering the Pipeline": [[33, "registering-the-pipeline"]], "Registering the type, formats, and artifact class": [[66, "registering-the-type-formats-and-artifact-class"]], "Registering the usage example": [[70, "registering-the-usage-example"]], "Registering usage examples": [[49, "registering-usage-examples"]], "Requesting addition of your plugin to the Library": [[37, "requesting-addition-of-your-plugin-to-the-library"]], "Requirements before requesting the addition of your plugin to the Library": [[37, "requirements-before-requesting-the-addition-of-your-plugin-to-the-library"]], "Results and Assertions": [[60, "results-and-assertions"]], "Rules for identifying an archive": [[9, "rules-for-identifying-an-archive"]], "Run cookiecutter to create your plugin": [[72, "run-cookiecutter-to-create-your-plugin"]], "SQL Filtering": [[50, "sql-filtering"]], "Semantic Properties": [[16, "semantic-properties"]], "Semantic Subtyping": [[16, "semantic-subtyping"]], "Semantic Type": [[59, "semantic-type"]], "Semantic Types, Primitives, and Visualizations": [[16, null]], "Semantic types": [[29, "semantic-types"]], "Semantic types, data types, file formats, and artifact classes": [[29, null]], "Set up your development environment": [[46, null]], "Setting up your development environment": [[24, null]], "Share your plugin on GitHub": [[36, "share-your-plugin-on-github"]], "Should our sequence splitter take the size of each split or the number of splits to create as input?": [[68, null]], "Single File Directory Formats": [[11, "single-file-directory-formats"]], "Skipping format validation": [[52, "skipping-format-validation"]], "Standard/plugin-specific development": [[19, "standard-plugin-specific-development"]], "Summary": [[8, "summary"]], "Template your plugin": [[36, "template-your-plugin"]], "Testing": [[58, null]], "Testing the parallel Pipeline": [[68, "testing-the-parallel-pipeline"]], "Testing the semantic type and formats": [[66, "testing-the-semantic-type-and-formats"]], "Testing the transformer": [[66, "testing-the-transformer"]], "Testing usage examples": [[49, "testing-usage-examples"]], "Text File Formats": [[11, "text-file-formats"]], "The Most Important File: metadata.yaml": [[9, "the-most-important-file-metadata-yaml"]], "The PluginManager Object": [[22, "the-pluginmanager-object"]], "The ResultCollection object": [[30, "the-resultcollection-object"]], "The action block": [[15, "the-action-block"]], "The action.yaml file": [[15, "the-action-yaml-file"]], "The environment block": [[15, "the-environment-block"]], "The execution block": [[15, "the-execution-block"]], "The input metadata": [[73, "the-input-metadata"]], "The qiime.Metadata class": [[63, "the-qiime-metadata-class"]], "The structure of QIIME 2 plugin packages": [[27, null]], "Transformers": [[28, null]], "Trying it out": [[49, "trying-it-out"]], "Trying the new action": [[67, "trying-the-new-action"]], "Tutorial table of contents": [[74, "tutorial-table-of-contents"]], "Tutorial: A step-by-step guide to building your first QIIME 2 plugin": [[74, null]], "Types": [[59, null]], "Types of QIIME 2 Actions": [[25, null]], "Unions": [[16, "unions"]], "Unique IDs": [[15, "unique-ids"]], "Unit testing": [[66, "unit-testing"]], "Unit testing the visualizer function": [[65, "unit-testing-the-visualizer-function"]], "Update plugin_setup.py": [[73, "update-plugin-setup-py"]], "Update search-and-summarize": [[73, "update-search-and-summarize"]], "Update search-and-summarize to use split and combine Methods": [[68, "update-search-and-summarize-to-use-split-and-combine-methods"]], "Update the nw_align action to avoid duplicating information": [[69, "update-the-nw-align-action-to-avoid-duplicating-information"]], "Updating nw-align to use the new artifact class": [[66, "updating-nw-align-to-use-the-new-artifact-class"]], "Usage Examples": [[60, null]], "Use Artifact Collections as Action inputs or outputs": [[30, null]], "User Metadata API": [[63, null]], "User documentation": [[7, null]], "Using Collections": [[30, "using-collections"]], "Using Collections with the Python API": [[30, "using-collections-with-the-python-api"]], "Using Collections with the command line interface (CLI)": [[30, "using-collections-with-the-command-line-interface-cli"]], "Utilities": [[61, null]], "Utility functions": [[22, "utility-functions"]], "Validation": [[11, "validation"]], "Variable Layouts": [[11, "variable-layouts"]], "Version-agnostic format guarantees": [[18, "version-agnostic-format-guarantees"]], "Visualization type": [[59, "visualization-type"]], "What Provenance Data is Captured?": [[15, "what-provenance-data-is-captured"]], "What to test and what not to test": [[67, "what-to-test-and-what-not-to-test"]], "Why Capture Provenance Data?": [[15, "why-capture-provenance-data"]], "Why a ZIP File?": [[9, "why-a-zip-file"]], "Wrapping up testing": [[67, "wrapping-up-testing"]], "Write a wrapper function": [[67, "write-a-wrapper-function"]], "Write the visualizer function": [[65, "write-the-visualizer-function"]], "Write unit tests": [[67, "write-unit-tests"]], "Writing Usage Examples": [[49, null]], "Writing tutorials": [[70, "writing-tutorials"]], "init": [[30, "init"]], "load": [[30, "load"]], "q2-dwq2": [[27, "q2-dwq2"]], "q2-dwq2/.git": [[27, "q2-dwq2-git"]], "q2-dwq2/.github": [[27, "q2-dwq2-github"]], "q2-dwq2/.gitignore": [[27, "q2-dwq2-gitignore"]], "q2-dwq2/LICENSE": [[27, "q2-dwq2-license"]], "q2-dwq2/MANIFEST.in": [[27, "q2-dwq2-manifest-in"]], "q2-dwq2/Makefile": [[27, "q2-dwq2-makefile"]], "q2-dwq2/README.md": [[27, "q2-dwq2-readme-md"]], "q2-dwq2/ci": [[27, "q2-dwq2-ci"]], "q2-dwq2/q2_dwq2": [[27, "q2-dwq2-q2-dwq2"]], "q2-dwq2/q2_dwq2/__init__.py": [[27, "q2-dwq2-q2-dwq2-init-py"]], "q2-dwq2/q2_dwq2/_methods.py": [[27, "q2-dwq2-q2-dwq2-methods-py"]], "q2-dwq2/q2_dwq2/_version.py": [[27, "q2-dwq2-q2-dwq2-version-py"]], "q2-dwq2/q2_dwq2/citations.bib": [[27, "q2-dwq2-q2-dwq2-citations-bib"]], "q2-dwq2/q2_dwq2/plugin_setup.py": [[27, "q2-dwq2-q2-dwq2-plugin-setup-py"]], "q2-dwq2/q2_dwq2/setup.cfg": [[27, "q2-dwq2-q2-dwq2-setup-cfg"]], "q2-dwq2/q2_dwq2/setup.py": [[27, "q2-dwq2-q2-dwq2-setup-py"]], "q2-dwq2/q2_dwq2/tests": [[27, "q2-dwq2-q2-dwq2-tests"]], "q2-dwq2/q2_dwq2/tests/__init__.py": [[27, "q2-dwq2-q2-dwq2-tests-init-py"]], "q2-dwq2/q2_dwq2/tests/data": [[27, "q2-dwq2-q2-dwq2-tests-data"]], "q2-dwq2/q2_dwq2/tests/test_methods.py": [[27, "q2-dwq2-q2-dwq2-tests-test-methods-py"]], "q2-dwq2/q2_dwq2/versioneer.py": [[27, "q2-dwq2-q2-dwq2-versioneer-py"]], "save": [[30, "save"]], "split-apply-combine flowchart for search and summarize": [[68, "split-apply-combine-flowchart"]], "tl;dr": [[64, null], [65, "add-alignment-visualizer-commit"], [66, "add-artifact-class-commit"], [67, "add-nw-align-method-commit"], [68, "add-parallel-pipeline-commits"], [69, "add-pipeline-commit"], [70, "add-usage-example-commit"], [73, "integrate-metadata-commits"]]}, "docnames": ["back-matter/bibliography", "back-matter/genindex", "back-matter/glossary", "back-matter/intro", "ci/intro", "docs/developer-documentation", "docs/intro", "docs/user-documentation", "framework/explanations/architecture", "framework/explanations/archives", "framework/explanations/data-storage", "framework/explanations/formats", "framework/explanations/garbage-collection", "framework/explanations/intro", "framework/explanations/metaprogramming", "framework/explanations/provenance", "framework/explanations/types", "framework/intro", "framework/references/archive-versions", "framework/references/dev-cycle-structure", "framework/references/intro", "interfaces/intro", "interfaces/references/api", "interfaces/references/intro", "intro", "plugins/explanations/actions", "plugins/explanations/intro", "plugins/explanations/package-structure", "plugins/explanations/transformers", "plugins/explanations/types-of-types", "plugins/how-to-guides/artifact-collections-as-io", "plugins/how-to-guides/automate-testing", "plugins/how-to-guides/create-register-method", "plugins/how-to-guides/create-register-pipeline", "plugins/how-to-guides/create-register-transformer", "plugins/how-to-guides/create-register-visualizer", "plugins/how-to-guides/distribute-on-gh", "plugins/how-to-guides/distribute-on-library", "plugins/how-to-guides/facilitate-installation", "plugins/how-to-guides/format-validation-levels", "plugins/how-to-guides/handle-exceptions-in-parallel-pipelines", "plugins/how-to-guides/intro", "plugins/how-to-guides/maximize-compatibility", "plugins/how-to-guides/play-nicely-with-others", "plugins/how-to-guides/publicize", "plugins/how-to-guides/register-a-plugin", "plugins/how-to-guides/set-up-development-environment", "plugins/how-to-guides/support-your-users", "plugins/how-to-guides/test-plugins", "plugins/how-to-guides/usage-examples", "plugins/how-to-guides/use-metadata", "plugins/intro", "plugins/references/antipatterns", "plugins/references/api/citations", "plugins/references/api/context", "plugins/references/api/formats", "plugins/references/api/intro", "plugins/references/api/plugin", "plugins/references/api/testing", "plugins/references/api/types", "plugins/references/api/usage", "plugins/references/api/utils", "plugins/references/intro", "plugins/references/metadata-api", "plugins/tutorials/add-2nd-transformer", "plugins/tutorials/add-alignment-visualizer", "plugins/tutorials/add-artifact-class", "plugins/tutorials/add-nw-align-method", "plugins/tutorials/add-parallel-pipeline", "plugins/tutorials/add-pipeline", "plugins/tutorials/add-usage-examples", "plugins/tutorials/conclusion", "plugins/tutorials/create-from-template", "plugins/tutorials/integrate-metadata", "plugins/tutorials/intro"], "envversion": {"sphinx": 62, "sphinx.domains.c": 3, "sphinx.domains.changeset": 1, "sphinx.domains.citation": 1, "sphinx.domains.cpp": 9, "sphinx.domains.index": 1, "sphinx.domains.javascript": 3, "sphinx.domains.math": 2, "sphinx.domains.python": 4, "sphinx.domains.rst": 2, "sphinx.domains.std": 2, "sphinx.ext.intersphinx": 1, "sphinxcontrib.bibtex": 9}, "filenames": ["back-matter/bibliography.md", "back-matter/genindex.md", "back-matter/glossary.md", "back-matter/intro.md", "ci/intro.md", "docs/developer-documentation.md", "docs/intro.md", "docs/user-documentation.md", "framework/explanations/architecture.md", "framework/explanations/archives.md", "framework/explanations/data-storage.md", "framework/explanations/formats.md", "framework/explanations/garbage-collection.md", "framework/explanations/intro.md", "framework/explanations/metaprogramming.md", "framework/explanations/provenance.md", "framework/explanations/types.md", "framework/intro.md", "framework/references/archive-versions.md", "framework/references/dev-cycle-structure.md", "framework/references/intro.md", "interfaces/intro.md", "interfaces/references/api.md", "interfaces/references/intro.md", "intro.md", "plugins/explanations/actions.md", "plugins/explanations/intro.md", "plugins/explanations/package-structure.md", "plugins/explanations/transformers.md", "plugins/explanations/types-of-types.md", "plugins/how-to-guides/artifact-collections-as-io.md", "plugins/how-to-guides/automate-testing.md", "plugins/how-to-guides/create-register-method.md", "plugins/how-to-guides/create-register-pipeline.md", "plugins/how-to-guides/create-register-transformer.md", "plugins/how-to-guides/create-register-visualizer.md", "plugins/how-to-guides/distribute-on-gh.md", "plugins/how-to-guides/distribute-on-library.md", "plugins/how-to-guides/facilitate-installation.md", "plugins/how-to-guides/format-validation-levels.md", "plugins/how-to-guides/handle-exceptions-in-parallel-pipelines.md", "plugins/how-to-guides/intro.md", "plugins/how-to-guides/maximize-compatibility.md", "plugins/how-to-guides/play-nicely-with-others.md", "plugins/how-to-guides/publicize.md", "plugins/how-to-guides/register-a-plugin.md", "plugins/how-to-guides/set-up-development-environment.md", "plugins/how-to-guides/support-your-users.md", "plugins/how-to-guides/test-plugins.md", "plugins/how-to-guides/usage-examples.md", "plugins/how-to-guides/use-metadata.md", "plugins/intro.md", "plugins/references/antipatterns.md", "plugins/references/api/citations.md", "plugins/references/api/context.md", "plugins/references/api/formats.md", "plugins/references/api/intro.md", "plugins/references/api/plugin.md", "plugins/references/api/testing.md", "plugins/references/api/types.md", "plugins/references/api/usage.md", "plugins/references/api/utils.md", "plugins/references/intro.md", "plugins/references/metadata-api.md", "plugins/tutorials/add-2nd-transformer.md", "plugins/tutorials/add-alignment-visualizer.md", "plugins/tutorials/add-artifact-class.md", "plugins/tutorials/add-nw-align-method.md", "plugins/tutorials/add-parallel-pipeline.md", "plugins/tutorials/add-pipeline.md", "plugins/tutorials/add-usage-examples.md", "plugins/tutorials/conclusion.md", "plugins/tutorials/create-from-template.md", "plugins/tutorials/integrate-metadata.md", "plugins/tutorials/intro.md"], "indexentries": {"__iter__() (qiime2.plugin.citations method)": [[53, "qiime2.plugin.Citations.__iter__", false]], "action": [[2, "term-Action", true]], "action() (in module qiime2.sdk)": [[22, "qiime2.sdk.Action", false]], "action() (qiime2.sdk.usage.usage method)": [[60, "qiime2.sdk.usage.Usage.action", false]], "archive": [[2, "term-Archive", true]], "artifact": [[2, "term-Artifact", true]], "artifact api": [[2, "term-Artifact-API", true]], "artifact class": [[2, "term-Artifact-class", true]], "artifact() (in module qiime2.sdk)": [[22, "qiime2.sdk.Artifact", false]], "assert_has_line_matching() (qiime2.sdk.usage.usagevariable method)": [[60, "qiime2.sdk.usage.UsageVariable.assert_has_line_matching", false]], "assert_no_nans_in_tables() (in module qiime2.plugin.testing)": [[58, "qiime2.plugin.testing.assert_no_nans_in_tables", false]], "assert_output_type() (qiime2.sdk.usage.usagevariable method)": [[60, "qiime2.sdk.usage.UsageVariable.assert_output_type", false]], "assertregisteredsemantictype() (qiime2.plugin.testing.testpluginbase method)": [[58, "qiime2.plugin.testing.TestPluginBase.assertRegisteredSemanticType", false]], "assertsemantictyperegisteredtoformat() (qiime2.plugin.testing.testpluginbase method)": [[58, "qiime2.plugin.testing.TestPluginBase.assertSemanticTypeRegisteredToFormat", false]], "binaryfileformat (class in qiime2.plugin)": [[55, "qiime2.plugin.BinaryFileFormat", false]], "bool (in module qiime2.plugin)": [[59, "qiime2.plugin.Bool", false]], "categorical (in module qiime2.plugin)": [[59, "qiime2.plugin.Categorical", false]], "categoricalmetadatacolumn (class in qiime2)": [[63, "qiime2.CategoricalMetadataColumn", false]], "choices (class in qiime2.plugin)": [[59, "qiime2.plugin.Choices", false]], "citationrecord (class in qiime2.plugin)": [[53, "qiime2.plugin.CitationRecord", false]], "citations (class in qiime2.plugin)": [[53, "qiime2.plugin.Citations", false]], "collection (in module qiime2.plugin)": [[59, "qiime2.plugin.Collection", false]], "column_count (qiime2.metadata property)": [[63, "qiime2.Metadata.column_count", false]], "columns (qiime2.metadata property)": [[63, "qiime2.Metadata.columns", false]], "comment() (qiime2.sdk.usage.usage method)": [[60, "qiime2.sdk.usage.Usage.comment", false]], "conda metapackage": [[2, "term-Conda-metapackage", true]], "construct_artifact_collection() (qiime2.sdk.usage.usage method)": [[60, "qiime2.sdk.usage.Usage.construct_artifact_collection", false]], "deployment": [[2, "term-Deployment", true]], "directory format": [[2, "term-Directory-Format", true]], "directoryformat (class in qiime2.plugin)": [[55, "qiime2.plugin.DirectoryFormat", false]], "distribution": [[2, "term-Distribution", true]], "dr": [[2, "term-tl-dr", true]], "drop_missing_values() (qiime2.metadatacolumn method)": [[63, "qiime2.MetadataColumn.drop_missing_values", false]], "dry": [[2, "term-DRY", true]], "duplicate() (in module qiime2.util)": [[61, "qiime2.util.duplicate", false]], "end() (in module qiime2.plugin)": [[59, "qiime2.plugin.End", false]], "execute_examples() (qiime2.plugin.testing.testpluginbase method)": [[58, "qiime2.plugin.testing.TestPluginBase.execute_examples", false]], "file format": [[2, "term-File-Format", true]], "filter_columns() (qiime2.metadata method)": [[63, "qiime2.Metadata.filter_columns", false]], "filter_ids() (qiime2.metadata method)": [[63, "qiime2.Metadata.filter_ids", false]], "filter_ids() (qiime2.metadatacolumn method)": [[63, "qiime2.MetadataColumn.filter_ids", false]], "float (in module qiime2.plugin)": [[59, "qiime2.plugin.Float", false]], "format": [[2, "term-Format", true]], "framework": [[2, "term-Framework", true]], "galaxy": [[2, "term-Galaxy", true]], "get_action() (qiime2.sdk.context method)": [[54, "qiime2.sdk.Context.get_action", false]], "get_artifact_collection_member() (qiime2.sdk.usage.usage method)": [[60, "qiime2.sdk.usage.Usage.get_artifact_collection_member", false]], "get_available_cores() (in module qiime2.plugin.util)": [[61, "qiime2.plugin.util.get_available_cores", false]], "get_column() (qiime2.metadata method)": [[63, "qiime2.Metadata.get_column", false]], "get_data_path() (qiime2.plugin.testing.testpluginbase method)": [[58, "qiime2.plugin.testing.TestPluginBase.get_data_path", false]], "get_ids() (qiime2.metadata method)": [[63, "qiime2.Metadata.get_ids", false]], "get_ids() (qiime2.metadatacolumn method)": [[63, "qiime2.MetadataColumn.get_ids", false]], "get_metadata_column() (qiime2.sdk.usage.usage method)": [[60, "qiime2.sdk.usage.Usage.get_metadata_column", false]], "get_missing() (qiime2.metadatacolumn method)": [[63, "qiime2.MetadataColumn.get_missing", false]], "get_transformer() (qiime2.plugin.testing.testpluginbase method)": [[58, "qiime2.plugin.testing.TestPluginBase.get_transformer", false]], "get_value() (qiime2.metadatacolumn method)": [[63, "qiime2.MetadataColumn.get_value", false]], "has_missing_values() (qiime2.metadatacolumn method)": [[63, "qiime2.MetadataColumn.has_missing_values", false]], "help() (qiime2.sdk.usage.usage method)": [[60, "qiime2.sdk.usage.Usage.help", false]], "identifier": [[2, "term-Identifier", true]], "identity": [[2, "term-Identity", true]], "implementationerror() (in module qiime2.sdk)": [[22, "qiime2.sdk.ImplementationError", false]], "import_from_format() (qiime2.sdk.usage.usage method)": [[60, "qiime2.sdk.usage.Usage.import_from_format", false]], "init_artifact() (qiime2.sdk.usage.usage method)": [[60, "qiime2.sdk.usage.Usage.init_artifact", false]], "init_artifact_collection() (qiime2.sdk.usage.usage method)": [[60, "qiime2.sdk.usage.Usage.init_artifact_collection", false]], "init_artifact_from_url() (qiime2.sdk.usage.usage method)": [[60, "qiime2.sdk.usage.Usage.init_artifact_from_url", false]], "init_format() (qiime2.sdk.usage.usage method)": [[60, "qiime2.sdk.usage.Usage.init_format", false]], "init_metadata() (qiime2.sdk.usage.usage method)": [[60, "qiime2.sdk.usage.Usage.init_metadata", false]], "init_metadata_from_url() (qiime2.sdk.usage.usage method)": [[60, "qiime2.sdk.usage.Usage.init_metadata_from_url", false]], "input": [[2, "term-Input", true]], "int (in module qiime2.plugin)": [[59, "qiime2.plugin.Int", false]], "interface": [[2, "term-Interface", true]], "jobs (in module qiime2.plugin)": [[59, "qiime2.plugin.Jobs", false]], "list (in module qiime2.plugin)": [[59, "qiime2.plugin.List", false]], "load() (qiime2.metadata class method)": [[63, "qiime2.Metadata.load", false]], "load() (qiime2.plugin.citations class method)": [[53, "qiime2.plugin.Citations.load", false]], "make_artifact() (qiime2.sdk.context method)": [[54, "qiime2.sdk.Context.make_artifact", false]], "merge() (qiime2.metadata method)": [[63, "qiime2.Metadata.merge", false]], "merge_metadata() (qiime2.sdk.usage.usage method)": [[60, "qiime2.sdk.usage.Usage.merge_metadata", false]], "metadata": [[2, "term-Metadata", true]], "metadata (class in qiime2)": [[63, "qiime2.Metadata", false]], "metadata (in module qiime2.plugin)": [[59, "qiime2.plugin.Metadata", false]], "metadatacolumn (class in qiime2)": [[63, "qiime2.MetadataColumn", false]], "metadatacolumn (in module qiime2.plugin)": [[59, "qiime2.plugin.MetadataColumn", false]], "metadatafileerror (class in qiime2.metadata)": [[63, "qiime2.metadata.MetadataFileError", false]], "method": [[2, "term-Method", true]], "method() (in module qiime2.sdk)": [[22, "qiime2.sdk.Method", false]], "missing_scheme (qiime2.metadatacolumn property)": [[63, "qiime2.MetadataColumn.missing_scheme", false]], "name (qiime2.metadatacolumn property)": [[63, "qiime2.MetadataColumn.name", false]], "numeric (in module qiime2.plugin)": [[59, "qiime2.plugin.Numeric", false]], "numericmetadatacolumn (class in qiime2)": [[63, "qiime2.NumericMetadataColumn", false]], "output": [[2, "term-Output", true]], "package (qiime2.plugin.testing.testpluginbase attribute)": [[58, "qiime2.plugin.testing.TestPluginBase.package", false]], "pairwise sequence alignment": [[2, "term-Pairwise-sequence-alignment", true]], "parameter": [[2, "term-Parameter", true]], "parse_format() (in module qiime2.sdk)": [[22, "qiime2.sdk.parse_format", false]], "parse_type() (in module qiime2.sdk)": [[22, "qiime2.sdk.parse_type", false]], "payload": [[2, "term-Payload", true]], "peek() (qiime2.sdk.usage.usage method)": [[60, "qiime2.sdk.usage.Usage.peek", false]], "pipeline": [[2, "term-Pipeline", true]], "pipeline() (in module qiime2.sdk)": [[22, "qiime2.sdk.Pipeline", false]], "plugin": [[2, "term-Plugin", true]], "plugin (class in qiime2.plugin)": [[57, "qiime2.plugin.Plugin", false]], "plugin manager": [[2, "term-Plugin-Manager", true]], "pluginmanager() (in module qiime2.sdk)": [[22, "qiime2.sdk.PluginManager", false]], "pluginmethods (class in qiime2.plugin.plugin)": [[57, "qiime2.plugin.plugin.PluginMethods", false]], "pluginpipelines (class in qiime2.plugin.plugin)": [[57, "qiime2.plugin.plugin.PluginPipelines", false]], "pluginvisualizers (class in qiime2.plugin.plugin)": [[57, "qiime2.plugin.plugin.PluginVisualizers", false]], "primitive type": [[2, "term-Primitive-Type", true]], "properties (class in qiime2.plugin)": [[59, "qiime2.plugin.Properties", false]], "provenance": [[2, "term-Provenance", true]], "provenance replay": [[2, "term-Provenance-Replay", true]], "python 3 api": [[2, "term-Python-3-API", true]], "q2cli": [[2, "term-q2cli", true]], "range (class in qiime2.plugin)": [[59, "qiime2.plugin.Range", false]], "redirected_stdio() (in module qiime2.util)": [[61, "qiime2.util.redirected_stdio", false]], "register_artifact_class() (qiime2.plugin.plugin method)": [[57, "qiime2.plugin.Plugin.register_artifact_class", false]], "register_formats() (qiime2.plugin.plugin method)": [[57, "qiime2.plugin.Plugin.register_formats", false]], "register_function() (qiime2.plugin.plugin.pluginmethods method)": [[57, "qiime2.plugin.plugin.PluginMethods.register_function", false]], "register_function() (qiime2.plugin.plugin.pluginpipelines method)": [[57, "qiime2.plugin.plugin.PluginPipelines.register_function", false]], "register_function() (qiime2.plugin.plugin.pluginvisualizers method)": [[57, "qiime2.plugin.plugin.PluginVisualizers.register_function", false]], "register_semantic_type_to_format() (qiime2.plugin.plugin method)": [[57, "qiime2.plugin.Plugin.register_semantic_type_to_format", false]], "register_semantic_types() (qiime2.plugin.plugin method)": [[57, "qiime2.plugin.Plugin.register_semantic_types", false]], "register_transformer() (qiime2.plugin.plugin method)": [[57, "qiime2.plugin.Plugin.register_transformer", false]], "register_validator() (qiime2.plugin.plugin method)": [[57, "qiime2.plugin.Plugin.register_validator", false]], "register_views() (qiime2.plugin.plugin method)": [[57, "qiime2.plugin.Plugin.register_views", false]], "result": [[2, "term-Result", true]], "result() (in module qiime2.sdk)": [[22, "qiime2.sdk.Result", false]], "resultcollection() (in module qiime2.sdk)": [[22, "qiime2.sdk.ResultCollection", false]], "results() (in module qiime2.sdk)": [[22, "qiime2.sdk.Results", false]], "save() (qiime2.plugin.citations method)": [[53, "qiime2.plugin.Citations.save", false]], "semantic type": [[2, "term-Semantic-Type", true]], "semantictype() (in module qiime2.plugin)": [[59, "qiime2.plugin.SemanticType", false]], "set (in module qiime2.plugin)": [[59, "qiime2.plugin.Set", false]], "setup() (qiime2.plugin.testing.testpluginbase method)": [[58, "qiime2.plugin.testing.TestPluginBase.setUp", false]], "single-use plugin (sup)": [[2, "term-Single-Use-Plugin-SUP", true]], "singlefiledirectoryformat() (in module qiime2.plugin)": [[55, "qiime2.plugin.SingleFileDirectoryFormat", false]], "start() (in module qiime2.plugin)": [[59, "qiime2.plugin.Start", false]], "str (in module qiime2.plugin)": [[59, "qiime2.plugin.Str", false]], "teardown() (qiime2.plugin.testing.testpluginbase method)": [[58, "qiime2.plugin.testing.TestPluginBase.tearDown", false]], "test_dir_prefix (qiime2.plugin.testing.testpluginbase attribute)": [[58, "qiime2.plugin.testing.TestPluginBase.test_dir_prefix", false]], "testpluginbase (class in qiime2.plugin.testing)": [[58, "qiime2.plugin.testing.TestPluginBase", false]], "textfileformat (class in qiime2.plugin)": [[55, "qiime2.plugin.TextFileFormat", false]], "threads (in module qiime2.plugin)": [[59, "qiime2.plugin.Threads", false]], "tl": [[2, "term-tl-dr", true]], "to_dataframe() (qiime2.metadata method)": [[63, "qiime2.Metadata.to_dataframe", false]], "to_dataframe() (qiime2.metadatacolumn method)": [[63, "qiime2.MetadataColumn.to_dataframe", false]], "to_series() (qiime2.metadatacolumn method)": [[63, "qiime2.MetadataColumn.to_series", false]], "transform() (in module qiime2.plugin.util)": [[61, "qiime2.plugin.util.transform", false]], "transform_format() (qiime2.plugin.testing.testpluginbase method)": [[58, "qiime2.plugin.testing.TestPluginBase.transform_format", false]], "transformer": [[2, "term-Transformer", true]], "type": [[2, "term-Type", true]], "type_from_ast() (in module qiime2.sdk)": [[22, "qiime2.sdk.type_from_ast", false]], "typemap (class in qiime2.plugin)": [[59, "qiime2.plugin.TypeMap", false]], "typematch (class in qiime2.plugin)": [[59, "qiime2.plugin.TypeMatch", false]], "uninitializedpluginmanagererror() (in module qiime2.sdk)": [[22, "qiime2.sdk.UninitializedPluginManagerError", false]], "usageaction (class in qiime2.sdk.usage)": [[60, "qiime2.sdk.usage.UsageAction", false]], "usageaction (qiime2.sdk.usage.usage attribute)": [[60, "qiime2.sdk.usage.Usage.UsageAction", false]], "usageinputs (class in qiime2.sdk.usage)": [[60, "qiime2.sdk.usage.UsageInputs", false]], "usageinputs (qiime2.sdk.usage.usage attribute)": [[60, "qiime2.sdk.usage.Usage.UsageInputs", false]], "usageoutputnames (class in qiime2.sdk.usage)": [[60, "qiime2.sdk.usage.UsageOutputNames", false]], "usageoutputnames (qiime2.sdk.usage.usage attribute)": [[60, "qiime2.sdk.usage.Usage.UsageOutputNames", false]], "usageoutputs (class in qiime2.sdk.usage)": [[60, "qiime2.sdk.usage.UsageOutputs", false]], "usagevariable (class in qiime2.sdk.usage)": [[60, "qiime2.sdk.usage.UsageVariable", false]], "uuid": [[2, "term-UUID", true]], "validationerror (class in qiime2.plugin)": [[55, "qiime2.plugin.ValidationError", false]], "validationerror() (in module qiime2.sdk)": [[22, "qiime2.sdk.ValidationError", false]], "view": [[2, "term-View", true]], "view_as_metadata() (qiime2.sdk.usage.usage method)": [[60, "qiime2.sdk.usage.Usage.view_as_metadata", false]], "visualization": [[2, "term-Visualization", true]], "visualization (in module qiime2.plugin)": [[59, "qiime2.plugin.Visualization", false]], "visualization (type)": [[2, "term-Visualization-Type", true]], "visualization() (in module qiime2.sdk)": [[22, "qiime2.sdk.Visualization", false]], "visualizer": [[2, "term-Visualizer", true]], "visualizer() (in module qiime2.sdk)": [[22, "qiime2.sdk.Visualizer", false]]}, "objects": {"qiime2": [[63, 0, 1, "", "CategoricalMetadataColumn"], [63, 0, 1, "", "Metadata"], [63, 0, 1, "", "MetadataColumn"], [63, 0, 1, "", "NumericMetadataColumn"]], "qiime2.Metadata": [[63, 1, 1, "", "column_count"], [63, 1, 1, "", "columns"], [63, 2, 1, "", "filter_columns"], [63, 2, 1, "", "filter_ids"], [63, 2, 1, "", "get_column"], [63, 2, 1, "", "get_ids"], [63, 2, 1, "", "load"], [63, 2, 1, "", "merge"], [63, 2, 1, "", "to_dataframe"]], "qiime2.MetadataColumn": [[63, 2, 1, "", "drop_missing_values"], [63, 2, 1, "", "filter_ids"], [63, 2, 1, "", "get_ids"], [63, 2, 1, "", "get_missing"], [63, 2, 1, "", "get_value"], [63, 2, 1, "", "has_missing_values"], [63, 1, 1, "", "missing_scheme"], [63, 1, 1, "", "name"], [63, 2, 1, "", "to_dataframe"], [63, 2, 1, "", "to_series"]], "qiime2.metadata": [[63, 0, 1, "", "MetadataFileError"]], "qiime2.plugin": [[55, 0, 1, "", "BinaryFileFormat"], [59, 3, 1, "", "Bool"], [59, 3, 1, "", "Categorical"], [59, 0, 1, "", "Choices"], [53, 0, 1, "", "CitationRecord"], [53, 0, 1, "", "Citations"], [59, 3, 1, "", "Collection"], [55, 0, 1, "", "DirectoryFormat"], [59, 4, 1, "", "End"], [59, 3, 1, "", "Float"], [59, 3, 1, "", "Int"], [59, 3, 1, "", "Jobs"], [59, 3, 1, "", "List"], [59, 3, 1, "", "Metadata"], [59, 3, 1, "", "MetadataColumn"], [59, 3, 1, "", "Numeric"], [57, 0, 1, "", "Plugin"], [59, 0, 1, "", "Properties"], [59, 0, 1, "", "Range"], [59, 4, 1, "", "SemanticType"], [59, 3, 1, "", "Set"], [55, 4, 1, "", "SingleFileDirectoryFormat"], [59, 4, 1, "", "Start"], [59, 3, 1, "", "Str"], [55, 0, 1, "", "TextFileFormat"], [59, 3, 1, "", "Threads"], [59, 0, 1, "", "TypeMap"], [59, 0, 1, "", "TypeMatch"], [55, 0, 1, "", "ValidationError"], [59, 3, 1, "", "Visualization"]], "qiime2.plugin.Citations": [[53, 2, 1, "", "__iter__"], [53, 2, 1, "", "load"], [53, 2, 1, "", "save"]], "qiime2.plugin.Plugin": [[57, 2, 1, "", "register_artifact_class"], [57, 2, 1, "", "register_formats"], [57, 2, 1, "", "register_semantic_type_to_format"], [57, 2, 1, "", "register_semantic_types"], [57, 2, 1, "", "register_transformer"], [57, 2, 1, "", "register_validator"], [57, 2, 1, "", "register_views"]], "qiime2.plugin.plugin": [[57, 0, 1, "", "PluginMethods"], [57, 0, 1, "", "PluginPipelines"], [57, 0, 1, "", "PluginVisualizers"]], "qiime2.plugin.plugin.PluginMethods": [[57, 2, 1, "", "register_function"]], "qiime2.plugin.plugin.PluginPipelines": [[57, 2, 1, "", "register_function"]], "qiime2.plugin.plugin.PluginVisualizers": [[57, 2, 1, "", "register_function"]], "qiime2.plugin.testing": [[58, 0, 1, "", "TestPluginBase"], [58, 4, 1, "", "assert_no_nans_in_tables"]], "qiime2.plugin.testing.TestPluginBase": [[58, 2, 1, "", "assertRegisteredSemanticType"], [58, 2, 1, "", "assertSemanticTypeRegisteredToFormat"], [58, 2, 1, "", "execute_examples"], [58, 2, 1, "", "get_data_path"], [58, 2, 1, "", "get_transformer"], [58, 5, 1, "", "package"], [58, 2, 1, "", "setUp"], [58, 2, 1, "", "tearDown"], [58, 5, 1, "", "test_dir_prefix"], [58, 2, 1, "", "transform_format"]], "qiime2.plugin.util": [[61, 4, 1, "", "get_available_cores"], [61, 4, 1, "", "transform"]], "qiime2.sdk": [[22, 4, 1, "", "Action"], [22, 4, 1, "", "Artifact"], [22, 4, 1, "", "ImplementationError"], [22, 4, 1, "", "Method"], [22, 4, 1, "", "Pipeline"], [22, 4, 1, "", "PluginManager"], [22, 4, 1, "", "Result"], [22, 4, 1, "", "ResultCollection"], [22, 4, 1, "", "Results"], [22, 4, 1, "", "UninitializedPluginManagerError"], [22, 4, 1, "", "ValidationError"], [22, 4, 1, "", "Visualization"], [22, 4, 1, "", "Visualizer"], [22, 4, 1, "", "parse_format"], [22, 4, 1, "", "parse_type"], [22, 4, 1, "", "type_from_ast"]], "qiime2.sdk.Context": [[54, 2, 1, "", "get_action"], [54, 2, 1, "", "make_artifact"]], "qiime2.sdk.usage": [[60, 0, 1, "", "UsageAction"], [60, 0, 1, "", "UsageInputs"], [60, 0, 1, "", "UsageOutputNames"], [60, 0, 1, "", "UsageOutputs"], [60, 0, 1, "", "UsageVariable"]], "qiime2.sdk.usage.Usage": [[60, 5, 1, "", "UsageAction"], [60, 5, 1, "", "UsageInputs"], [60, 5, 1, "", "UsageOutputNames"], [60, 2, 1, "", "action"], [60, 2, 1, "", "comment"], [60, 2, 1, "", "construct_artifact_collection"], [60, 2, 1, "", "get_artifact_collection_member"], [60, 2, 1, "", "get_metadata_column"], [60, 2, 1, "", "help"], [60, 2, 1, "", "import_from_format"], [60, 2, 1, "", "init_artifact"], [60, 2, 1, "", "init_artifact_collection"], [60, 2, 1, "", "init_artifact_from_url"], [60, 2, 1, "", "init_format"], [60, 2, 1, "", "init_metadata"], [60, 2, 1, "", "init_metadata_from_url"], [60, 2, 1, "", "merge_metadata"], [60, 2, 1, "", "peek"], [60, 2, 1, "", "view_as_metadata"]], "qiime2.sdk.usage.UsageVariable": [[60, 2, 1, "", "assert_has_line_matching"], [60, 2, 1, "", "assert_output_type"]], "qiime2.util": [[61, 4, 1, "", "duplicate"], [61, 4, 1, "", "redirected_stdio"]]}, "objnames": {"0": ["py", "class", "Python class"], "1": ["py", "property", "Python property"], "2": ["py", "method", "Python method"], "3": ["py", "data", "Python data"], "4": ["py", "function", "Python function"], "5": ["py", "attribute", "Python attribute"]}, "objtypes": {"0": "py:class", "1": "py:property", "2": "py:method", "3": "py:data", "4": "py:function", "5": "py:attribute"}, "terms": {"": [0, 2, 5, 8, 9, 10, 11, 15, 16, 18, 19, 24, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 41, 43, 44, 45, 47, 49, 50, 51, 52, 53, 57, 58, 59, 60, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74], "0": [9, 11, 15, 16, 24, 30, 31, 33, 46, 49, 59, 60, 61, 65, 66, 67, 69, 72, 73], "00": 15, "001": 67, "00a294c": 18, "01": [24, 67], "03d_r": 11, "04": 15, "06": 70, "07": 15, "080381": 15, "1": [0, 11, 15, 16, 19, 24, 27, 30, 32, 33, 37, 38, 49, 59, 60, 64, 65, 66, 67, 69, 70], "10": [11, 15, 18, 19, 24, 31, 38, 59, 60, 61, 67], "100": [45, 59, 60, 68], "100014989": 24, "11": [0, 15, 18, 46, 52, 60], "1103": 15, "12": [7, 11, 15, 18, 46, 59], "13": 18, "13039": 24, "14": 66, "147": 0, "15": [42, 46, 68, 70], "16": [15, 31, 47, 68], "17": 67, "171": 66, "18": [46, 69], "184": 16, "19": 0, "195": 0, "197": 0, "1970": [0, 67], "1976": 27, "1981": 0, "1990": 0, "1u24ca248454": 24, "2": [0, 2, 4, 5, 7, 9, 11, 12, 13, 15, 16, 17, 20, 22, 26, 28, 29, 30, 31, 32, 33, 35, 36, 39, 40, 41, 43, 47, 49, 50, 51, 52, 53, 56, 57, 58, 59, 60, 61, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73], "20": [10, 15, 29, 59, 68], "2016": 18, "2017": 18, "2018": 18, "2019": [0, 18], "2021": [0, 15], "2022": 60, "2023": [0, 7, 46, 52], "2024": [2, 4, 11, 19, 31, 36, 38, 42, 44, 47, 52, 66, 67, 71, 72], "2025": 31, "207342": 24, "20px": 65, "20th": [0, 67], "20xx": 19, "21": 15, "215": 0, "21t14": 15, "22": 71, "23": [4, 44, 66, 67], "24": [18, 36], "25": [65, 68, 70], "27a5": 15, "29": 69, "2adb9": 15, "2adb9f00": 15, "2c00": 18, "2nd": 0, "3": [0, 2, 11, 15, 16, 24, 32, 45, 46, 49, 59, 60, 63, 68, 73, 74], "30": 68, "300": 37, "333fd63a2b4a102e58e364f37cd98b74": 18, "34b07e56": 15, "35": 68, "3611a0c1": 15, "37921": 24, "38": 15, "3rd": 43, "4": [0, 2, 9, 15, 24, 31, 59, 60, 66, 67, 69], "40": 68, "403": 0, "41": 67, "410": 0, "411d": 15, "414": 18, "42": [15, 60], "42b5": 15, "4308": 15, "4322": 15, "4373b96f26689f78889caeb1fbb94090": 18, "4389a0b": 18, "44": 72, "443": [0, 67], "453": [0, 67], "45c12936": 9, "469998": 15, "48": [0, 67], "484d": 9, "4886": 18, "4b60": 9, "4e2f": 15, "4f03": 15, "5": [0, 9, 11, 16, 38, 52, 59, 60, 66, 67, 68, 69], "50": 66, "5000": 11, "51": 66, "587": 15, "5a7118c14fd1bacc957ddf01e61491b7": 18, "6": [0, 15, 60, 67, 68], "610383": 15, "62c7": 15, "64": [46, 59], "66": 69, "68": 16, "684b8b7": 18, "6dada99d0c81": 18, "7": [0, 2, 15], "7a40cff7855daffa28d4082194bdf60": 18, "7zip": 10, "8": [11, 15, 18, 46, 61, 65, 67], "80": 65, "8000": 7, "81b130d538c3": 15, "85": 68, "8601": 15, "862772dbrrej": 24, "87058ae3": 15, "8dd3": 15, "9": [11, 15, 18], "90": 68, "93224813": 15, "95": 68, "98ff96bad145": 9, "999": 59, "A": [0, 2, 9, 10, 11, 15, 16, 18, 22, 24, 25, 27, 30, 32, 33, 35, 42, 45, 46, 49, 51, 53, 57, 58, 59, 60, 61, 63, 64, 66, 68, 69, 71], "And": [16, 50, 66, 68, 70, 74], "As": [4, 7, 9, 11, 15, 16, 18, 19, 27, 30, 32, 33, 36, 38, 44, 49, 52, 57, 59, 64, 65, 66, 67, 68, 69, 70, 71], "At": [5, 8, 46, 50, 57, 64, 66, 67, 68, 73], "BY": 24, "Be": 36, "But": [52, 59, 66, 67, 73], "By": [15, 27, 32, 38, 49, 50, 67, 73], "For": [2, 5, 10, 11, 12, 15, 16, 18, 24, 25, 27, 28, 29, 30, 31, 32, 36, 43, 44, 45, 46, 49, 50, 52, 61, 63, 65, 66, 67, 68, 69, 70, 72, 73], "If": [5, 9, 10, 12, 15, 16, 19, 24, 27, 29, 30, 31, 32, 35, 36, 37, 38, 40, 41, 42, 43, 44, 45, 46, 47, 49, 50, 52, 57, 58, 59, 60, 63, 64, 65, 66, 67, 68, 69, 70, 72, 73, 74], "In": [2, 5, 8, 10, 11, 15, 16, 18, 19, 25, 27, 30, 31, 32, 35, 38, 40, 45, 49, 50, 52, 57, 59, 63, 64, 65, 66, 67, 68, 69, 70, 72, 73], "It": [8, 9, 11, 12, 15, 16, 18, 22, 24, 25, 29, 30, 31, 33, 36, 44, 45, 49, 52, 57, 59, 64, 65, 66, 67, 69, 70, 74], "NOT": [30, 37], "No": [59, 66], "Not": [8, 16, 59], "Of": [16, 60], "On": [30, 66, 73], "One": [11, 16, 19, 29, 37, 60, 63, 66, 67, 68, 69, 74], "Or": [59, 67, 72], "That": [15, 16, 29, 44, 52, 65, 66, 67, 68, 69, 70, 71, 73], "Thats": 16, "The": [0, 2, 7, 8, 10, 11, 12, 14, 16, 18, 19, 24, 26, 28, 29, 31, 32, 33, 34, 35, 36, 37, 38, 40, 42, 43, 44, 45, 46, 49, 50, 51, 52, 53, 54, 57, 58, 59, 60, 61, 64, 65, 66, 67, 68, 69, 70, 71, 72, 74], "Then": [7, 8, 9, 27, 65, 66, 67, 68, 70, 73], "There": [2, 9, 10, 15, 16, 27, 29, 31, 40, 43, 45, 49, 52, 59, 60, 66, 67, 68], "These": [2, 7, 8, 9, 10, 11, 15, 16, 18, 19, 25, 28, 30, 31, 32, 34, 37, 45, 49, 52, 56, 59, 60, 63, 67, 68, 69, 70], "To": [7, 8, 10, 11, 16, 24, 27, 29, 31, 36, 42, 46, 49, 51, 52, 58, 63, 65, 66, 67, 68, 69, 70, 72, 73, 74], "WILL": 37, "Will": [22, 59], "With": [15, 18, 31, 38, 42, 64, 66], "_": [11, 27, 32, 45, 57, 66, 67, 69], "_0": 57, "_001": 11, "_1": [34, 50, 57, 66], "_2": [34, 64, 66], "_3": 66, "_4": 66, "__all__": 66, "__getitem__": 16, "__init__": [5, 18, 66], "__iter__": 53, "__release__": 60, "__repr__": 65, "__super__": 58, "__version__": [45, 57, 67], "_action": 69, "_align_and_summarize_output": 69, "_align_and_summarize_output_descript": 69, "_archiv": [9, 18], "_batch": 68, "_confirm_acgt_onli": 66, "_confirm_single_record": 66, "_create_seq_artifact": [64, 70], "_exampl": [64, 70], "_exit": 12, "_fn": 57, "_html_templat": [65, 73], "_l": 11, "_method": [66, 67, 68, 69], "_nw_align_default": 69, "_nw_align_input": 69, "_nw_align_input_descript": 69, "_nw_align_paramet": 69, "_nw_align_parameter_descript": 69, "_pipelin": [68, 73], "_r": 11, "_result": 40, "_split_seqs_default": 68, "_tabulate_las_default": 73, "_tabulate_las_paramet": 73, "_tabulate_las_parameter_descript": 73, "_test_simple1_help": 68, "_transform": [18, 64, 66], "_transform_singlerecorddnafastaformat_to_dna": 66, "_types_and_format": 66, "_validate_": [11, 39, 52, 66], "_validate_field_": 16, "_validate_n_int": 11, "_visual": [65, 73], "_ziparch": 9, "a10d5d44": 15, "a416": 15, "a692": 15, "a6d07fc80a01": 15, "a983": 15, "a_boo": 60, "a_div_vector": 49, "aaa": 67, "aaaa": 67, "aaaaaaaagg": [65, 67], "aaaaaaaaggggcctttttttt": 67, "aaaaaaaaggtggcctttttttt": [65, 67], "aaaag": 67, "aaaaggttt": 67, "aaaattt": 67, "aaccgctggcgaa": [64, 70], "aaccggttaacacccac": [65, 67], "aaccggttggccaa": [64, 70], "abbrevi": [15, 68], "abil": [39, 66], "abl": [9, 10, 11, 15, 16, 18, 27, 36, 43, 46, 47, 60, 65, 66, 67, 69, 70, 74], "about": [2, 7, 8, 10, 11, 15, 16, 27, 29, 36, 37, 44, 45, 48, 49, 50, 52, 57, 59, 63, 64, 67, 68, 70, 72, 73, 74], "abov": [7, 8, 15, 16, 18, 19, 27, 31, 32, 37, 38, 42, 45, 46, 49, 59, 65, 66, 67, 68, 69, 70], "absenc": 59, "absolut": 37, "abstract": [10, 15, 16, 22, 63, 70], "abstractli": 70, "ac92": 15, "acactcaccacccaattgct": 68, "acactctccacccatttgct": 68, "acactctccagccatttgct": 68, "accept": [2, 5, 16, 25, 32, 33, 35, 44, 49, 57, 67, 68], "access": [2, 9, 15, 22, 24, 32, 42, 45, 52, 57, 58, 59, 60, 63, 64, 65, 66, 67, 68, 69, 74], "accggt": [65, 67], "accggtaaccggttaacacccac": [64, 66, 67], "accggtggaaccgg": [65, 67], "accggtggaaccggtaacacccac": [64, 66, 67], "accident": [10, 15, 29, 59], "accomplish": [10, 24, 33], "accord": [16, 36, 49], "accordingli": 67, "account": 38, "accur": [11, 15], "accuraci": 32, "acgt": 66, "achiev": [10, 14, 29, 41, 52, 67, 68, 69, 74], "acid": [0, 67], "acknowledg": 5, "acronym": 2, "across": [15, 18, 27, 32, 52, 63, 67, 68, 69], "act": [22, 70], "actinomycetota": 73, "action": [2, 7, 8, 9, 10, 11, 14, 16, 18, 19, 26, 27, 28, 29, 33, 41, 43, 45, 49, 50, 51, 52, 54, 59, 63, 66, 68, 70, 72, 74], "action_id": [49, 60, 70], "activ": [4, 8, 15, 19, 24, 29, 31, 44, 47, 67], "actor": 8, "actual": [15, 16, 29, 30, 40, 49, 50, 60, 65, 66, 67, 68, 70, 73], "ad": [9, 11, 16, 18, 19, 27, 29, 32, 33, 35, 37, 43, 49, 59, 64, 65, 66, 67, 68, 69, 70, 71, 73], "adapt": [8, 24, 64, 66, 68, 69, 70], "add": [7, 16, 18, 19, 36, 37, 40, 42, 51, 57, 59, 72, 74], "add_plugin": 22, "addion": 70, "addison": 0, "addit": [2, 9, 10, 12, 15, 16, 19, 27, 31, 35, 36, 38, 44, 46, 49, 50, 57, 59, 63, 65, 66, 68, 70, 73, 74], "addition": [10, 12, 16, 29, 50, 70], "additon": 9, "address": [10, 19, 29, 31, 42, 65, 66, 67, 69], "adequ": 10, "adher": [32, 69], "adjust": [31, 67], "adopt": [16, 27, 52, 66, 67], "advanc": [10, 30, 31, 44], "advantag": 10, "advis": 24, "ae0d0e26da5b84a6c0722148789c51e0": 18, "ae57": 15, "afb": 15, "afford": 59, "after": [27, 29, 31, 36, 40, 46, 63, 66, 67, 68, 69, 70, 72, 73, 74], "ag": [44, 50, 60], "again": [8, 27, 30, 31, 38, 43, 63, 64, 65, 67, 68, 69, 73], "against": [31, 36, 37, 60, 66, 68], "agnost": [4, 15], "ahead": [8, 49], "aid": [19, 24], "aim": [11, 15, 19], "airplan": 59, "alabast": 15, "alert": 31, "alfr": 24, "algorithm": [15, 29, 32, 67, 68, 74], "alia": [15, 18, 59], "alias": 15, "align": [0, 2, 15, 18, 65, 69, 73], "align_and_summar": 69, "aligned_sequ": [67, 70], "aligned_sequence1": [65, 67], "aligned_sequence2": [65, 67], "alignedproteinsequ": 66, "alignedrnasequ": 66, "alignedsequ": [65, 67, 69], "all": [2, 7, 8, 9, 10, 11, 15, 16, 18, 19, 22, 24, 27, 28, 29, 30, 31, 32, 36, 38, 44, 45, 48, 49, 50, 52, 57, 58, 59, 60, 63, 65, 66, 67, 68, 69, 70, 72, 73, 74], "alloc": 12, "allot": 68, "allow": [2, 8, 9, 10, 11, 15, 16, 18, 22, 24, 27, 29, 31, 42, 45, 49, 50, 52, 57, 59, 63, 66, 67, 68, 69, 70, 73], "almost": [2, 16, 36, 73], "alon": 18, "along": [2, 19, 27, 28, 30, 42, 68, 72, 73], "alongsid": [10, 18], "alpha": [18, 25, 33, 35, 45, 49], "alpha_divers": 35, "alpha_group_signific": 35, "alphadivers": [33, 35, 49], "alreadi": [15, 16, 29, 36, 41, 42, 47, 49, 52, 66, 67, 68, 72, 73, 74], "also": [4, 8, 9, 11, 15, 16, 18, 22, 24, 29, 30, 31, 36, 38, 44, 47, 49, 50, 52, 57, 58, 59, 63, 64, 65, 66, 67, 68, 69, 70, 72, 73, 74], "alter": 2, "altern": [10, 42, 61, 67, 68, 69], "although": [11, 50], "altschul": 0, "alwai": [8, 9, 11, 12, 15, 16, 31, 50, 59, 60, 63, 64, 65, 66, 67, 68, 69], "am": [27, 70], "ambigu": [2, 59, 66], "amino": [0, 67], "among": [15, 66], "amongst": 50, "amount": [8, 14, 68], "ampl": [19, 31], "amplicon": [2, 7, 31, 36, 38, 42, 50], "an": [0, 2, 4, 8, 10, 11, 12, 13, 15, 17, 18, 19, 22, 24, 27, 28, 29, 31, 32, 33, 34, 35, 36, 37, 41, 42, 43, 48, 49, 50, 52, 53, 54, 57, 58, 59, 60, 63, 64, 68, 70, 72], "an_input_filepath": 52, "an_output_filepath": 52, "anaconda": 45, "analys": [15, 70], "analysi": [2, 10, 15, 25, 32, 35, 53, 67], "analyt": [35, 66], "analyz": [44, 68], "anatomi": [10, 13, 15, 17], "ancestor": [9, 18], "ancestor_uuid": 18, "ancestr": [2, 9, 67], "andrew": 0, "angl": 8, "angri": 67, "ani": [2, 7, 8, 9, 10, 11, 12, 15, 16, 19, 24, 25, 27, 28, 30, 31, 32, 36, 37, 42, 45, 46, 49, 50, 57, 58, 59, 63, 64, 65, 66, 67, 68, 69, 70, 72, 73], "anniversari": [0, 67], "annot": [2, 16, 28, 30, 32, 33, 34, 35, 49, 50, 57, 67, 68], "announc": [19, 44], "anoth": [2, 9, 10, 11, 12, 16, 25, 27, 34, 44, 47, 50, 59, 65, 66, 68, 69, 70, 73], "answer": [12, 36, 42, 47, 72], "anti": [11, 51, 62, 66], "antipattern": 67, "anual": 19, "anyon": [4, 16, 19, 66], "anyth": [10, 12, 16, 24, 27, 29, 30, 31, 32, 35, 40, 49, 59, 60, 65, 66, 67, 68, 70, 73], "anytim": 31, "anywai": 16, "anywher": [16, 45, 50, 69], "api": [2, 5, 8, 14, 15, 16, 21, 23, 24, 31, 32, 33, 45, 49, 51, 52, 54, 58, 60, 62, 64, 65, 66, 69, 74], "app": 52, "appar": 68, "appear": [15, 16, 52, 67, 68], "append": [33, 68], "appl": [16, 46, 59], "appli": [0, 2, 27, 29, 32, 33, 52, 57, 63, 64, 67, 69, 73, 74], "applic": [0, 32, 46, 63, 67, 69, 70, 73, 74], "approach": [4, 7, 10, 15, 24, 38, 42, 43, 44, 52, 66, 68, 74], "appropri": [9, 12, 18, 28, 29, 33, 45, 49, 54, 67], "approv": [4, 19], "april": [4, 19, 31, 36, 44, 66], "apt": 27, "aptli": 9, "ar": [2, 4, 5, 7, 8, 9, 10, 11, 12, 14, 15, 16, 18, 19, 22, 24, 25, 27, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 52, 56, 57, 59, 60, 61, 63, 64, 65, 66, 67, 68, 69, 70, 72, 73, 74], "arbitrari": [15, 52, 57, 59, 66, 68, 73], "arbitrarili": 2, "arbitrary_kei": 59, "architectur": [4, 13, 17], "archiv": [2, 8, 10, 11, 13, 15, 17, 20, 24, 29], "archiveformat": 18, "area": 4, "aren": [11, 16, 18, 52, 67], "arg": [16, 40, 66, 67], "argument": [8, 16, 18, 30, 49, 52, 54, 57, 59, 60, 66, 69], "argumentless": 57, "aris": [16, 29, 31, 66], "aritfact": 64, "around": [10, 27, 30, 31, 47, 60, 67, 68], "arrai": [10, 49], "arrow": [8, 18], "art": 10, "articl": [27, 29, 44, 53, 66, 67, 70], "artifact": [2, 8, 9, 10, 11, 12, 14, 15, 16, 18, 22, 25, 26, 27, 28, 32, 33, 34, 35, 41, 42, 43, 49, 51, 52, 54, 57, 59, 60, 63, 64, 65, 67, 68, 69, 70, 72, 73, 74], "artifact_collect": 60, "artifact_for_md": 60, "artifact_format": 57, "artifactapiusag": [49, 70], "artifactclass": 66, "arvum": 73, "arxiv": 44, "ask": [16, 36, 42, 44], "aspect": [10, 14, 15, 17, 48, 66, 67], "assembl": 67, "assert": [16, 49, 58], "assert_frame_equ": 68, "assert_has_line_match": [49, 60], "assert_no_nans_in_t": 58, "assert_output_typ": [49, 60], "assertequ": [64, 66, 67], "assertin": [65, 68], "assertionerror": 60, "assertnotequ": 67, "assertraisesregex": 66, "assertregisteredsemantictyp": [58, 66], "assertsemantictyperegisteredtoformat": 58, "assess": 70, "asset": [9, 45, 46, 58], "assign": [15, 16, 18, 19, 29, 49, 50, 59, 67, 69, 70], "assist": [19, 27, 38, 42, 46], "associ": [2, 7, 15, 16, 18, 27, 28, 29, 38, 45, 52, 57, 59, 60, 63, 64, 66, 67, 68, 69, 70, 72, 73], "assum": [10, 31, 36, 38, 52, 63, 67], "assur": 59, "ast": 22, "astut": 11, "asynchron": 8, "atom": 37, "attach": 16, "attempt": [49, 50, 66, 67], "attent": [19, 36], "attribut": [22, 30, 58, 68], "attt": 67, "audienc": 8, "august": [31, 42, 47, 71], "auth": 36, "authent": 36, "author": [5, 24, 44, 60, 67, 69], "authorit": 69, "auto": 59, "autodoc": 5, "autom": [7, 27, 41, 47, 49, 51, 66, 74], "automat": [12, 15, 16, 32, 33, 35, 37, 53, 54, 57, 66, 69, 70], "avail": [2, 8, 9, 11, 24, 29, 38, 42, 43, 49, 50, 54, 56, 60, 61, 66, 67, 68, 69, 70, 73], "avoid": [7, 16, 29, 42, 43, 45, 49, 52, 66, 67, 70, 74], "awai": [16, 52, 57, 66], "awar": [16, 19, 29, 38, 47, 52, 54, 66, 68, 73], "ax": 59, "b": [0, 16, 59, 60, 67], "b733": 18, "bacillota": 73, "bacillus_a": 73, "back": [10, 15, 16, 31, 52, 61, 63, 64, 65, 66, 67, 69, 70, 71, 72, 74], "backfir": 44, "background": [66, 67], "backlog": 19, "backward": [9, 30, 43, 74], "bacteri": 29, "bacteria": 73, "bad": [52, 66], "baerheim1994effect": 57, "bag": 16, "bail": 11, "balanc": 19, "banana": [16, 59], "bandwidth": 19, "bar": [30, 37, 57, 59, 60], "bar1": 60, "bar2": 60, "bar3": 60, "bar4": 60, "bar5": 60, "bar6": 60, "bar7": 60, "barcod": [11, 50], "barcode_id": 11, "base": [2, 4, 10, 11, 14, 19, 22, 27, 28, 29, 31, 41, 42, 47, 50, 51, 52, 57, 59, 63, 65, 66, 67, 68, 70], "basetyp": 57, "basi": [19, 29, 31, 67], "basic": [0, 11, 15, 16, 30, 31, 38, 49, 66, 67], "baz": 59, "bbe1": 9, "bdc8a": 18, "beauti": 4, "becaus": [2, 8, 9, 10, 11, 12, 15, 16, 18, 27, 29, 31, 38, 40, 49, 52, 63, 64, 65, 66, 67, 68, 69, 70, 73], "becom": [8, 11, 12, 16, 28, 31, 57, 59, 66, 68, 70], "been": [9, 16, 18, 19, 24, 27, 28, 30, 36, 42, 52, 63, 66, 67, 68, 69, 72, 74], "befor": [7, 8, 16, 19, 29, 31, 40, 41, 42, 43, 45, 49, 50, 64, 65, 66, 67, 68, 69, 70, 73, 74], "begin": [19, 28, 44, 47, 63, 66, 67, 69, 74], "behav": 73, "behavior": [2, 8, 33, 49, 50, 57, 59, 67, 68, 69], "behind": [15, 16, 19, 64, 69], "being": [5, 10, 12, 15, 16, 18, 19, 29, 32, 38, 40, 43, 50, 52, 63, 66, 67], "believ": 10, "belong": 16, "below": [8, 9, 15, 18, 19, 30, 31, 38, 45, 60, 63, 66], "benchmark": 47, "benefici": 31, "benefit": [15, 52, 66, 68, 70], "best": [16, 52, 59, 66, 67, 68], "beta": [28, 32, 33, 45], "beta_phylogenet": [28, 32], "beta_result": 33, "better": [8, 10, 12, 15, 16, 19, 29, 46, 57, 64, 66], "between": [2, 4, 7, 8, 9, 10, 11, 15, 16, 18, 19, 22, 28, 29, 31, 32, 33, 41, 51, 52, 59, 64, 66, 68, 73], "beyond": 49, "bi": 19, "bib": [15, 18, 32, 45, 67], "bibtex": [15, 27, 32, 45, 53, 67], "bibtext": 67, "big": [52, 68, 70], "bigger": [45, 65], "binaryfileformat": [2, 11, 55, 57], "bio": [65, 66, 67], "bioconda": [31, 38], "bioinformat": [0, 2, 66, 67, 68, 73, 74], "biol": 0, "biolog": [2, 11], "biologi": [44, 67], "biom": [11, 27, 28, 29, 49, 67], "biomv210dirfmt": 9, "biopython": 66, "birthdai": 16, "bit": [11, 16, 31, 45, 59, 65, 66, 67, 68, 69], "blame": 52, "blank": [16, 59, 63], "blast": [67, 68], "blith": 16, "blob": 46, "block": [40, 49, 66, 68, 69, 73], "blue": [15, 18], "blur": 7, "board": 19, "bodi": [50, 65, 66], "bolyen": [0, 5, 24], "book": [24, 27, 33, 67, 70], "bool": [16, 30, 57, 58, 59, 63], "bool_dict": 30, "bool_list": 30, "boolean": [16, 59, 60, 67], "bore": 66, "both": [8, 11, 15, 16, 29, 37, 43, 45, 49, 59, 66, 67, 68, 69, 70], "bother": 70, "bottleneck": 4, "bottom": [8, 15, 66, 67, 70], "bound": [16, 59], "boundari": 67, "bowtie2index": 66, "box": [8, 15, 18, 52, 69], "brackendb": 66, "bracket": [8, 31, 38], "brai": 33, "branch": [7, 19, 31, 37, 38, 59], "bray_curtis_distance_matrix": 33, "bray_curtis_emperor": 33, "bray_curtis_pcoa_result": 33, "braycurti": 33, "break": [9, 11, 16, 27, 70], "breviti": 8, "brief": [37, 44, 45, 66, 67, 73], "briefli": [48, 66, 67, 68], "bring": [15, 16, 67], "broad": [16, 59], "broadli": [52, 56, 70], "broken": [15, 24, 70], "browser": [2, 7, 36, 52], "bsd": [24, 67], "bug": [15, 19, 52, 69], "buggi": 52, "bui": 44, "build": [4, 7, 16, 24, 27, 31, 41, 42, 51, 52, 56, 66, 67, 68, 69, 72], "built": [7, 8, 10, 16, 24, 27, 41, 44, 52, 63, 65, 66, 67, 69, 73], "bump": 19, "bunch": [42, 65, 67], "bundl": 16, "burn": 52, "busi": [11, 44, 52], "bytesio": 61, "c": [0, 16, 52, 59, 60, 67], "c1": 59, "c9811bcaa3e6": 15, "cach": [7, 49, 65, 66, 67, 69, 73], "cake": 16, "calcul": [25, 45], "call": [8, 9, 10, 11, 12, 16, 22, 27, 28, 29, 30, 32, 33, 34, 35, 40, 45, 49, 50, 52, 57, 58, 60, 61, 65, 66, 68, 69, 70, 72, 73], "callabl": [54, 57, 60], "came": 49, "can": [2, 4, 5, 7, 8, 9, 10, 11, 12, 15, 16, 18, 19, 24, 25, 27, 28, 29, 30, 31, 32, 33, 35, 36, 37, 38, 39, 42, 44, 45, 46, 47, 48, 52, 53, 57, 58, 59, 60, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74], "cancer": [7, 24], "cannot": [2, 8, 16, 25, 35, 61, 63], "canon": [24, 60], "cap": 19, "capabl": [2, 11], "capit": 16, "caporaso": [0, 5, 19, 24, 38, 42, 64, 65, 66, 67, 68, 69, 70, 72, 73], "captur": [9, 18, 42, 49, 74], "care": [8, 15, 28, 29, 49, 68], "carri": [10, 16, 29, 57], "casava": 11, "casavaoneeightsinglelanepersampledirfmt": 11, "case": [2, 5, 8, 9, 11, 12, 15, 16, 27, 29, 30, 32, 38, 42, 46, 49, 50, 52, 59, 60, 63, 65, 66, 67, 68, 69, 70, 72, 73], "cast": [50, 63, 70], "cat": [59, 67], "cat1": 18, "catch": [19, 31], "categor": [16, 59, 63], "categori": [16, 19, 44, 47], "categorical_md_col": 50, "categoricalmetadatacolumn": [50, 63], "caught": 40, "caus": [8, 59], "caveat": [42, 74], "cc": 24, "cd": [7, 46], "cd4015db31da": 15, "cell": 50, "central": [2, 15, 47, 50, 64], "certain": [5, 10, 63, 69], "certainli": [2, 36], "chain": [15, 64, 66, 69], "chalk": 16, "challeng": [10, 66], "chan": 24, "chang": [2, 4, 7, 8, 18, 19, 24, 27, 30, 31, 36, 43, 44, 46, 49, 52, 57, 60, 65, 66, 67, 68, 69, 70, 72, 74], "changelog": [18, 19], "channel": [31, 38], "chapter": [2, 24, 30, 41, 67, 68, 69, 73], "charact": [37, 45, 59, 63, 65, 66, 67], "characterist": [15, 18], "charset": 65, "chart": 68, "check": [8, 9, 11, 18, 29, 44, 46, 49, 50, 58, 60, 64, 65, 66, 67, 68, 70, 72], "checkbox": [16, 67], "checksum": 18, "chef": 16, "child": 12, "chloe": 0, "choic": [28, 29, 32, 36, 44, 59, 69], "choos": [10, 12, 15, 29, 43, 47, 50, 68], "chose": [15, 67, 73], "christian": 67, "christoph": 0, "ci": [19, 46], "circl": [15, 16, 64], "circular": 43, "circumst": 52, "circumv": 52, "citabl": 44, "citat": [10, 15, 18, 32, 33, 35, 45, 51, 52, 56, 57, 62, 65, 69, 70, 72], "citation_text": 57, "citationrecord": [53, 57], "citatonrecord": 57, "cite": [2, 3, 9, 15, 18, 44, 67], "clang": 15, "clarifi": [10, 16], "class": [2, 10, 11, 15, 16, 18, 22, 26, 28, 30, 32, 34, 42, 43, 48, 49, 50, 51, 52, 53, 55, 57, 58, 59, 60, 64, 65, 67, 68, 69, 70, 73, 74], "classmethod": [53, 63], "claus": [24, 63], "clean": [12, 27, 54], "cleaner": 49, "cleanup": [12, 54], "clear": [37, 44, 67], "cleric": 15, "clever": [49, 57], "cli": 15, "click": [15, 67], "client": [15, 27], "clinic": [52, 67], "clone": [7, 46], "close": [9, 10, 16, 42, 63, 66], "closest": 73, "clunki": [49, 65, 66, 67], "cluster": [29, 68], "co": 44, "code": [2, 5, 7, 8, 9, 11, 15, 18, 19, 22, 27, 28, 31, 37, 40, 42, 45, 49, 50, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74], "coerc": [28, 59], "cogniz": 42, "cohes": 2, "colin": 0, "colleagu": 15, "collect": [2, 13, 15, 16, 17, 18, 22, 33, 41, 49, 51, 53, 57, 63, 66, 67, 68], "collection_1": 60, "collection_2": 60, "collector": 12, "collis": 43, "color": 65, "column": [8, 16, 59, 60, 68, 73], "column_a": 60, "column_count": 63, "column_missing_schem": 63, "column_nam": 60, "column_ord": 73, "column_typ": [50, 63], "columnar": 2, "columnproperti": [59, 63], "com": [7, 15, 18, 31, 38, 45, 46], "combin": [2, 10, 11, 15, 16, 25, 32, 33, 35, 40, 49, 58], "combinator": 16, "combine_act": 68, "combine_las_report": 68, "come": [16, 25, 28, 29, 37, 47, 52, 59, 64, 66, 67, 70, 71, 72, 73, 74], "comfort": [41, 46, 68, 72, 74], "comma": 69, "command": [2, 7, 15, 16, 25, 27, 29, 32, 36, 38, 42, 45, 46, 49, 52, 66, 67, 69, 72, 73, 74], "comment": [60, 63], "commentari": 60, "commerci": 24, "commit": [18, 19, 27, 31, 36, 37, 43, 66, 68, 70, 72], "common": [0, 2, 9, 10, 11, 15, 16, 18, 22, 28, 49, 52, 57, 66, 67, 69, 73], "commonli": [29, 50, 56, 67], "commun": [2, 8, 19, 24, 31, 37, 45, 47, 60, 69, 70], "compabl": 43, "compar": [8, 35, 57, 65, 66, 67, 69], "comparison": 35, "compat": [8, 9, 10, 22, 31, 37, 38, 41, 45, 51, 52, 59], "complet": [7, 8, 10, 15, 16, 19, 24, 29, 34, 36, 40, 42, 45, 57, 65, 66, 67, 68, 69, 70, 72, 74], "complex": [9, 15, 16, 45, 49, 65, 68], "compliant": 37, "complic": 73, "compon": [11, 18, 24, 27], "compos": [10, 11, 42, 59, 63, 69], "composit": [10, 15, 16, 38, 59], "compound": 16, "comprehens": 16, "compromis": [15, 16], "comput": [0, 2, 7, 10, 15, 16, 29, 32, 33, 36, 40, 49, 50, 51, 52, 66, 69, 70, 72, 74], "computation": 69, "concat": 68, "concaten": 68, "concept": [29, 67], "conceptu": [19, 59, 66], "concern": [8, 15, 24, 29, 32, 66, 67], "concis": 16, "conclud": 29, "conclus": [51, 74], "concret": [16, 50, 57, 61, 63], "concurr": 43, "conda": [2, 15, 31, 36, 37, 38, 42, 49], "conda_subdir": 46, "condit": [58, 67], "confid": 52, "config": 46, "configur": [9, 11, 27, 47, 68, 69], "confirm": [7, 36, 44, 49, 64, 66, 67, 68, 70, 73], "conflict": [10, 31, 42], "confound": 12, "confus": [10, 29, 31], "congratul": 72, "connect": [45, 57], "consensu": 16, "consequ": [16, 59], "consid": [2, 10, 11, 15, 16, 18, 27, 42, 52, 59, 63, 66, 67, 68, 69], "consider": [16, 43, 63, 68], "consist": [9, 18, 50, 59, 63], "constrain": [16, 59], "constraint": [8, 10, 36], "construct": [8, 11, 14, 16, 22, 42, 59, 63], "construct_artifact_collect": 60, "constructor": 60, "consum": [50, 52], "consumm": [15, 67], "consumpt": [2, 67], "contain": [2, 8, 9, 10, 11, 15, 16, 19, 24, 27, 29, 30, 32, 33, 35, 37, 45, 50, 52, 53, 57, 60, 63, 66, 67, 70, 72, 73, 74], "content": [2, 4, 7, 9, 15, 29, 30, 38, 49, 63, 65, 66, 67, 71], "context": [2, 12, 15, 16, 27, 38, 45, 46, 51, 56, 57, 61, 62, 66, 68, 69, 70], "contigu": 59, "continu": [19, 27, 36, 52, 66, 68, 72], "contract": 32, "contraint": 10, "contrast": [2, 9, 15, 25], "contribut": [5, 15, 19], "contributor": 5, "control": [27, 66, 68, 69, 72], "convei": 67, "conveni": [9, 10, 16, 18, 27, 50, 52, 57, 58, 64, 65, 66], "convent": [27, 34, 45, 49, 59, 66, 67, 69, 70, 73], "convers": 28, "converst": 64, "convert": [2, 8, 10, 22, 28, 34, 57, 60, 61, 63, 64, 66, 73], "convinc": [67, 70], "cook": 16, "cookiecutt": [24, 27, 71], "cool": [27, 36, 44, 50, 52, 57, 64, 67, 68], "cool_project": 50, "coordin": [2, 8, 32], "copi": [64, 67, 72], "copyfil": 61, "copyright": 67, "core": [9, 12, 14, 15, 16, 18, 33, 50, 59, 60, 61, 67, 68], "core_metr": 33, "core_metrics_phylogenet": 15, "correct": [15, 49, 52], "correctli": [52, 65], "correspond": [30, 32, 38, 59, 63, 66, 67, 73], "corrupt": 11, "cost": [16, 52], "costli": 52, "could": [10, 15, 16, 25, 29, 30, 32, 38, 44, 45, 49, 52, 57, 59, 65, 66, 67, 68, 70, 73], "couldn": [15, 52], "count": [29, 32, 65], "counter": 67, "counterpart": 16, "counterproduct": 52, "coupl": [8, 31, 52, 64, 66, 67], "courier": 65, "cours": [16, 31, 47, 67, 69], "cover": [7, 24, 45, 49], "cpu": 59, "crash": [40, 52], "creat": [4, 7, 9, 11, 12, 15, 16, 24, 27, 29, 30, 31, 36, 37, 38, 41, 42, 43, 44, 45, 46, 49, 50, 51, 52, 54, 57, 58, 59, 60, 63, 64, 65, 66, 67, 70, 71, 73, 74], "creation": [10, 15, 68], "creator": 66, "credit": 70, "criteria": [47, 63], "critic": [2, 69], "cron": 31, "cross": [7, 15, 52], "crude": 65, "cryptosporangium": 73, "csvdirformat": 57, "csvformat": 57, "ctx": [33, 54, 56, 57, 68, 69], "curiou": 49, "current": [4, 9, 11, 12, 15, 16, 18, 19, 24, 30, 31, 36, 38, 42, 44, 46, 49, 61, 63], "curti": 33, "custom": [4, 15, 18, 31, 72], "custom_ax": 15, "cut": 16, "cutadapt": [43, 50], "cutleri": 16, "cycl": [17, 20, 38], "czi": 24, "d": [0, 5, 24, 27, 31, 32, 42, 45, 65, 66, 67, 69, 70, 72], "d_001": 11, "dada2": [15, 43], "daf": 24, "daf2019": 24, "dag": 15, "dai": 24, "daniel": [0, 74], "darn": 36, "dash": [8, 45], "data": [2, 7, 8, 11, 12, 13, 16, 17, 18, 26, 28, 32, 34, 44, 50, 51, 52, 57, 58, 59, 60, 61, 63, 65, 66, 67, 68, 72, 74], "databas": 68, "datafram": [29, 50, 52, 57, 59, 60, 63, 68, 69, 73], "dataset": [7, 32], "date": [19, 24, 31, 37], "datetim": 15, "david": 0, "de": 30, "deadlin": 19, "deal": [7, 16, 64], "debug": 31, "decemb": 52, "decentr": [10, 13, 17, 18], "decid": [8, 52, 59, 67, 69], "decis": [10, 16, 29, 68], "declar": [11, 29], "decor": [14, 16, 34, 57, 66], "decoupl": 8, "decreas": 68, "dedic": 49, "deep": [12, 15, 16], "def": [11, 28, 30, 32, 33, 34, 35, 49, 50, 52, 57, 60, 64, 65, 66, 67, 68, 69, 70, 73], "default": [15, 27, 31, 32, 36, 38, 50, 53, 57, 58, 60, 63, 66, 67, 68, 69, 70, 72], "default_missing_schem": 63, "defer": [8, 60], "defin": [2, 5, 8, 10, 11, 15, 18, 19, 22, 25, 27, 28, 29, 30, 31, 32, 33, 34, 35, 38, 41, 42, 46, 50, 51, 52, 57, 58, 59, 60, 63, 65, 69, 73, 74], "definit": [11, 16, 25, 30, 35, 49, 58, 66, 67, 68, 70], "defunct": 57, "degre": 32, "delai": 29, "delet": [64, 67, 72], "deliber": 58, "deliv": 10, "deliver": 19, "demonstr": [10, 57, 60, 67, 72], "demultiplex": [11, 29], "demultiplexed_seq": 18, "demutiplex": 66, "demux": 50, "denot": [2, 8], "dep": 19, "depend": [2, 8, 9, 15, 18, 19, 29, 31, 36, 38, 42, 45, 46, 49, 50, 66, 68, 69], "deploi": [43, 70], "deploy": [2, 29, 42, 43, 64, 69, 72], "deprec": [19, 24, 57, 59], "depth": 25, "deriv": [2, 24, 67], "descend": 68, "describ": [2, 4, 8, 9, 10, 11, 15, 16, 18, 27, 29, 31, 32, 33, 35, 45, 46, 49, 52, 60, 63, 64, 65, 66, 67, 68, 69, 70], "descript": [8, 9, 10, 15, 30, 32, 33, 35, 37, 45, 52, 57, 63, 64, 65, 66, 67, 69, 73], "descriptor": [14, 16, 43, 61], "design": [9, 10, 19, 28, 31, 63, 64, 68, 69], "desir": 60, "destin": [10, 28, 30, 61], "destroi": 12, "destruct": 12, "destructor": 12, "detail": [2, 4, 9, 10, 15, 16, 18, 30, 32, 34, 37, 39, 45, 49, 50, 56, 63, 66, 67, 68], "detect": [29, 66], "determin": [9, 10, 15, 16, 19, 27, 28, 32, 50, 63, 65, 67, 68], "dev": [19, 24, 27, 31, 46, 49, 65, 66, 67, 69, 73], "dev0": 46, "develop": [2, 7, 8, 10, 11, 15, 18, 20, 23, 27, 29, 31, 34, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 47, 49, 50, 57, 58, 62, 63, 64, 65, 67, 68, 69, 70, 71, 72, 73, 74], "devic": 65, "df": [50, 60, 66], "diagram": [18, 19], "dialog": [16, 52], "diataxi": [0, 70], "dict": [22, 30, 53, 57, 59, 60, 63, 67, 68, 69], "dict_of_int": 60, "dictat": [59, 60], "dictionari": [22, 30, 32, 45, 49, 57, 59, 68, 69, 70, 73], "did": [64, 66, 67, 68, 69, 73], "didn": [2, 16, 40, 65, 67], "diff": 66, "differ": [2, 7, 9, 10, 11, 15, 16, 18, 22, 24, 29, 31, 32, 35, 38, 41, 45, 46, 51, 52, 60, 63, 64, 65, 66, 67, 68, 69, 70, 72], "differec": 52, "differenti": [11, 16, 18, 68, 73], "difficult": [10, 12, 29, 38], "digress": 66, "dillon": 0, "dimens": 32, "dine": 16, "dir": [58, 67, 72], "direct": [8, 15, 16, 31, 47, 74], "directli": [8, 10, 12, 15, 18, 22, 27, 28, 29, 30, 32, 34, 49, 50, 59, 64, 66, 67, 69, 73], "directori": [2, 9, 10, 12, 13, 15, 17, 18, 27, 29, 30, 31, 36, 37, 38, 46, 49, 57, 60, 65, 67, 69, 70, 72], "directory_format": [14, 57], "directoryformat": [2, 11, 55, 57, 66], "disabl": 66, "disambigu": 29, "disassoci": 15, "discontinu": 59, "discourag": 9, "discours": 47, "discov": [15, 29, 31, 36, 44, 67, 70], "discoveri": [29, 52], "discret": 2, "discuss": [4, 7, 10, 15, 16, 19, 24, 27, 29, 31, 39, 42, 52, 66, 67, 70, 71], "disk": [2, 10, 11, 29, 30, 60, 63, 66], "dispatch": [9, 16, 18], "displai": [15, 27, 45, 49, 60, 65, 67, 72], "disregard": 49, "dissemin": 70, "distanc": [32, 33, 50, 66], "distance_matrix": [28, 32, 33], "distancematrix": [28, 32, 33, 34, 66], "distinct": [15, 16, 33, 57, 59, 67, 73], "distinguish": [2, 10, 16, 59], "distribut": [2, 7, 15, 19, 24, 31, 41, 45, 50, 51, 52, 67, 68, 72], "distro": [19, 37], "dive": [15, 16], "divers": [15, 25, 32, 33, 35, 43, 45, 49, 69], "diversity_lib": 49, "divid": 68, "di\u00e1taxi": [0, 24, 74], "dm": 33, "dna": [2, 11, 65, 66, 67, 68, 69, 70], "dnafastaformat": [11, 67], "dnaiter": [18, 66, 67, 68], "dnasequencesdirectoryformat": [11, 18], "do": [7, 10, 15, 16, 18, 19, 24, 27, 28, 30, 32, 33, 34, 35, 36, 37, 40, 42, 45, 47, 49, 50, 52, 57, 59, 60, 64, 65, 66, 67, 68, 69, 70, 71, 73, 74], "doc": [7, 19, 24, 37, 60, 63, 70], "docstr": [63, 67], "doctyp": 65, "document": [0, 6, 8, 10, 15, 16, 17, 18, 19, 24, 27, 29, 30, 36, 37, 41, 42, 45, 47, 48, 49, 52, 57, 60, 61, 63, 67, 70, 72, 74], "documentat": 70, "docx": 10, "doe": [2, 8, 9, 10, 12, 15, 16, 24, 25, 27, 30, 32, 35, 37, 44, 49, 57, 58, 59, 61, 63, 66, 67, 68, 69, 70], "doen": 9, "doesn": [11, 15, 16, 19, 27, 29, 32, 42, 44, 46, 48, 63, 65, 66, 67, 68, 69, 70], "doi": [24, 44], "domain": [8, 16, 43, 57, 59], "don": [2, 4, 7, 10, 16, 19, 27, 31, 34, 36, 38, 44, 49, 52, 64, 65, 66, 67, 69, 70, 71, 72, 73], "done": [7, 8, 15, 29, 31, 32, 36, 42, 45, 53, 60, 66, 67, 68, 69, 70, 73], "dot": 8, "doubl": 59, "doubt": 44, "down": [15, 16, 66], "download": [15, 46, 52, 60, 72], "downstream": [31, 52, 73], "dozen": 16, "dr": 2, "draft": 42, "drill": 15, "driven": [2, 67], "driver": [7, 49, 57, 60, 70], "drop": 63, "drop_all_miss": 63, "drop_all_uniqu": 63, "drop_missing_valu": [50, 63], "drop_zero_vari": 63, "dropdown": 16, "dry": [2, 69, 73], "dst": 61, "dtype": 63, "due": [10, 30, 31, 68], "dull": 16, "dull_par": 16, "dummi": 52, "dummy_output": 52, "dummy_plugin": [30, 60], "dump": 16, "duplic": [9, 15, 61, 70, 72, 73], "duplicate_t": [29, 67], "durat": 15, "dure": [7, 15, 36, 45, 49, 52, 57, 60, 66, 67, 69], "dwq2": [4, 24, 29, 38, 45, 64, 65, 66, 67, 68, 69, 70, 72, 73], "dwq2_action": 70, "dynam": [8, 12], "e": [0, 2, 7, 9, 10, 11, 12, 15, 18, 19, 22, 24, 27, 29, 30, 31, 32, 33, 35, 36, 37, 38, 42, 43, 44, 45, 49, 50, 52, 53, 57, 59, 60, 61, 63, 65, 66, 67, 68, 69, 70, 72, 74], "e072706": 18, "e1011676": 0, "e168": 15, "e5c5": 15, "each": [8, 9, 10, 15, 16, 18, 19, 24, 27, 29, 31, 32, 33, 37, 38, 42, 49, 50, 57, 59, 60, 63, 65, 66, 67, 69, 70, 74], "earli": [4, 74], "earlier": [16, 30, 66, 67, 69], "eas": [10, 15], "easi": [9, 16, 49, 66, 67, 69], "easier": [15, 16, 18, 36, 38, 42, 64, 66, 67], "easiest": [38, 49, 71, 72], "easili": [15, 27, 29, 70], "eat": 16, "ebb5968ebafb": 15, "ecosystem": [19, 31, 47, 66], "ed": 59, "ed5d": 15, "edg": 67, "edit": [0, 7, 27, 40, 52, 66, 67], "editor": 27, "effect": [8, 15, 59, 68], "effici": [29, 66], "effort": [8, 15, 52], "eigendecomposit": 32, "eigenvalu": 32, "eigenvector": 32, "eigh": 32, "either": [2, 8, 16, 19, 29, 31, 36, 42, 52, 59, 63, 66, 67, 68, 69, 72], "element": [15, 16, 45, 50, 59, 60], "elev": 50, "elig": [47, 50], "elizabeth": 0, "els": [10, 27, 29, 30, 49, 66, 69], "elsevi": 67, "elsewher": [52, 69], "email": [15, 47], "emp": 50, "emperor": [15, 33, 45], "emperor_plot": 33, "emploi": [43, 65], "emppairedenddirfmt": 11, "empti": [27, 30, 52, 57, 59], "en": 65, "enabl": [2, 9, 10, 15, 27, 36, 40, 44, 49, 50, 64, 65, 66, 67, 68, 69, 70, 73], "enclos": 38, "encod": [9, 10, 63], "encode_miss": 63, "encount": [42, 66, 68], "encourag": [47, 57, 73], "end": [8, 15, 30, 44, 45, 59, 65, 66, 67, 69, 71, 72, 74], "endnot": 67, "energi": 68, "enforc": [16, 59, 63], "engin": [2, 19, 52, 67, 69], "enough": [9, 16, 49, 68], "ensur": [9, 11, 12, 31, 46, 49, 50, 52, 58, 65, 66, 67, 68, 70], "entir": [8, 9, 11, 12, 16, 38, 50, 57, 65, 69], "entireti": [66, 68], "entiti": [5, 10, 66], "entri": [2, 8, 27, 52, 53, 57, 59], "entry_point": [27, 45], "enumer": [8, 11, 30, 59, 68], "env": [31, 38, 46, 67], "environ": [2, 7, 10, 18, 19, 31, 36, 37, 38, 41, 42, 49, 51, 66, 67, 70, 72, 73], "environment": 67, "epeat": 69, "epoch": [31, 37, 38, 60], "epub": 10, "equal": [11, 16, 68], "equenc": 67, "equival": [7, 22, 59, 69], "erron": 69, "error": [10, 11, 29, 52, 60, 63, 66, 67, 73], "especi": [29, 72], "essenti": [16, 30, 45, 52, 57, 59, 66], "establish": 43, "etc": [11, 15, 16, 18, 19, 32, 45, 50], "euclidean": 50, "eval": 14, "evalu": [16, 60], "evan": [0, 5, 16, 24], "evelop": 24, "even": [10, 15, 16, 27, 29, 33, 42, 49, 52, 65, 66, 67, 68], "evenness_vector": 33, "event": [15, 31, 59, 60, 67], "eventu": 40, "ever": [15, 16, 27, 35, 59, 64, 73], "everi": [9, 10, 11, 15, 35, 57, 59, 63, 67, 69, 70, 74], "everyon": [16, 19, 44, 52], "everyth": [29, 46, 49, 52, 56, 64, 65, 66, 67, 68, 72], "everywher": 14, "evid": 68, "evil": 11, "evolut": 67, "evolv": [9, 18], "exact": 32, "exactli": [2, 10, 15, 25, 35, 49, 63, 64, 66, 67, 73], "examin": 28, "exampl": [2, 4, 7, 8, 9, 11, 12, 16, 18, 19, 24, 25, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 40, 41, 43, 44, 45, 46, 50, 51, 52, 56, 57, 58, 59, 61, 62, 63, 64, 65, 66, 67, 68, 69, 71, 72, 74], "example1": 57, "example2": 57, "example_funct": 30, "example_function_variant1": 57, "example_function_variant2": 57, "excacerb": 12, "except": [11, 12, 15, 16, 33, 35, 41, 44, 51, 59, 65, 66, 67, 69], "excit": [50, 70], "exclud": [16, 27, 45, 59], "exclus": [43, 49, 58, 59, 69], "execut": [2, 8, 32, 49, 57, 58, 60, 67, 68, 69, 70, 72, 74], "execute_exampl": [49, 58, 70], "executionusag": 49, "executionusagevari": 60, "exemplifi": 29, "exercis": 68, "exist": [2, 4, 10, 11, 15, 16, 19, 27, 29, 30, 32, 36, 40, 41, 43, 47, 50, 51, 52, 57, 59, 60, 61, 66, 67, 68, 72], "exit": [12, 22, 29, 40, 67, 72], "exp": 49, "exp_format": 58, "expand": [4, 7, 15, 57, 65, 74], "expect": [7, 10, 11, 16, 22, 24, 29, 30, 32, 35, 42, 44, 46, 49, 52, 58, 64, 65, 66, 67, 68, 70, 72], "expected_hit": 68, "expens": 69, "experi": [15, 44, 46, 68, 70], "experienc": [27, 42], "expert": 47, "expertis": [52, 70], "explain": 16, "explan": [17, 24, 27, 29, 39, 51, 66], "explanatori": [19, 66], "explicit": 73, "explicitli": [16, 27, 30, 40, 52, 59], "explor": [24, 35, 45, 65, 69, 70], "export": [7, 50, 65, 67, 70], "expos": [11, 49, 50, 69], "express": [15, 16, 22, 49, 57, 59, 60, 70], "ext": 60, "extend": [2, 10, 30, 58, 67], "extens": [5, 31, 35, 39, 60, 66], "extension": 16, "extent": 44, "extern": [19, 52, 57, 69], "extol": 16, "extra": [11, 16, 37, 52, 58, 67, 73], "extract": [9, 10, 15], "extrem": 66, "f": [0, 11, 38, 49, 53, 60, 66, 73], "f1000": 44, "f6105891": 18, "f95f324": 18, "face": [49, 66, 70], "facet": 10, "facilit": [0, 7, 10, 31, 37, 41, 42, 51, 67, 72, 73], "fact": [30, 42, 67], "facto": 30, "factori": [11, 16, 22, 59, 60, 64, 70], "factory1": 60, "factory2": 60, "fail": [8, 29, 31, 52, 58, 65, 66], "failur": [29, 31, 52, 66, 67], "fair": [10, 67], "fairli": [38, 68], "faith_pd": 18, "fall": [19, 67], "fallen": 31, "fals": [15, 34, 57, 58, 59, 63, 66, 67, 68], "familar": 73, "famili": 65, "familiar": [29, 38, 45, 49, 50, 66], "fanci": 16, "far": [16, 32, 73], "fast": 32, "fasta": [10, 11, 29, 66, 67], "faster": [7, 8], "fastq": [10, 11, 29, 66], "fastqgzformat": 11, "favorit": 67, "featur": [2, 10, 19, 25, 29, 33, 37, 38, 49, 50, 52, 57, 59, 63, 66, 68, 70, 72, 73], "feature_data": [18, 67], "feature_t": [33, 49, 52], "feature_table1": 49, "feature_table2": 49, "feature_table3": 49, "feature_table_merge_exampl": 49, "feature_table_merge_three_tables_exampl": 49, "featuredata": [52, 65, 66, 67, 68, 69, 73], "featuret": [9, 28, 29, 32, 33, 49, 52, 72], "feb": 15, "feedback": [4, 5, 27, 71], "feel": [15, 31, 42, 44, 52, 66, 68, 70, 72], "few": [15, 16, 19, 28, 29, 31, 33, 35, 37, 43, 47, 48, 58, 65, 66, 69, 73, 74], "fewer": 68, "ff": [34, 57, 60, 64, 66, 70], "ff427b50aaa1": 15, "fh": [11, 34, 57, 58, 65, 66, 68, 73], "field": [15, 16, 22, 37, 52, 53, 59, 60, 66, 67], "field_memb": [16, 59], "field_nam": [16, 59], "fifteen": 15, "fig": [9, 15, 18, 37], "figur": [2, 8, 35, 52, 65, 66, 68], "file": [2, 8, 10, 13, 16, 17, 18, 19, 25, 26, 27, 30, 31, 32, 34, 35, 36, 37, 38, 45, 46, 49, 51, 52, 53, 57, 58, 60, 61, 63, 64, 65, 67, 68, 69, 70, 72, 73], "file1": 60, "file2": 60, "filecollect": 11, "fileformat": 11, "filehandl": 53, "filenam": [10, 11, 15, 18, 27, 31, 58, 66], "filepath": [27, 53, 58, 59, 63, 66], "filesystem": [12, 59], "fill": 38, "fillet": 16, "filter": [7, 63, 68, 73], "filter_column": [50, 63], "filter_id": 63, "final": [8, 15, 16, 35, 42, 45, 49, 50, 59, 66, 67, 68, 69, 70, 73, 74], "find": [15, 16, 24, 27, 29, 33, 35, 38, 41, 44, 45, 52, 57, 59, 61, 64, 67, 68, 69, 70, 72, 73, 74], "fine": [15, 36, 42, 46, 52], "finish": 8, "first": [7, 8, 11, 16, 19, 24, 27, 28, 31, 33, 35, 36, 38, 41, 42, 49, 51, 52, 54, 57, 59, 64, 66, 68, 70, 71, 72, 73], "first_memb": 60, "fish": 16, "fit": 59, "five": 15, "fix": [10, 16, 19, 31, 52, 59, 66], "flake8": 46, "flavor": [25, 37], "flexibl": [42, 65, 66, 70, 73], "flexilib": 49, "float": [16, 59, 63, 66, 67, 69], "flow": 68, "flower": 16, "fly": 11, "fn": 66, "focu": [11, 15, 24, 42, 46, 49, 66], "focus": [47, 63, 67], "fold": 73, "folder": 37, "folk": 70, "follow": [2, 9, 10, 16, 18, 19, 27, 30, 31, 32, 33, 35, 36, 37, 38, 40, 42, 45, 46, 49, 57, 63, 64, 65, 66, 67, 68, 69, 70, 72, 73], "font": 65, "foo": [30, 57, 59, 60], "forg": [15, 31, 38], "forget": [15, 16, 67, 71], "fork": [7, 16], "form": [2, 8, 15, 16, 30, 52, 66, 67], "formal": [16, 68, 69], "format": [2, 8, 9, 10, 13, 15, 16, 17, 26, 27, 28, 31, 32, 34, 37, 41, 42, 43, 45, 48, 49, 50, 51, 56, 57, 58, 60, 62, 63, 64, 65, 67, 68, 70, 73, 74], "format_inst": 11, "format_str": 22, "former": 42, "formerli": 2, "fortun": [12, 30], "forum": [19, 30, 42, 45, 47, 52, 57, 66, 67, 70, 71], "forward": [11, 19, 31, 36, 67, 69, 70, 74], "found": [5, 8, 15, 18, 19, 31, 58, 59, 64, 65, 66, 67, 68, 72, 73], "foundat": [24, 42], "four": [8, 67], "fp": 66, "fr": 0, "fraction": 68, "fragil": 65, "fragment": [18, 57, 59, 68], "frame": 19, "framework": [0, 2, 8, 9, 11, 14, 15, 16, 18, 24, 28, 39, 43, 45, 46, 49, 50, 52, 58, 60, 67, 70], "free": [2, 15, 27, 44, 45, 47, 52, 66, 67, 68, 72], "freedom": [16, 66], "freez": 19, "frequenc": [9, 28, 29, 31, 32, 33, 49, 52, 72], "frequent": [29, 70], "fridai": [19, 29], "friendli": [16, 45, 67, 68], "from": [2, 4, 5, 7, 8, 9, 10, 11, 12, 15, 16, 18, 19, 22, 24, 27, 28, 29, 30, 31, 32, 33, 34, 36, 38, 40, 42, 43, 44, 45, 46, 47, 49, 51, 52, 53, 54, 57, 58, 59, 60, 63, 65, 66, 67, 68, 69, 70, 71, 73, 74], "from_typ": [58, 61, 67], "front": [27, 37], "frost": 16, "fruit": 16, "frustrat": [29, 52, 68], "fsvd": 32, "ft": 49, "ft1_factori": 49, "ft2_factori": 49, "full": [15, 18, 24, 48, 65, 67, 68, 69, 70], "fulli": [7, 15, 37, 52, 69], "fun": 70, "function": [2, 4, 8, 9, 11, 15, 16, 27, 28, 29, 30, 31, 34, 37, 39, 42, 45, 46, 49, 50, 52, 54, 57, 58, 60, 64, 66, 68, 69, 70, 73, 74], "fund": 19, "fundament": [16, 67, 74], "funder": 24, "further": [8, 12, 15, 16, 59, 63], "futur": [7, 10, 11, 19, 24, 30, 40, 52, 59, 69, 70], "fuzzi": 16, "g": [9, 10, 11, 12, 15, 18, 22, 24, 27, 29, 31, 33, 35, 36, 37, 38, 42, 43, 44, 45, 49, 50, 52, 53, 60, 63, 66, 68, 69, 70, 72, 74], "g1827eab": 46, "g7cf7a7a": 46, "g8ac7e3": 46, "gain": 63, "galaxi": [2, 52, 67, 70, 74], "game": 67, "gap": [65, 67], "gap_extend_penalti": [66, 67, 68, 69], "gap_open_penalti": [66, 67, 68, 69], "garbag": [13, 17, 52], "gatekeep": 4, "gave": 30, "gehret": 0, "gene": 68, "gener": [0, 2, 4, 7, 8, 9, 10, 11, 15, 16, 19, 22, 24, 25, 27, 28, 29, 31, 32, 35, 36, 38, 43, 44, 47, 49, 52, 57, 59, 60, 64, 65, 66, 67, 68, 69, 70, 71, 73, 74], "genera": 29, "genom": 67, "genu": 73, "get": [8, 10, 15, 16, 27, 30, 34, 36, 44, 45, 46, 49, 52, 58, 65, 66, 67, 68, 69, 70, 72, 73, 74], "get_act": [33, 54, 68, 69], "get_artifact_collection_memb": 60, "get_available_cor": 61, "get_column": [59, 63], "get_data_path": [58, 66, 67], "get_id": [50, 63], "get_index_path": 68, "get_metadata_column": 60, "get_miss": 63, "get_sequence_id": 66, "get_transform": [58, 64], "get_valu": 63, "ggcctttttttt": [65, 67], "gh": [36, 72], "gish": 0, "git": [7, 31, 36, 38, 46, 67], "github": [4, 5, 7, 15, 18, 19, 24, 37, 38, 41, 42, 45, 46, 47, 51, 66, 70, 72], "githubusercont": [38, 46], "give": [8, 15, 16, 37, 45, 49, 66, 69, 70], "given": [2, 10, 15, 16, 19, 22, 29, 49, 54, 57, 59, 60, 65, 66, 67, 68], "glanc": [8, 10], "global": [15, 43, 57, 67, 69], "global_pairwise_align_nucleotid": [66, 67, 69], "glossari": 3, "go": [7, 16, 19, 27, 31, 36, 44, 49, 52, 65, 66, 67, 68, 69, 70, 71, 72], "goal": [8, 16, 24, 29, 41, 44, 52, 64, 65, 67, 68, 69, 70, 73], "goe": [11, 15, 19], "golden": [67, 72], "gone": 52, "good": [16, 19, 27, 31, 45, 50, 60, 65, 66, 67, 68, 70, 71, 72], "googl": 67, "gotcha": 11, "grab": 46, "grai": 8, "grain": 15, "grammar": 16, "grant": [19, 24], "granular": 16, "grape": 16, "graph": 15, "graphic": [2, 10, 16, 35, 52, 67], "grasp": 16, "great": [16, 37, 49, 66, 70], "greater": [18, 59, 67], "greg": [5, 24, 44, 67], "gregcaporaso": 46, "gregori": 0, "gross": 16, "groundwork": 5, "group": [2, 8, 16, 35, 68, 70], "grow": 27, "grumpi": 36, "gttt": 67, "guarante": 52, "guid": [24, 27, 31, 38, 39, 46, 49, 51, 70], "guidanc": [42, 74], "guidelin": [38, 70], "gz": 11, "gzip": 11, "ha": [8, 9, 10, 11, 15, 16, 18, 24, 27, 29, 31, 33, 36, 40, 42, 45, 49, 50, 52, 59, 63, 65, 66, 67, 68, 69, 72, 73, 74], "habit": 45, "hack": [46, 49], "had": [9, 16, 29, 44, 57, 65, 66, 69], "hadn": 9, "halfwai": 8, "halko2011": 32, "hand": [8, 15, 16, 29, 50, 52, 66, 73], "handl": [12, 15, 28, 30, 41, 50, 51, 52, 63, 64, 68], "happen": [15, 16, 19, 27, 29, 32, 60, 66, 68], "happi": [16, 70, 71], "har": [48, 58], "hard": [15, 16, 29, 43, 66], "harder": 16, "hardwar": 15, "has_missing_valu": [50, 63], "hash": 16, "hassl": 31, "have": [2, 5, 8, 9, 10, 11, 12, 15, 16, 18, 19, 24, 28, 29, 30, 31, 32, 33, 36, 37, 38, 40, 42, 43, 44, 46, 47, 49, 50, 52, 58, 59, 60, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74], "haven": [10, 16, 19, 31, 52, 66, 67, 68], "head": [16, 58, 65], "header": 63, "hear": [5, 12, 29], "hello": [59, 60], "help": [4, 7, 10, 15, 16, 19, 27, 29, 31, 35, 36, 37, 38, 42, 45, 46, 47, 49, 52, 57, 60, 66, 67, 69, 70, 71, 72, 73], "helper": [58, 64, 66, 68, 70], "here": [2, 4, 7, 8, 11, 15, 16, 18, 24, 27, 28, 29, 31, 32, 33, 34, 35, 36, 38, 44, 45, 46, 48, 49, 50, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73], "herman": 0, "hesit": 19, "heurist": 32, "hide": 15, "hierarchi": 16, "high": [8, 15, 45, 66, 67, 68, 69], "highest": [8, 37, 68], "highli": [11, 52, 67, 70], "highlight": 10, "hint": [65, 66, 67, 70], "histor": [9, 18, 27], "histori": [2, 10, 15, 18], "hit": [68, 73], "hoc": [11, 59], "hold": [15, 16], "home": 16, "homebrew": 27, "homologi": [68, 73], "honor": 70, "hood": [64, 68, 70], "hook": [14, 58, 65], "hope": [19, 29, 44, 68], "hopefulli": [31, 66], "host": [2, 7, 15, 24, 37, 38, 72], "hour": 29, "hous": [15, 19, 38, 73], "how": [2, 4, 7, 8, 9, 11, 13, 15, 16, 17, 24, 27, 29, 31, 32, 34, 36, 37, 39, 42, 45, 46, 49, 51, 52, 59, 60, 63, 65, 66, 67, 68, 69, 70, 72, 73, 74], "howev": [2, 5, 8, 10, 16, 38, 42, 50, 52, 66, 73], "html": [7, 9, 35, 65, 68, 73], "http": [0, 7, 15, 18, 24, 31, 38, 45, 46, 60, 63, 67], "huge": [9, 29, 67], "human": [18, 32, 57, 59, 65, 66, 67, 68], "hunt": [0, 2], "hurt": 44, "hyphen": 57, "hypothes": 67, "hypothesi": [2, 67], "i": [2, 4, 5, 7, 8, 9, 11, 12, 13, 14, 16, 17, 18, 19, 22, 24, 25, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 42, 43, 44, 45, 46, 48, 49, 50, 52, 53, 54, 56, 57, 58, 59, 60, 61, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74], "i_tabl": 49, "icon": [15, 18], "id": [2, 49, 50, 57, 59, 60, 63, 64, 66, 68, 70, 73], "id_count": 63, "id_head": 63, "idea": [2, 4, 7, 8, 9, 10, 16, 19, 27, 29, 31, 44, 66, 67, 70, 73], "ideal": [7, 16, 42, 44, 57, 66, 67, 70], "ident": [2, 9, 18, 66, 67, 69], "identfii": 66, "identif": 0, "identifi": [2, 8, 15, 28, 31, 49, 50, 52, 57, 59, 60, 63, 66, 67, 68, 73], "identity_with_metadata_column_get_mdc": 49, "ids_to_keep": 63, "idx": 11, "ignor": [9, 10, 27, 52, 57, 59, 63, 67], "ignore_missing_sampl": 15, "ignore_pcoa_featur": 15, "iim": 24, "illumina": 11, "illustr": [8, 9, 16, 18, 28, 36, 37, 42, 67, 69], "imag": 37, "imagin": [16, 30, 49], "immedi": [19, 44, 74], "immutablemetadata": 50, "imp": 19, "impact": [10, 15, 29, 32, 59, 67, 68], "imped": 16, "implement": [9, 16, 30, 31, 38, 49, 52, 60, 63, 66, 67, 68, 69, 73, 74], "implementationerror": 22, "impli": [9, 66, 67, 69], "implic": 67, "implicit": 59, "import": [7, 8, 10, 14, 15, 16, 18, 27, 29, 31, 32, 34, 43, 44, 45, 49, 52, 57, 59, 64, 65, 67, 68, 69, 70, 73], "import_data": [33, 49, 60, 64, 68, 70], "import_from_format": 60, "import_modul": 66, "importantli": [8, 15, 67, 70, 73], "importlib": 66, "imposs": [15, 29], "improv": [4, 19, 44], "in_": 64, "inaccur": [15, 24], "inact": 8, "inadvertantli": 15, "inappropri": 29, "incident": 70, "includ": [2, 7, 9, 10, 11, 15, 16, 19, 24, 27, 31, 32, 33, 35, 37, 38, 44, 45, 49, 50, 52, 57, 59, 60, 63, 66, 67, 68, 69, 70, 72, 73, 74], "include_suffix": 63, "inclus": 59, "inclusive_end": [16, 59, 67], "inclusive_start": [59, 67], "incom": 19, "incompat": [30, 74], "incomplet": [15, 52, 69], "incomprehens": 15, "inconveni": 10, "incorpor": 25, "incorrect": 29, "increas": [67, 68], "incredibli": 10, "increment": [44, 59], "incur": 67, "indent": 16, "independ": [29, 59, 66], "index": [3, 9, 35, 59, 60, 63, 65, 68, 73], "index_fp": 68, "indic": [5, 8, 15, 29, 30, 32, 36, 42, 45, 46, 49, 58, 59, 63, 65, 66, 67, 68, 69, 73], "indistinct": 16, "individu": [2, 15, 27, 45, 49, 53, 63, 67, 68], "ineffect": 52, "inequ": 16, "inf": 52, "infer": [49, 50, 63, 67, 73], "infin": 59, "influenc": 32, "info": 46, "inforamt": 27, "inform": [2, 8, 9, 10, 11, 12, 14, 15, 16, 18, 19, 24, 27, 29, 31, 32, 34, 42, 44, 45, 47, 50, 57, 65, 66, 67, 68, 72, 73], "informat": 24, "infrastructur": [19, 68], "infrequ": 64, "inher": 66, "inherit": [18, 67], "ini": 9, "init_artifact": [49, 60, 70], "init_artifact_collect": 60, "init_artifact_from_url": 60, "init_format": 60, "init_metadata": 60, "init_metadata_from_url": 60, "initi": [11, 24, 27, 29, 31, 36, 49, 65, 66, 67, 74], "inject": 49, "inner": [15, 63, 73], "inplac": [68, 73], "input": [2, 8, 9, 11, 12, 15, 16, 18, 25, 28, 29, 32, 33, 34, 35, 41, 49, 50, 51, 57, 58, 59, 60, 65, 66, 67, 69, 72], "input_descript": [32, 33, 35, 52, 57, 65, 67, 69], "inputtypea": 59, "inputtypeb": 59, "insdc": 63, "insert": [18, 65, 67], "insid": [10, 16, 18, 32, 49, 66, 68, 73], "insight": [19, 44], "inspect": 16, "inspir": 60, "instal": [2, 7, 10, 27, 31, 37, 41, 42, 43, 44, 45, 49, 51, 64, 66, 70, 73], "instanc": [2, 16, 30, 32, 45, 49, 50, 57, 58, 66, 67, 69], "instanti": [22, 27, 30, 32, 50, 57, 60, 66, 67, 70], "instead": [8, 12, 16, 22, 29, 33, 45, 52, 53, 57, 59, 63, 65, 67, 68, 69], "institut": 24, "instruct": [7, 10, 24, 27, 31, 32, 37, 38, 41, 42, 46, 70, 72, 74], "int": [11, 16, 30, 32, 33, 57, 59, 60, 61, 63, 68], "int_collect": 60, "int_collection6": 60, "int_collection7": 60, "int_dict": 30, "int_list": 30, "int_seq_collect": 60, "integ": [9, 11, 16, 30, 57, 59, 63], "integr": [15, 19, 27, 40, 42, 49, 51, 68, 74], "intellig": 16, "intend": [2, 8, 22, 24, 29, 36, 46, 49, 50, 66, 67, 68, 70, 74], "intent": [2, 8, 29, 59], "intention": [9, 65], "inter": [8, 16, 67], "interact": [2, 8, 9, 16, 22, 30, 45, 50, 52, 67, 69], "interest": [11, 15, 16, 24, 27, 38, 44, 50, 57, 59, 68, 71], "interestingdataformat": 50, "interfac": [2, 4, 7, 8, 10, 11, 15, 18, 23, 24, 25, 27, 32, 36, 45, 46, 49, 50, 52, 57, 59, 60, 66, 67, 74], "intermedi": [15, 25, 66], "intern": [10, 29, 30, 50, 57, 60, 66, 69, 70], "interoper": 42, "interpret": [2, 9, 15, 18, 25, 44, 52, 59, 63, 68, 70], "interrupt": 68, "intersect": 59, "intervent": 7, "intial": 60, "introduc": [4, 18, 29, 36], "introduct": [0, 2, 49, 67, 68, 73], "introspect": 8, "intsequence1": [57, 60], "intsequence2": 57, "intsequenceformat": [11, 60], "intuit": [16, 67], "invalid": [11, 29, 52, 63, 66, 67], "invent": 10, "invers": 59, "invert": 16, "invest": 44, "investig": 15, "invoc": 16, "invok": [8, 12, 49, 54, 58, 60], "involv": [10, 16], "io": [53, 66], "ipython": [67, 70], "iq": 29, "is_semantic_typ": 59, "isn": [7, 11, 16, 27, 37, 44, 58, 60, 66, 67, 68, 70, 73], "iso": 15, "issu": [12, 15, 29, 31, 42, 45, 47, 49, 66, 71], "itcr": 31, "item": [19, 30, 67], "iter": [7, 30, 44, 53, 59, 60, 63, 67, 68], "ith": 24, "its": [2, 7, 8, 10, 11, 15, 16, 18, 27, 28, 29, 30, 32, 35, 39, 45, 49, 50, 54, 57, 60, 63, 65, 66, 67, 68, 69, 70, 72, 73], "itself": [8, 9, 10, 15, 30, 59, 66, 67], "iupac": 66, "j": 0, "jaccard": 33, "jaccard_distance_matrix": 33, "jaccard_emperor": 33, "jaccard_pcoa_result": 33, "januari": [7, 52], "jargon": 66, "jewel": 0, "job": [29, 31, 59, 68], "join": [63, 65, 68, 71, 73], "journal": [44, 67], "journei": [0, 67], "json": [16, 22], "jsonp": 18, "juggl": 12, "jupyt": [2, 24, 70], "just": [8, 14, 15, 16, 24, 27, 29, 30, 42, 44, 46, 49, 50, 52, 59, 64, 65, 66, 67, 68, 70, 72, 73], "k": 57, "keef": 0, "keep": [11, 15, 16, 27, 31, 33, 37, 43, 65, 68], "kei": [8, 15, 18, 30, 32, 37, 45, 49, 52, 53, 57, 59, 60, 67, 70], "kept": 73, "key1": 59, "key2": 59, "keyerror": 73, "keyword": 49, "kind": [2, 8, 11, 16, 29, 50, 66], "kishitanii": 73, "kit": 8, "kitchen": 16, "knife": 16, "knive": 16, "know": [9, 11, 16, 19, 24, 27, 29, 36, 44, 49, 52, 65, 66, 67, 68, 70, 72, 73], "knowledg": [8, 47, 67, 69], "known": [10, 12, 16, 29, 32, 59], "kruskal1952us": 35, "kwarg": 60, "la": [68, 73], "lab": [19, 24, 38, 42, 64, 65, 66, 67, 68, 69, 70, 72, 73], "label": [8, 16, 49], "lack": 16, "lai": 5, "lane_numb": 11, "lang": 65, "languag": [10, 14, 15, 16, 29], "laptop": [68, 70], "larg": [9, 15, 29, 32, 44, 57, 66, 67, 74], "larger": [8, 59, 68], "las_act": 68, "las_result": 68, "last": [14, 16, 36, 52, 65, 66, 68, 72], "latebindingattribut": 14, "later": [8, 10, 66, 67, 72], "latest": [31, 37, 49, 72], "latter": 42, "launch": 7, "layer": 8, "layout": [2, 10], "lead": [27, 29, 40, 52, 66], "learn": [10, 24, 27, 28, 44, 48, 67, 69, 70, 72, 74], "least": [2, 11, 19, 29, 30, 35, 52, 63, 66], "leav": [16, 27, 29, 31, 38, 65], "left": [29, 63, 73], "left_on": 73, "legal": 59, "legendrelegendr": 32, "len": [66, 73], "length": [68, 73], "lengthi": 16, "less": [8, 24, 29, 61, 66], "lesson": [65, 67], "let": [15, 16, 24, 27, 33, 36, 49, 52, 59, 64, 65, 66, 67, 68, 69, 70, 72, 73, 74], "level": [8, 11, 15, 27, 31, 36, 37, 38, 41, 45, 50, 51, 52, 57, 63, 65, 66, 67, 69, 70, 72], "lib": [31, 67], "librari": [31, 32, 41, 42, 45, 49, 51, 66, 67], "licens": 67, "life": 28, "lifetim": 12, "lift": 10, "lightli": 27, "lignment": 67, "like": [2, 7, 8, 9, 10, 11, 15, 16, 18, 24, 27, 29, 30, 31, 32, 33, 35, 36, 38, 40, 41, 42, 43, 45, 46, 47, 49, 50, 52, 57, 59, 60, 61, 64, 65, 66, 67, 68, 69, 70, 72, 73], "limit": [11, 15, 16, 38, 42, 43, 59], "line": [2, 7, 11, 15, 16, 18, 28, 29, 32, 36, 45, 46, 52, 57, 60, 65, 66, 67, 73], "linear": 9, "link": [5, 15, 35, 49, 61, 63, 66, 67, 68, 69], "linkcod": 5, "linux": [36, 46], "lipman": 0, "list": [3, 7, 11, 14, 15, 16, 18, 19, 29, 30, 32, 33, 35, 37, 38, 42, 45, 46, 49, 53, 57, 58, 59, 60, 66, 67, 68, 69, 71, 73], "liter": [49, 57, 60], "littl": [7, 16, 45, 65, 66, 67, 72], "live": [15, 19, 27, 42, 45, 66], "ll": [15, 16, 24, 27, 29, 31, 36, 38, 41, 46, 49, 52, 64, 65, 66, 67, 68, 69, 70, 72, 73, 74], "llm": 15, "load": [8, 11, 18, 27, 29, 32, 37, 45, 49, 50, 52, 53, 57, 58, 63, 65, 66, 67, 70, 72], "local": [0, 7, 36, 46, 49, 58, 67, 69, 72, 73], "local_alignment_search": 68, "local_pairwise_align_nucleotid": [67, 69], "localalignmentsearchresult": [68, 73], "localalignmentsearchresultsformat": 73, "localhost": 7, "locat": [8, 12, 37, 38, 52], "log": [15, 33, 36], "logic": [9, 11, 59, 61], "login": 36, "long": [2, 8, 10, 11, 28, 29, 32, 37, 38, 42, 57, 59, 65, 66, 67, 68], "longer": [57, 65, 66, 67, 68], "longitudin": 50, "look": [8, 9, 11, 16, 18, 27, 29, 30, 31, 33, 35, 38, 40, 41, 45, 49, 50, 58, 59, 64, 65, 66, 67, 68, 69, 70, 72, 73, 74], "lookup": [60, 67], "loop": 68, "loss": 32, "lot": [16, 27, 29, 31, 44, 45, 47, 49, 52, 64, 65, 66, 68, 70, 73], "loudli": 29, "love": [5, 12, 42, 44], "lower": 63, "lsmat": 34, "lsmatformat": 34, "luck": 44, "luckili": 65, "m": [0, 7, 27, 49, 65, 66, 67, 68, 69, 70, 72], "m3": 68, "macbook": 68, "machin": [15, 16, 52, 66], "machineri": [36, 58, 66], "maco": 46, "macosx": 15, "made": [10, 18, 24, 29, 40, 49, 50, 60, 66, 67, 72], "magic": [27, 68], "magnitud": 32, "mai": [2, 4, 7, 8, 10, 15, 16, 18, 19, 24, 27, 29, 30, 31, 32, 41, 42, 49, 50, 52, 54, 57, 59, 60, 63, 66, 67, 68, 69, 70, 72, 74], "mail": 45, "main": [16, 19, 31, 38, 40, 63, 65, 66], "maint": 19, "maintain": [10, 27, 31, 38, 42, 47, 49, 69, 73], "mainten": [15, 19, 31], "major": [52, 65, 66], "make": [4, 7, 9, 10, 11, 15, 16, 18, 27, 29, 30, 31, 32, 35, 36, 37, 38, 42, 43, 44, 46, 49, 52, 57, 59, 63, 64, 65, 67, 68, 69, 70, 72, 73, 74], "make_artifact": [33, 54, 69], "makefil": 36, "manag": [2, 9, 12, 15, 19, 27, 46, 52, 54, 58, 60, 61, 66, 67, 68, 69, 72], "mani": [5, 9, 10, 11, 15, 16, 18, 27, 29, 32, 35, 43, 44, 49, 50, 66, 67, 68, 69, 73], "manipul": [8, 9, 10, 59, 60, 63], "manner": [32, 50], "manual": [15, 30, 31, 49, 66], "manuscript": [2, 15, 44], "map": [22, 32, 59, 60, 63, 67, 68, 70], "mapping_1": 60, "mapping_2": 60, "mappingproxytyp": 63, "march": [0, 2, 11], "mari": 0, "markdown": [24, 37], "market": 44, "massiv": 15, "masteri": [0, 67], "match": [16, 18, 43, 45, 46, 54, 57, 59, 60, 63, 65, 67, 68, 73], "match_scor": [66, 67, 68, 69], "materi": [7, 50, 58, 60, 70], "matric": 32, "matrix": [32, 33, 66], "matter": [16, 32, 59], "matthew": 0, "max": [11, 57, 66], "maxim": [41, 51, 66], "mayb": [65, 69], "md": [18, 36, 37, 42, 50, 59, 60, 72], "md1": 60, "md2": 60, "md3": 60, "md5": 18, "md5sum": 18, "md_for_column": 60, "me": [16, 27, 52, 65, 66, 67, 69, 70, 72], "mean": [5, 8, 9, 10, 12, 15, 16, 24, 29, 38, 43, 45, 59, 66, 67, 68, 72], "meaning": [49, 52], "meaningless": 52, "meant": [2, 59], "meantim": 66, "mechan": [16, 36, 42, 52, 57], "medic": 67, "meet": [37, 49, 63, 70], "member": [11, 16, 19, 22, 59, 60], "memori": [2, 10, 12, 29, 63, 68], "mention": [36, 65, 66, 67, 69, 70], "menu": 16, "merg": [9, 19, 37, 49, 60, 63, 73], "merge_metadata": 60, "merged_t": 49, "messag": [29, 52, 57, 63, 67, 72, 73], "met": 37, "meta": [27, 46, 65], "metaclass": 14, "metadata": [2, 15, 16, 18, 25, 27, 33, 35, 41, 45, 49, 51, 56, 62, 64, 65, 66, 68, 70, 74], "metadata_column": 73, "metadata_index": 73, "metadatacolumn": [16, 50, 59, 63], "metadatafileerror": 63, "metagenom": [2, 31, 38, 42], "metapackag": [2, 31, 42], "metaprogram": [13, 17], "method": [0, 2, 11, 14, 15, 16, 18, 19, 22, 25, 27, 28, 30, 33, 35, 38, 41, 43, 49, 50, 51, 52, 54, 57, 58, 60, 63, 65, 66, 69, 70, 71, 72, 73, 74], "methodnam": 58, "metric": [15, 28, 32, 33, 45], "mi": 15, "microbiom": [2, 7], "microsecond": 15, "mid": 68, "middl": 19, "might": [10, 11, 16, 29, 30, 38, 45, 46, 49, 50, 58, 60, 66, 67, 68], "migrat": 57, "miller": 0, "min": [11, 57, 66], "mind": [15, 16, 42, 43, 66, 70], "mine": [16, 66, 68, 70], "mini": 47, "miniconda": 46, "miniconda3": [46, 67], "minim": [11, 39, 40, 46, 52, 66], "minimum": 65, "minor": [40, 67], "minut": [14, 29, 64, 65, 66, 67, 68], "mirror": 15, "miscellan": [67, 72], "misdiagnos": 52, "misialq": 24, "misinform": 52, "misinterpret": 29, "mismatch": [16, 65, 67], "mismatch_scor": [66, 67, 68, 69], "miss": [29, 42, 50, 52, 63, 68, 73], "missing_id": 73, "missing_schem": [59, 63], "mission": 16, "mistak": 66, "misus": 10, "mix": [16, 74], "mode": [7, 8, 11, 46, 55, 66], "model": [11, 14, 15, 16, 52, 66], "moder": 47, "modestli": 70, "modif": [40, 66], "modifi": [18, 67, 68], "modul": [2, 5, 16, 27, 56, 57, 59, 65, 66, 67, 69, 70], "modulo": 16, "mol": 0, "molecular": [0, 67], "moment": [5, 7, 48, 67], "mondai": 29, "monitor": [45, 47, 68], "monospac": 65, "month": [19, 47], "more": [2, 4, 8, 9, 10, 11, 12, 15, 16, 18, 19, 24, 25, 27, 29, 31, 32, 33, 36, 37, 38, 39, 41, 42, 44, 45, 47, 48, 49, 50, 52, 57, 59, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74], "morn": 29, "most": [7, 8, 10, 15, 16, 19, 24, 29, 31, 37, 40, 43, 44, 50, 52, 57, 59, 65, 66, 67, 68, 69, 70, 74], "mostli": 66, "motiv": [10, 29], "mouth": [16, 44], "move": [7, 8, 9, 10, 19, 30, 31, 46, 60, 64, 66, 67, 68, 69, 74], "mroe": 27, "msa": [65, 66, 67, 69, 70], "msa_summari": 69, "much": [8, 10, 11, 16, 29, 30, 46, 49, 60, 66, 67], "multi": [7, 68, 69], "multiindex": 73, "multipl": [7, 8, 10, 11, 15, 16, 18, 22, 24, 29, 30, 38, 52, 57, 58, 59, 60, 65, 66, 67, 68, 74], "multiprocess": 12, "must": [2, 8, 11, 15, 16, 18, 19, 28, 30, 32, 33, 35, 37, 40, 45, 49, 57, 58, 59, 60, 61, 63, 66, 67, 68, 69], "mutual": 58, "mv": 2, "my": [27, 29, 37, 44, 49, 52, 57, 64, 65, 66, 67, 68, 69, 70, 72, 73, 74], "my_act": [52, 60], "my_artifact": 60, "my_column": 60, "my_int": 60, "my_metadata": 60, "my_method": 57, "my_pipelin": 57, "my_plugin": 60, "my_visu": 57, "my_viz": 50, "myer": 0, "mynewformat": 52, "mypi": 32, "myself": 70, "myst": 24, "n": [11, 38, 46, 68], "n_char": 66, "n_job": 33, "n_jobs_or_thread": 15, "n_less": 61, "name": [2, 8, 9, 10, 11, 15, 16, 18, 22, 27, 30, 31, 32, 33, 34, 35, 37, 38, 43, 45, 46, 49, 52, 55, 57, 58, 59, 60, 63, 65, 66, 67, 68, 69, 70, 73], "namedtupl": [22, 53], "namespac": [22, 43], "nan": [58, 63], "narrow": [8, 59], "nation": 24, "nativ": 2, "natur": [59, 63, 70, 74], "navig": [36, 59], "nc": 24, "nd": 24, "nearli": 67, "neat": 27, "necessari": [10, 11, 16, 50, 56, 68], "necessarili": [8, 16, 29, 47, 57], "necessit": [31, 74], "need": [4, 7, 8, 9, 10, 11, 16, 19, 22, 24, 27, 29, 30, 31, 33, 36, 37, 38, 42, 44, 45, 46, 49, 50, 52, 57, 59, 60, 61, 64, 65, 66, 67, 68, 69, 70, 71, 73], "needleman": [0, 67, 69], "needleman1970": [67, 70], "needleman1970gener": 67, "neg": [52, 59, 67], "neither": [15, 16], "nest": [2, 8, 15, 16, 27], "network": 31, "never": [8, 16, 31, 34, 41, 52, 66, 67, 69], "new": [2, 4, 7, 9, 10, 11, 12, 15, 16, 18, 19, 24, 29, 30, 31, 32, 36, 37, 38, 39, 42, 43, 44, 45, 46, 51, 52, 54, 59, 61, 63, 65, 68, 69, 70, 71, 73, 74], "newer": 19, "newick": [10, 29, 66], "next": [15, 19, 31, 35, 36, 44, 45, 47, 52, 66, 67, 68, 69, 70, 71, 72, 73, 74], "nexu": 66, "nice": [16, 41, 51, 70], "nicer": 65, "nih": 24, "node": [15, 66, 68], "nois": 57, "nomenclatur": 16, "non": [8, 10, 15, 22, 32, 33, 49, 50, 59, 60, 66, 67], "non_definite_chars_count": 66, "none": [8, 11, 22, 32, 33, 35, 49, 50, 53, 54, 55, 57, 58, 59, 60, 61, 63, 65, 66, 67, 73], "nonetheless": 16, "nonsens": 59, "nor": 15, "normal": [12, 15, 16, 33, 59, 63, 66, 67], "notabl": [10, 15], "note": [8, 15, 30, 31, 36, 38, 48, 49, 57, 59, 61, 63, 64, 66, 67, 68], "notebook": [2, 15], "noth": [15, 27, 57, 59, 60, 61, 63], "notic": [11, 19, 29, 32, 47, 66, 68, 69], "notif": [29, 47, 74], "notion": 15, "noun": 2, "novemb": 0, "now": [8, 10, 11, 16, 18, 24, 31, 36, 40, 42, 44, 46, 49, 59, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73], "np": [49, 63], "nucleotid": [65, 67], "null": [9, 15], "num": 59, "num1": 57, "num2": 57, "num_split": 68, "number": [8, 11, 15, 16, 27, 28, 32, 45, 46, 50, 57, 59, 60, 61, 63, 67, 72, 73], "number_of_dimens": 32, "numer": [16, 59, 63], "numeric_md_col": 50, "numericmetadatacolumn": [50, 63], "numpi": 49, "nw": [65, 67, 69], "nw_align": [65, 66, 67, 70], "nw_align_act": 69, "nw_align_example_1": 70, "nwaligntest": 67, "o": [15, 30, 49, 53, 59, 61, 65, 67, 70, 72, 73], "o1": 49, "o2": 49, "ob": 58, "object": [2, 8, 12, 14, 15, 16, 19, 27, 28, 32, 33, 34, 35, 50, 51, 53, 57, 58, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 73], "obs_feat_vector": 49, "obscur": [52, 64, 66], "observ": [8, 11, 16, 33, 42, 52, 64, 65, 66, 67, 68], "observed_featur": 49, "observed_features_exampl": 49, "observed_hit": 68, "observed_index": 68, "observed_otu": 33, "observed_otus_vector": 33, "observed_viz": 68, "obtain": [50, 60, 63, 68], "obviou": 16, "obvious": [16, 44], "occur": [8, 11, 12, 15, 49, 67], "occurr": 31, "octob": [0, 18, 19, 31], "odd": 67, "off": [12, 16, 31, 38, 44, 52, 66, 69], "offend": 43, "offens": 66, "offer": [12, 18, 47, 50], "offici": [31, 38], "often": [10, 15, 16, 27, 29, 34, 38, 52, 65, 67, 68, 70, 74], "ok": [29, 52, 65, 66], "okai": 46, "old": [7, 16, 24], "older": [9, 15, 19, 29, 57, 72], "omiss": 59, "omit": 63, "onc": [8, 10, 11, 16, 19, 31, 32, 37, 44, 49, 59, 64, 66, 68], "one": [2, 8, 9, 10, 11, 15, 16, 18, 25, 27, 29, 30, 31, 32, 33, 34, 35, 36, 38, 40, 42, 43, 45, 48, 49, 50, 52, 57, 59, 63, 65, 66, 67, 68, 69, 70, 72, 73], "oner": 8, "ones": [42, 66, 67], "ongo": 19, "onion": 8, "onli": [2, 5, 8, 9, 11, 15, 16, 18, 24, 25, 29, 32, 33, 35, 36, 37, 42, 44, 45, 46, 50, 52, 57, 59, 60, 61, 63, 64, 65, 66, 67, 68, 69, 72, 73, 74], "onlin": [31, 44], "opaqu": 66, "open": [4, 7, 10, 11, 15, 34, 37, 46, 50, 52, 57, 65, 66, 67, 68, 70, 73], "oper": [2, 10, 15, 16, 25, 27, 29, 50, 52, 57, 68, 73], "opinion": 11, "opportun": [50, 52, 68, 69], "oppos": [2, 46, 66, 68], "opposit": [59, 68], "opt": [68, 72], "option": [11, 15, 22, 31, 36, 38, 44, 45, 47, 49, 58, 59, 63, 68], "optional1": 57, "optional2": 57, "orang": 59, "orchestr": 2, "order": [10, 11, 15, 16, 30, 31, 49, 57, 59, 60, 63, 67, 68, 73], "ordereddict": 53, "ordinationresult": 32, "org": [0, 7, 15, 18, 24, 31, 38, 46, 60, 63, 67], "organ": [16, 19, 24, 38, 42, 46, 66], "orient": 57, "origin": [2, 9, 10, 18, 30, 32, 33, 35, 58, 63, 68, 73], "osx": 46, "other": [2, 4, 5, 8, 9, 10, 11, 15, 16, 19, 24, 25, 27, 29, 30, 32, 35, 36, 37, 38, 41, 42, 45, 51, 52, 54, 57, 58, 60, 63, 65, 66, 67, 68, 69, 70, 72, 73, 74], "other_plugin": 16, "otherwis": [11, 30, 50, 57, 58, 59, 63, 72, 73], "otu": 33, "our": [4, 7, 10, 15, 16, 19, 24, 29, 38, 42, 44, 49, 52, 64, 65, 66, 69, 70, 71, 72, 73], "ourself": 69, "ourselv": [16, 67], "out": [9, 11, 14, 16, 19, 27, 29, 31, 37, 42, 44, 50, 52, 57, 60, 63, 65, 66, 67, 68, 69, 70, 72, 73], "outcom": [15, 29, 49, 50, 52, 67], "outdat": [15, 24, 29], "outer": 15, "outf": 52, "outlin": [19, 31, 38, 60], "output": [2, 11, 15, 16, 18, 25, 28, 29, 32, 33, 34, 35, 41, 49, 51, 57, 59, 60, 65, 66, 67, 68, 69, 70, 72, 73], "output_descript": [32, 33, 35, 52, 57, 67, 69], "output_dir": [35, 50, 57, 65, 73], "outsid": [27, 40, 59, 67], "outweigh": 68, "over": [7, 8, 9, 11, 15, 16, 18, 29, 33, 44, 45, 53, 60, 66, 67, 68, 69], "overal": [8, 18], "overhead": 68, "overlap": [49, 59, 63], "overlap_method": 49, "overload": 29, "overrid": [58, 60, 63], "overridden": 58, "overriden": 60, "oversel": 44, "oversight": 66, "overview": [13, 17], "overwrit": 61, "own": [2, 4, 7, 11, 15, 16, 28, 31, 41, 42, 47, 49, 52, 54, 64, 67, 70, 71, 72, 73, 74], "owner": [31, 37, 38], "p": [24, 49, 65, 67], "pacakg": 27, "packag": [2, 8, 14, 15, 19, 26, 31, 32, 38, 45, 46, 51, 53, 57, 58, 65, 66, 67, 68, 70, 72], "pad": 65, "page": [5, 7, 12, 27, 36, 37, 44, 45, 52, 60, 65, 67], "pai": [36, 52], "pain": 67, "pair": [2, 10, 28, 33, 37, 50, 53, 59, 67], "pairedendsequenceswithqu": 11, "pairwis": [2, 50, 65, 68, 69], "panda": [29, 35, 50, 59, 60, 63, 68, 69], "paper": [16, 44, 67], "paperpil": 67, "paragraph": 15, "parallel": [7, 8, 27, 41, 51, 69, 74], "parallel_config": 68, "parallelconfig": 68, "paramet": [2, 8, 10, 15, 16, 22, 25, 28, 30, 32, 33, 35, 45, 46, 49, 50, 53, 57, 58, 59, 61, 63, 65, 66, 67, 68, 69, 70, 72, 73], "parameter_descript": [32, 33, 35, 50, 52, 57, 65, 67, 69], "params_only_method": 60, "paranthraci": 73, "pare": 16, "parent": 15, "parenthesi": 8, "pars": [9, 18, 29], "parse_format": 22, "parse_typ": [14, 22], "parser": [9, 18], "parsl": 68, "part": [4, 11, 12, 17, 24, 30, 31, 38, 39, 42, 48, 52, 56, 59, 60, 65, 66, 67, 70, 71, 73], "parti": 43, "particular": [2, 8, 9, 10, 19, 38, 50, 59, 60], "particularli": 12, "partit": 50, "pass": [2, 10, 11, 15, 18, 19, 29, 30, 31, 36, 38, 45, 46, 49, 50, 52, 59, 65, 66, 67, 68, 69, 70, 73], "passag": 8, "passthrough": 15, "past": [38, 64, 67], "pastri": 16, "pastrybag": 16, "patch": 19, "path": [5, 12, 29, 30, 35, 37, 45, 49, 52, 53, 55, 58, 59, 60, 63, 64, 65, 67, 70, 72, 73], "pathlib": 58, "pathlik": 53, "pathspec": 55, "pattern": [11, 27, 38, 51, 62, 66], "payload": [2, 9, 10, 11], "pcoa": [15, 32, 33], "pcoa_result": 33, "pcoaresult": [32, 33], "pd": [29, 35, 50, 52, 57, 59, 60, 63, 68, 73], "pdt": 68, "pear": 16, "peek": [60, 67, 70], "peer": 44, "pen": 16, "penalti": 67, "pencil": 16, "pend": [18, 48, 66], "peopl": [16, 27, 44, 69], "per": [10, 11, 15, 29, 59, 65, 68], "percent": [68, 73], "perciev": 66, "perfect": 16, "perform": [2, 8, 9, 10, 11, 15, 16, 29, 31, 36, 39, 50, 52, 53, 60, 63, 64, 65, 66, 67, 68, 69], "permit": [10, 16, 57], "persist": [10, 11, 15], "person": [10, 16, 38, 70], "perspect": 44, "ph": 50, "phone": 52, "photobacterium": 73, "phrase": 29, "phylogenet": [15, 29, 32, 33, 66, 67], "phylogenetic_metr": 28, "phylogeni": [15, 28, 29, 32, 66], "phylum": 73, "pick": 19, "pictur": [7, 8, 60], "piec": [2, 9, 10, 16, 69], "pielou": 33, "pielou_": 33, "pin": 19, "pip": [7, 31, 36, 38, 42, 49], "pipelin": [2, 18, 22, 25, 28, 41, 51, 56, 57, 62, 73, 74], "pipx": 72, "pivot": 50, "pkg_resourc": 15, "place": [10, 11, 27, 30, 37, 47, 48, 59, 63, 66, 67, 68, 69, 73], "placehold": 48, "plai": [31, 41, 51], "plain": [10, 16], "plan": [15, 18, 29, 31, 47, 49, 52, 66, 71, 72], "platform": [15, 47], "pleas": [15, 19, 24, 42, 44, 47, 49, 52, 66, 67], "plo": 0, "plot": [15, 33, 35], "plu": 11, "plugin": [2, 4, 5, 7, 8, 10, 11, 14, 15, 16, 18, 24, 25, 26, 29, 30, 32, 33, 34, 35, 40, 41, 47, 49, 50, 53, 54, 55, 58, 59, 60, 62, 63, 64, 66, 68, 69, 70, 71, 73], "plugin_id": [49, 60, 70], "plugin_setup": [34, 45, 49, 65, 66, 68, 69, 70], "pluginmanag": [2, 7, 27, 60], "pluginmethod": 57, "pluginpipelin": 57, "pluginvisu": 57, "png": [15, 35], "point": [8, 9, 15, 27, 35, 36, 42, 57, 59, 63, 64, 66, 67, 68, 69, 73], "poke": [27, 72], "popular": [44, 70], "port": [15, 24], "posit": [2, 59, 65, 66, 67], "possess": [16, 59, 60], "possibl": [9, 10, 15, 16, 18, 29, 37, 38, 49, 52, 58, 59, 61, 64, 65, 66, 67, 68, 69, 70], "possibli": [9, 15], "post": 67, "potenti": 29, "pound": 63, "power": [16, 27, 49, 66, 67, 68, 70], "pr": [31, 37], "practic": [16, 52, 60, 65, 66, 72], "pragmat": [0, 67, 69], "pre": [27, 65], "predecessor": 18, "predefin": [2, 73], "predetermin": 16, "predic": 16, "predict": 31, "prefer": [15, 16, 27, 29, 31, 45, 49, 60, 66], "prefix": [49, 58], "prepar": [44, 60, 69, 73], "presenc": [11, 58], "present": [4, 7, 9, 11, 15, 18, 30, 32, 35, 38, 49, 58, 63, 65, 66, 67, 68, 70, 73], "preserv": [60, 63], "presum": [44, 66], "pretend": 49, "pretti": [27, 36, 68], "prevent": [10, 11, 15, 43, 66, 69], "preview": 7, "previou": [11, 15, 38, 45, 64, 65, 66, 67], "previous": [9, 18, 24, 31, 42, 66, 69], "previous_v": 11, "primari": [2, 15], "primarili": [2, 15, 24, 40], "primit": [2, 10, 13, 17, 22, 30, 32, 49, 57, 60, 67, 69], "princip": 32, "principl": [2, 10, 69, 73], "print": [16, 49, 60, 70], "prior": [10, 15, 18, 19, 30, 33, 38, 50], "priorit": 19, "prioriti": [44, 52], "privat": [27, 59, 66, 67], "privileg": 8, "pro": 68, "probabl": [16, 29, 44, 49, 52, 66, 68], "problem": [9, 10, 29, 31, 52, 66], "problemat": [15, 52, 68], "proce": [38, 68, 73], "proceed": 40, "process": [2, 7, 8, 12, 16, 19, 31, 36, 37, 40, 44, 45, 49, 52, 61, 66, 67, 68, 72], "processor": 68, "procida": [0, 74], "produc": [2, 12, 15, 16, 18, 22, 25, 28, 32, 33, 35, 49, 52, 57, 59, 67, 68, 69, 70], "profession": 0, "program": 29, "programat": 15, "programm": [0, 29, 67, 69], "programmat": 16, "progress": [19, 44, 74], "project": [5, 10, 19, 24, 27, 32, 44, 45, 46, 52], "project_nam": 57, "prolifer": 73, "promis": 52, "promot": [4, 44], "prompt": [67, 72], "prone": 66, "proof": 10, "propag": 27, "properli": 49, "properti": [14, 50, 59, 63, 65, 66], "proport": [16, 59], "prospect": [15, 36], "protein": [0, 2, 66, 67], "protocol": 14, "prototyp": [52, 67], "proud": 44, "proven": [0, 2, 7, 8, 13, 17, 18, 33, 52, 63, 65, 68, 72, 74], "provid": [2, 4, 5, 8, 9, 10, 11, 12, 15, 16, 19, 22, 24, 25, 27, 28, 29, 30, 31, 32, 33, 34, 35, 37, 38, 39, 41, 42, 45, 46, 48, 50, 51, 53, 59, 60, 61, 63, 64, 65, 66, 67, 68, 69, 70, 72, 73, 74], "proxi": [49, 68], "pseudomonadota": 73, "public": [4, 9, 11, 22, 41, 42, 49, 51, 52, 56, 66], "publish": [29, 44, 67, 74], "pull": [7, 9, 18, 27, 31, 37], "pull_request": 31, "punctuat": 45, "purpos": [8, 10, 16, 24, 50, 57, 60, 65, 67, 70, 72], "push": [12, 31, 36], "put": [27, 31, 38, 66, 67, 68, 69, 73], "py": [5, 16, 18, 45, 49, 64, 65, 66, 68, 70], "pypi": 45, "pytest": [46, 49], "python": [2, 7, 8, 12, 14, 15, 16, 19, 27, 32, 34, 40, 45, 46, 49, 52, 53, 57, 63, 66, 68, 69, 74], "python3": 67, "q": [24, 68], "q1": 68, "q2": [15, 18, 25, 28, 29, 34, 38, 43, 45, 46, 48, 49, 50, 57, 64, 65, 66, 67, 68, 69, 70, 72, 73], "q2_divers": [28, 32, 33, 35, 45], "q2_dwq2": [65, 66, 67, 68, 69, 70], "q2_feature_t": 49, "q2_type": [18, 32, 67], "q2cli": [2, 15, 46, 49, 66, 70, 74], "q2dev": 46, "q2galaxi": 70, "q2view": 15, "qiim": [0, 2, 4, 5, 7, 9, 11, 12, 13, 15, 16, 17, 18, 20, 22, 26, 28, 29, 30, 31, 32, 33, 35, 36, 39, 40, 41, 43, 47, 49, 50, 51, 52, 53, 56, 57, 58, 59, 60, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73], "qiime2": [2, 5, 7, 9, 11, 12, 14, 15, 16, 18, 22, 24, 27, 31, 32, 35, 37, 38, 45, 46, 48, 49, 50, 52, 53, 55, 56, 57, 58, 59, 60, 61, 63, 64, 65, 66, 67, 68, 69, 70, 72, 73], "qual": 29, "qualiti": [29, 67], "quantit": 44, "queri": [50, 63, 68, 73], "query_seq": 68, "query_sequ": 68, "query_sequences_art": 68, "query_split": 68, "question": [8, 9, 11, 19, 36, 42, 45, 47, 49, 50, 66, 72], "quick": [2, 11, 65, 66], "quickli": [11, 19, 29, 44, 66, 70], "quiet": [29, 67, 72], "quietli": 29, "quit": 45, "quot": 74, "qza": [10, 15, 29, 30, 49, 66, 67, 70], "qzv": [7, 10, 15], "r": [0, 7, 11, 16, 32, 52, 60, 65, 66, 68, 69], "r1": 68, "r2": 68, "r3": 68, "race": 44, "raii": 12, "rais": [11, 16, 22, 40, 57, 58, 60, 63, 66, 73], "ram": [29, 68], "ran": [15, 65, 68, 70], "random": 9, "randomli": 2, "rang": [32, 33, 59, 66, 67, 68], "rank": 57, "rare": 59, "rarefi": [25, 33, 66], "rarefied_t": 33, "rather": [7, 15, 16, 29, 31, 43, 44, 52, 65, 66, 67, 70], "raw": [38, 46, 66], "re": [2, 4, 5, 7, 10, 15, 16, 19, 24, 27, 31, 32, 36, 37, 38, 41, 43, 44, 46, 49, 52, 64, 65, 66, 67, 68, 69, 70, 72, 73, 74], "reach": [19, 30, 42, 44, 47, 49, 52, 66], "read": [2, 8, 9, 11, 16, 24, 27, 30, 31, 34, 52, 63, 64, 65, 66, 67, 68, 70, 71, 74], "read_csv": 57, "read_numb": 11, "readabl": [32, 65, 68], "reader": [8, 24, 36, 67], "readi": [7, 8, 19, 32, 36, 44, 64, 66, 67, 68, 70, 72, 73], "readiab": 0, "readm": [36, 37, 42, 72], "real": [15, 16, 24, 49, 51, 60, 68, 72, 73, 74], "realiti": 52, "realiz": [29, 59], "realli": [7, 12, 14, 70, 73], "reason": [10, 15, 29, 40, 52, 66, 69, 72, 73], "reassign": 67, "recal": [64, 66, 73], "receiv": [8, 16, 19, 33, 52, 57, 59, 66, 68, 73, 74], "recent": [7, 10, 16, 29, 31, 36, 66], "reciev": 66, "recip": [27, 46], "recogn": [16, 27, 59, 67], "recommend": [7, 11, 16, 19, 31, 36, 44, 46, 50, 57, 66, 67, 68, 70, 72], "reconsid": 67, "record": [8, 10, 11, 15, 18, 66, 67, 72, 74], "record_map": 11, "recreat": 15, "recur": 52, "recycl": [7, 68], "redesign": 4, "redirect": 61, "redirected_stdio": 61, "reduc": [15, 32, 42, 52, 66, 68], "redund": 15, "ref": [15, 18, 19, 73], "refactor": [19, 64, 68], "refer": [2, 4, 7, 9, 15, 17, 21, 24, 27, 29, 30, 31, 32, 37, 38, 39, 42, 44, 45, 48, 49, 50, 51, 64, 65, 66, 67, 68, 69, 70, 72, 73], "referenc": [27, 30, 37, 38, 67], "reference_metadata": 73, "reference_seq": [68, 73], "reference_sequ": 68, "reference_sequences_art": 68, "referenti": 9, "reflect": [15, 19, 29, 38], "reformat": 9, "refresh": [49, 65, 66, 67, 69, 73], "refus": 16, "regard": [29, 32, 44], "regardless": [15, 29, 38, 44, 63], "regex": 60, "regist": [2, 8, 10, 11, 15, 16, 18, 25, 27, 28, 29, 41, 43, 50, 51, 52, 54, 57, 58, 64, 73], "register_artifact_class": [57, 66], "register_format": [57, 66], "register_funct": [28, 30, 32, 33, 35, 49, 50, 52, 57, 65, 66, 67, 68, 69, 70], "register_semantic_typ": [16, 57, 66], "register_semantic_type_to_format": 57, "register_transform": [34, 50, 57, 64, 66], "register_valid": 57, "register_view": 57, "registr": [11, 15, 28, 30, 45, 48, 49, 50, 51, 56, 59, 62, 67, 68, 69, 70, 73], "regroup": 50, "regular": [19, 59, 60], "regularli": [31, 37], "reimplement": 49, "reindex": 73, "reinstal": 49, "rel": [15, 19, 27, 31, 37, 52, 53, 60, 63, 66, 67, 68, 73], "relat": [2, 8, 9, 10, 15, 16, 19, 27, 36, 47, 66, 67, 74], "relationship": [16, 29], "releas": [7, 17, 18, 20, 30, 31, 37, 38, 42, 46, 49, 72], "relev": [4, 8, 15, 18, 19, 24, 27, 29, 31, 38, 42, 45, 46, 50, 66, 67, 70, 73], "reli": [31, 38], "reliabl": 15, "relianc": 15, "remain": [15, 16, 18, 24, 31, 36, 68], "rememb": [15, 16, 67, 73], "remind": [38, 70], "remot": [31, 52], "remov": [4, 11, 19, 50, 63, 66, 67, 73], "renam": [2, 27], "render": [7, 37, 49, 50, 60, 70], "reorgan": [27, 66], "repair": 15, "repeat": [2, 9, 16], "repercuss": 52, "repetit": 48, "replac": [42, 44, 57, 61, 65, 67, 70], "replai": [0, 2, 7, 15, 52, 74], "replay": 52, "repo": [31, 36], "report": [67, 68], "repositori": [7, 19, 24, 27, 31, 36, 37, 38, 46, 49, 67], "repr": 65, "repres": [2, 9, 10, 11, 15, 16, 18, 22, 29, 50, 57, 59, 60, 63, 66, 67, 68, 73], "represent": [2, 9, 11, 15, 16, 18, 29, 35, 50, 59, 65, 69], "reproduc": [0, 10, 15, 52], "reproduct": 15, "request": [7, 8, 10, 18, 27, 29, 31, 42, 44, 47, 50, 58, 61, 63, 66, 67, 68, 72], "requir": [7, 8, 11, 15, 16, 19, 27, 28, 30, 31, 33, 35, 36, 40, 45, 46, 48, 49, 52, 54, 59, 63, 65, 66, 67, 68, 69, 70, 72], "research": [15, 19, 24], "reserv": 16, "reset": 58, "reset_index": 73, "resolut": 59, "resolv": [5, 40, 42], "resourc": [7, 12, 27, 37, 47, 59, 68, 69], "respect": [5, 15, 18, 27, 29, 59, 63, 67, 69], "respons": [2, 8, 9, 12, 42, 44, 47, 52, 72], "rest": 9, "restart": 68, "restrict": [8, 27, 44, 46, 50, 63, 73], "result": [2, 7, 8, 9, 15, 18, 22, 24, 29, 30, 32, 33, 35, 40, 44, 49, 50, 52, 57, 58, 59, 63, 64, 65, 66, 67, 68, 69, 70, 72, 73], "result1": 40, "result2": 40, "result_as_str": 58, "resultcollect": [22, 60], "resulttypea": 59, "resulttypeb": 59, "retain": [58, 63], "retract": [52, 67], "retriev": [60, 63, 69], "retrospect": [2, 10, 13, 17], "return": [2, 8, 11, 16, 18, 22, 29, 32, 33, 34, 35, 36, 40, 49, 50, 52, 53, 54, 57, 58, 59, 60, 61, 63, 64, 65, 66, 67, 68, 69, 70], "reus": [10, 22, 42, 68, 73], "revers": [11, 68], "review": [10, 15, 16, 19, 42, 44, 64, 65, 66, 67, 68, 73], "revis": [27, 67], "rewrit": 14, "rfc": 2, "rich": [8, 10, 16, 70], "right": [8, 16, 37, 42, 49, 52, 63, 66, 67, 74], "right_on": 73, "rightli": 69, "risk": 52, "rm": 67, "rna": [2, 66, 67], "robin": 19, "robust": [12, 16], "role": 64, "root": [2, 9, 15, 18, 28, 29, 32, 37, 49, 66], "root_uuid": 18, "rough": 8, "roughli": [10, 27, 68], "round": [8, 19, 64, 68], "roundtripp": 63, "row": [59, 63], "rrna": 66, "rstrip": 11, "rule": [10, 15, 16, 30, 59], "run": [2, 7, 11, 15, 18, 27, 29, 31, 36, 40, 42, 44, 46, 47, 49, 52, 58, 64, 65, 66, 67, 69, 70, 73, 74], "runner": 58, "runtest": 58, "runtim": [9, 14, 15, 66, 68], "s1": [49, 59, 67], "s2": [49, 67], "s3": 49, "s42": 60, "s_": 11, "s_l": 11, "sai": [16, 29, 69], "said": [44, 67], "sake": [46, 68], "same": [8, 10, 15, 16, 18, 22, 29, 30, 31, 33, 35, 38, 43, 44, 45, 49, 52, 59, 63, 64, 65, 66, 68, 69, 70, 72, 73], "sampl": [2, 10, 11, 15, 18, 25, 29, 33, 35, 45, 59, 60, 63, 73], "sample_id": [11, 49], "sampledata": [11, 29, 33, 35, 49], "sampling_depth": [15, 33], "sapienn": 48, "satisfi": 16, "saul": 67, "save": [8, 9, 10, 11, 15, 18, 50, 52, 53, 57, 63, 65, 67, 68, 70], "scale": 65, "scene": [19, 64], "schedul": [19, 31], "schema": 9, "scheme": [9, 15, 37, 63], "scholar": 67, "scienc": [2, 24], "scientif": 52, "scientist": [10, 27, 31], "scikit": [65, 66, 67], "scipi": 32, "scope": [15, 22, 27, 49, 70], "score": [60, 67, 68, 73], "scratch": [24, 36], "script": 15, "sdk": [2, 7, 8, 12, 14, 22, 49, 60, 67, 68, 69], "search": [0, 42, 47, 59, 63, 66, 67], "search_and_summarize_pipelin": 68, "searchabl": 50, "searchandsummarizetest": 68, "second": [15, 16, 33, 38, 51, 57, 59, 65, 66, 68, 70, 74], "section": [10, 15, 16, 18, 19, 24, 37, 52, 56, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73], "see": [2, 8, 9, 10, 11, 15, 16, 18, 24, 27, 28, 29, 32, 33, 35, 36, 37, 42, 44, 45, 46, 47, 48, 49, 57, 59, 61, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73], "seek": [10, 12], "seem": [8, 16, 29, 44, 47, 67], "seen": [8, 9, 11, 60, 72], "select": [7, 15, 16, 36, 52], "self": [9, 10, 11, 15, 16, 19, 52, 64, 65, 66, 67, 68, 70], "sell": 44, "semant": [2, 8, 10, 11, 13, 17, 18, 22, 26, 32, 34, 43, 48, 51, 57, 58, 60, 74], "semantic_express": 57, "semantic_typ": [57, 58, 60], "semantictyp": [16, 30, 59, 66], "semat": [11, 66], "send": [27, 68], "sens": [10, 16, 27, 29, 42, 65, 68, 69], "sentenc": 64, "separ": [15, 32, 45, 73], "seper": 16, "sept": 38, "septemb": 0, "seq": [64, 66, 67, 68, 70], "seq1": [64, 66, 67, 69, 70, 73], "seq1_factori": [64, 70], "seq2": [64, 66, 67, 69, 70, 73], "seq2_factori": [64, 70], "seq3": 73, "seq_num": 66, "sequenc": [0, 2, 8, 10, 11, 29, 64, 65, 66, 69, 70, 73], "sequence1": 67, "sequence2": 67, "sequences_path_mak": 11, "sequenceswithqu": 29, "seri": [24, 35, 36, 59, 63, 70], "serial": [9, 63, 66], "seriou": 67, "serv": [9, 12, 24, 49], "server": [7, 44, 52, 65], "session": 67, "set": [7, 8, 9, 11, 16, 18, 27, 30, 31, 32, 41, 42, 44, 50, 51, 57, 58, 59, 60, 63, 65, 66, 67, 68, 69, 70, 72, 73], "set_index": [68, 73], "set_path_mak": 11, "setup": [45, 58, 68], "setupi": 27, "setuptool": [27, 45], "sever": [2, 19, 35, 43, 45, 58, 59, 68, 73], "shannon": 33, "shannon_vector": 33, "shape": 67, "share": [4, 10, 15, 18, 22, 37, 38, 42, 44, 63, 68, 69, 72, 74], "sharp": 16, "sharp_fillet": 16, "sharpen": 16, "shell": 70, "short": [34, 37, 57, 65, 69], "short_descript": [45, 57], "shortcut": 69, "shorthand": 59, "shortli": [67, 74], "shotgun": 2, "should": [8, 10, 11, 12, 15, 16, 19, 22, 24, 27, 29, 31, 32, 33, 35, 36, 37, 38, 42, 44, 45, 46, 47, 49, 50, 52, 57, 59, 60, 63, 65, 66, 67, 69, 70, 72, 73, 74], "shouldn": [11, 27, 29, 66, 67, 73], "show": [14, 16, 18, 19, 44, 49, 67, 72, 73, 74], "shown": [8, 15, 18, 30, 45], "shred": 16, "shutil": 61, "side": [49, 58, 68], "signatur": [14, 22, 32, 35, 60, 66, 67, 68, 69, 73], "signific": [14, 18], "silenc": [67, 72], "silicon": [24, 46], "silli": [16, 66, 72], "silvers1997effect": 57, "similar": [0, 16, 22, 25, 31, 33, 35, 38, 59, 65, 67, 68, 69, 70, 73], "similarli": [24, 29, 66, 67], "simpl": [9, 15, 16, 30, 37, 45, 49, 53, 59, 65, 66, 67, 68, 69, 72, 73], "simpler": [15, 16], "simplest": [11, 68], "simpli": [9, 15, 16, 30, 50, 52, 67, 68], "simplifi": [9, 15, 44, 45, 48, 58, 64, 66, 69], "simultan": [16, 59], "sinc": [16, 27, 29, 35, 43, 47, 52, 57, 64, 65, 66, 67, 68, 73, 74], "singl": [2, 7, 9, 10, 15, 16, 18, 25, 27, 29, 30, 33, 35, 37, 38, 43, 45, 49, 50, 57, 58, 63, 65, 66, 67, 68, 69, 70, 73], "singlednasequ": [29, 64, 66, 69, 70], "singlednasequencetest": 66, "singlednasequencetransformertest": 66, "singlefiledirectoryformat": [11, 55, 57, 66], "singleint": [30, 60], "singlelanepersamplepairedendfastqdirfmt": 18, "singlerecorddnafastadirectoryformat": [64, 66], "singlerecorddnafastaformat": [66, 70], "singlerecorddnafastaformattest": 66, "singleton": [2, 57], "singular": 30, "site": [15, 50, 67, 72], "situat": [9, 11, 16, 57, 60], "size": [15, 67], "skbio": [28, 32, 34, 65, 66, 67, 68, 69, 70], "skd": 14, "skip": [11, 49, 66], "sklearn_n_jobs_descript": 33, "slate": 24, "sleev": 16, "sloan": 24, "slow": [16, 29, 32, 66, 67, 68, 69], "small": [9, 11, 57, 59, 64, 67, 68, 70], "smaller": [16, 59, 68], "smith": [0, 67, 68, 69], "smoke": 49, "sneak": 66, "snif": 11, "so": [7, 10, 11, 15, 16, 18, 19, 25, 27, 29, 30, 31, 32, 34, 35, 36, 43, 44, 45, 49, 50, 52, 57, 58, 59, 60, 64, 65, 66, 67, 68, 69, 70, 72, 73, 74], "softwar": [2, 8, 9, 10, 11, 15, 19, 27, 29, 31, 32, 42, 44, 52, 61, 67, 69, 74], "software_entri": 18, "sole": 63, "solid": 8, "solut": [10, 69], "solv": [10, 29], "some": [2, 4, 8, 9, 10, 11, 14, 15, 16, 18, 24, 25, 27, 29, 32, 33, 35, 36, 38, 42, 43, 44, 45, 48, 49, 50, 52, 57, 60, 64, 65, 66, 67, 68, 69, 70, 72, 73, 74], "some_act": 40, "some_artifact": 60, "some_plugin": 18, "somedai": 16, "someexcept": 40, "someon": [19, 27, 44, 67, 69], "someth": [16, 19, 29, 38, 40, 44, 46, 50, 52, 57, 65, 66, 67, 68, 70, 72, 74], "sometim": [10, 31, 52, 67], "somewher": 52, "soon": [37, 47], "sooner": 31, "sophist": 16, "sorri": 29, "sort": [8, 19, 29, 65, 68, 73], "sort_kei": 16, "sortabl": 50, "soup": 16, "sourc": [2, 7, 15, 18, 22, 28, 32, 33, 35, 37, 43, 46, 52, 53, 54, 55, 57, 58, 59, 60, 61, 63, 67, 74], "source_format": 58, "space": 45, "span": 38, "spars": 7, "spatula": 16, "speak": [52, 56], "spec": 63, "speci": 73, "special": [11, 15, 16, 27, 59, 67, 68], "specif": [2, 5, 7, 8, 10, 15, 16, 18, 24, 27, 31, 32, 36, 37, 38, 41, 45, 46, 49, 50, 57, 63, 66, 67, 68, 70, 72, 73, 74], "specifi": [2, 15, 27, 30, 31, 32, 38, 50, 58, 63, 65, 66, 67, 68], "spend": [44, 65], "split": [24, 29, 40, 49], "split_act": 68, "split_int": 60, "split_siz": 68, "spoon": 16, "spork": 16, "sqlite": 63, "squar": 15, "src": 61, "stabl": 72, "stackoverflow": 45, "stage": [27, 46, 66, 67, 68], "stai": 31, "standalon": 45, "standard": [9, 10, 27, 67], "start": [8, 15, 16, 27, 29, 31, 35, 36, 38, 42, 44, 45, 46, 59, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74], "stat": 65, "state": [7, 8, 10, 12, 69], "statement": [27, 49, 66, 67], "static": [9, 12], "statist": [35, 45], "stderr": [61, 67, 72], "stdin": 16, "stdio": 61, "stdout": [61, 67, 72], "steak": 16, "stem": 67, "step": [7, 8, 10, 15, 24, 27, 36, 37, 38, 40, 41, 45, 51, 58, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73], "still": [2, 5, 10, 16, 19, 24, 29, 30, 37, 38, 47, 64, 65, 67, 68, 71, 72], "stitch": 33, "storag": [8, 66], "store": [9, 11, 13, 17, 18, 19, 27, 29, 31, 57, 58, 59, 60, 63, 65, 66, 67, 68, 69], "stori": 16, "str": [16, 22, 28, 33, 34, 35, 50, 52, 53, 57, 58, 59, 60, 63, 64, 65, 66, 69, 70, 73], "straight": [16, 36, 67, 69, 70], "straightforward": [38, 45], "strategi": [43, 68], "strict": [16, 59], "strictli": [8, 59], "strike": 19, "string": [9, 10, 16, 18, 22, 32, 45, 50, 52, 53, 57, 58, 59, 60, 63, 65, 66, 67, 70], "strip": 30, "structur": [2, 9, 10, 12, 15, 16, 17, 18, 20, 26, 29, 31, 32, 38, 51, 59, 70, 72], "struggl": 66, "stuck": [65, 66, 69], "studi": [11, 15, 50, 63], "stuff": [15, 27], "style": 65, "sub": [2, 8, 33, 47, 66], "subclass": [2, 18, 49, 53, 57, 58, 63, 66, 70], "subcommand": 43, "subdir": 46, "subdirectori": [9, 10, 15, 66], "subject": 50, "submiss": 19, "submit": [7, 19, 27, 37, 44, 59], "submodul": [22, 27, 67], "suboptim": 66, "subsequ": [0, 15, 25, 32, 50, 59, 67, 68, 69], "subset": [11, 59, 68], "substanti": 74, "substitut": 16, "substr": 65, "subsystem": 46, "subtyp": [2, 59], "succeed": 66, "success": [8, 31, 36, 66, 67, 72], "successfulli": [29, 49, 70, 72], "suffer": 32, "suffic": [16, 65], "suffici": [59, 74], "suggest": [5, 16, 31, 38, 44, 57, 68, 72], "suit": [16, 48, 68, 70], "suitabl": 46, "sum": [49, 66], "summar": [65, 69, 70], "summari": [2, 35, 65, 66, 68, 69], "summarize_align": [65, 69], "summarize_alignment_act": 69, "summarizealignmenttest": 65, "sun": 31, "sup": 2, "super": [57, 68], "supersed": 18, "supertyp": 16, "suppli": [57, 63], "support": [2, 4, 7, 9, 10, 11, 15, 18, 19, 24, 31, 36, 37, 40, 41, 42, 44, 45, 46, 49, 50, 51, 52, 57, 59, 61, 63, 66, 67, 69, 70, 74], "suppos": [16, 65, 67], "sure": [29, 31, 36, 42, 46, 49, 64, 66, 72], "surround": 8, "sw": 67, "swap": [14, 16], "sweet": 65, "switch": 7, "sy": [12, 15, 61], "symbol": [31, 38], "symmetr": 66, "sync": [31, 73], "synchron": 12, "synonym": [10, 16, 29], "syntax": [16, 22, 30, 32, 59, 67], "system": [2, 10, 15, 16, 18, 27, 29, 30, 32, 37, 45, 46, 52, 59, 69], "t": [0, 2, 4, 7, 9, 10, 11, 15, 16, 18, 19, 27, 29, 31, 32, 34, 36, 37, 38, 40, 42, 44, 46, 47, 48, 49, 52, 58, 59, 60, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73], "t_in": 59, "t_out": 59, "t_parama": 59, "t_paramb": 59, "taacacccac": [65, 67], "tab": [15, 31, 65, 72, 73], "tabl": [15, 25, 27, 28, 29, 32, 33, 35, 38, 49, 50, 52, 58, 59, 61, 63, 66, 67, 68, 72, 73], "tabul": [50, 68, 73], "tabular": [59, 63, 68], "tabularmsa": [65, 66, 67, 69], "tabulate_las_result": 68, "tabulate_las_results_act": 73, "tag": [15, 18, 45], "take": [18, 28, 29, 31, 32, 33, 35, 42, 43, 44, 47, 57, 60, 63, 64, 65, 66, 67, 69, 70, 73], "taken": 60, "talk": [16, 27], "tar": 9, "target": [24, 31, 36, 37, 38, 41, 42, 44, 58, 70, 72, 74], "task": [8, 16, 19, 41, 65, 74], "taxa": 43, "taxonom": [68, 73], "taxonomi": [52, 67, 73], "team": [15, 19, 24, 46], "tear": 16, "teardown": 58, "tech": 47, "technic": [4, 15, 41, 44, 45, 51, 65, 67, 69], "technologi": 24, "tediou": 66, "tell": [15, 44, 45, 66, 67], "temp_dir": [11, 65], "tempfil": 70, "templat": [7, 24, 27, 42, 51, 60, 65, 71, 74], "temporari": [27, 58, 67], "temptat": 74, "ten": [15, 19], "tend": [44, 57, 64, 68, 70], "term": [2, 10, 15, 19, 25, 29, 31, 38, 63, 66, 67, 70], "termin": [15, 25, 35, 46, 59, 73], "test": [16, 19, 24, 36, 41, 44, 45, 46, 47, 51, 52, 56, 59, 60, 62, 71, 74], "test_alt_gap_extend_penalti": 67, "test_alt_gap_open_penalti": 67, "test_alt_match_scor": 67, "test_alt_mismatch_scor": 67, "test_dir_prefix": 58, "test_dna_to_single_record_fasta_simple1": 64, "test_dna_to_single_record_fasta_simple2": 64, "test_exampl": 70, "test_invalid_default_valid": 66, "test_invalid_max_valid": 66, "test_invalid_min_valid": 66, "test_method": [66, 67, 68], "test_pipelin": 68, "test_semantic_type_registr": 66, "test_simple1": [65, 66, 67, 68], "test_simple1_parallel": 68, "test_simple1_seri": 68, "test_simple2": [66, 67], "test_single_record_fasta_to_dna_simple1": 66, "test_single_record_fasta_to_dna_simple2": 66, "test_transform": [64, 66], "test_types_and_format": 66, "test_visu": 65, "testcas": 58, "testpluginbas": [48, 49, 58, 65, 66, 67, 68, 70], "text": [8, 9, 10, 15, 27, 31, 33, 35, 45, 52, 59, 60, 63, 64, 65, 67, 69, 70, 72, 73], "textfileformat": [2, 11, 52, 55, 57, 66], "textual": 35, "than": [7, 8, 11, 15, 16, 29, 30, 31, 46, 49, 50, 52, 59, 61, 63, 64, 65, 66, 67, 68, 69, 70, 72], "thank": [24, 71], "thei": [2, 8, 10, 11, 15, 16, 18, 19, 27, 28, 29, 30, 34, 36, 37, 38, 42, 44, 47, 50, 52, 57, 59, 60, 61, 64, 65, 66, 67, 68, 69, 70], "them": [7, 8, 10, 12, 15, 16, 18, 19, 24, 27, 30, 31, 32, 36, 38, 40, 42, 49, 52, 53, 64, 65, 66, 67, 68, 69, 70, 73, 74], "theme": 2, "themselv": [8, 15, 49, 67, 68], "theoret": 15, "theori": 68, "therefor": [2, 9, 15, 27, 38, 63, 66, 67, 68, 70], "therein": 31, "thereof": 60, "thermophili": 66, "thi": [2, 4, 5, 7, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19, 22, 25, 27, 28, 29, 30, 31, 32, 33, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 52, 53, 54, 56, 57, 58, 59, 60, 61, 63, 64, 65, 66, 68, 69, 70, 71, 72, 73, 74], "thing": [7, 11, 15, 16, 19, 27, 29, 31, 37, 44, 49, 52, 57, 60, 65, 66, 67, 68, 69, 70, 73], "think": [12, 16, 19, 29, 50, 64, 66, 67], "third": [29, 68], "thoma": [0, 2], "thorough": 24, "those": [11, 15, 24, 28, 35, 36, 38, 41, 42, 49, 50, 52, 59, 63, 64, 66, 67, 68, 69, 70, 72, 73], "though": [8, 10, 16, 18, 24, 29, 32, 40, 44, 46, 65, 66, 70, 72], "thought": 59, "thread": [40, 59, 69], "three": [8, 11, 15, 19, 25, 29, 49, 60, 66, 67], "three_tabl": 49, "through": [2, 11, 15, 19, 24, 27, 29, 30, 31, 35, 36, 38, 42, 45, 46, 47, 49, 52, 65, 66, 67, 68, 69, 70, 72, 73, 74], "throughout": [24, 67], "throw": 73, "thu": [25, 35, 63], "ti": 47, "tie": 12, "time": [7, 8, 9, 10, 15, 18, 19, 27, 28, 29, 30, 31, 38, 42, 43, 44, 46, 50, 52, 57, 60, 64, 65, 66, 67, 69, 70, 74], "timelin": 19, "timepoint": 19, "timestamp": 15, "tini": [42, 68], "tip": [36, 68], "titl": [15, 57, 65, 67, 73], "tl": 2, "to_ast": [16, 22], "to_datafram": [50, 63, 73], "to_html": 73, "to_import": 60, "to_list": 73, "to_seri": 63, "to_typ": [58, 60, 61, 67], "togeth": [2, 9, 11, 16, 18, 31, 33, 66, 68, 69], "toggl": 69, "toi": [31, 68], "told": 29, "toler": 43, "too": [2, 11, 15, 50, 52, 66], "tool": [0, 2, 4, 10, 15, 18, 27, 29, 41, 42, 43, 47, 51, 66, 67, 68, 69, 70], "top": [8, 15, 27, 31, 36, 37, 65, 66, 67, 68, 69, 70, 72], "topic": [7, 24, 39, 44, 67], "total": [33, 42, 61], "touch": [15, 67], "toward": [66, 70], "traceback": 16, "track": [9, 10, 13, 17, 18, 19, 52, 53, 54, 63], "tracker": [45, 47, 71], "trade": 66, "train": 31, "trait": 18, "tranch": 74, "tranform": 58, "transfer": 16, "transform": [2, 15, 18, 26, 41, 43, 48, 50, 51, 57, 58, 60, 61, 67, 68, 69, 74], "transform_format": [58, 66], "transit": [7, 29, 66], "translat": [8, 70], "transpar": 15, "travers": 15, "treat": [27, 29, 59, 63], "treatment": [63, 67], "tree": [9, 22, 27, 29, 66], "treenod": 28, "tri": [40, 52, 66], "triag": 19, "trick": 16, "tricker": 65, "trigger": 31, "trip": 64, "trivial": [59, 64], "troubleshoot": [31, 38, 42], "true": [16, 22, 58, 59, 60, 63, 67, 68, 73], "truli": 44, "trust": [10, 66, 67], "try": [11, 16, 40, 44, 47, 59, 60, 64, 65, 66, 68, 69, 70, 72, 73], "tsv": [11, 15, 35, 49, 60, 63, 73], "tt": 67, "ttt": 67, "tupl": [22, 32, 33, 57, 59, 63, 69], "ture": 16, "turn": [8, 30, 67, 70], "tutori": [7, 24, 27, 36, 40, 41, 44, 46, 50, 51, 63, 66, 69, 71, 72], "twice": 9, "two": [0, 8, 11, 15, 16, 29, 31, 34, 35, 38, 43, 49, 50, 52, 59, 60, 64, 66, 67, 68, 69, 70, 72, 73], "tx": 64, "txt": [7, 52, 60], "type": [2, 5, 8, 9, 13, 15, 17, 18, 19, 22, 26, 28, 30, 32, 33, 34, 35, 42, 43, 46, 48, 49, 50, 51, 52, 53, 54, 56, 57, 58, 60, 61, 62, 63, 64, 65, 67, 68, 69, 70, 73, 74], "type_frag": 57, "type_from_ast": 22, "typeerror": [11, 16, 22, 60], "typeexpress": 22, "typemap": 59, "typematch": 59, "typevarexp": 59, "typic": [2, 11, 19, 27, 28, 29, 31, 36, 43, 50, 59, 60, 66, 67, 68, 69], "u": [15, 16, 19, 24, 27, 30, 37, 38, 42, 44, 49, 52, 64, 65, 66, 67, 68, 69, 70], "ubiquit": [9, 68], "ubuntu": 46, "ui": [8, 16], "ultim": [16, 27, 42, 44, 47, 70, 72, 74], "ultipl": 67, "uml": 8, "unabl": [5, 16], "unadorn": 16, "unambigu": [52, 66, 69], "unbound": 59, "uncommon": [15, 52], "under": [18, 19, 24, 27, 31, 38, 44, 46, 47, 52, 60, 64, 67, 68, 70], "underli": [11, 16, 33, 34, 49, 61, 65, 67, 68, 69], "underscor": [27, 45, 49], "understand": [8, 10, 12, 15, 16, 19, 24, 29, 31, 64, 67], "understood": 9, "unexpect": 69, "unfamilar": 16, "unfortun": [31, 44], "unicod": [16, 59], "unifi": 50, "unimport": 57, "uninitializedpluginmanagererror": [22, 60], "uninterest": 16, "union": [57, 59], "uniqu": [2, 9, 33, 43, 44, 49, 50, 59, 63, 66], "unit": [2, 27, 31, 44, 45, 49, 68, 69, 70, 71, 72], "unitl": 39, "unittest": [49, 58], "univers": [2, 29, 64], "unix": 2, "unkown": 12, "unless": [16, 18, 33, 45, 46, 59, 72], "unlik": [11, 15, 16, 24, 45, 57, 61, 66, 69, 73], "unnecessari": [66, 68, 73], "unnecessarili": 49, "unpack": [49, 59, 60], "unrecognizedformaterror": 66, "unrel": 16, "unreli": 52, "unroot": [29, 66], "unschedul": 19, "unshred": 16, "unspecifi": [67, 72], "until": [7, 16, 19, 29, 65, 67, 68, 69, 70], "unus": 67, "unusu": 67, "unweighted_unifrac_emperor": 15, "unzip": [10, 15], "up": [9, 12, 16, 18, 19, 27, 30, 31, 37, 41, 47, 49, 50, 51, 58, 64, 65, 66, 68, 69, 73], "upcom": [19, 31], "upda": 49, "updat": [9, 10, 15, 16, 19, 24, 31, 36, 44, 46, 70], "upfront": 52, "upkeep": 19, "upload": 52, "upon": [8, 36], "uppercas": 45, "upstream": [31, 68, 73], "urgent": 19, "url": [0, 24, 37, 38, 45, 57, 60], "us": [2, 4, 7, 8, 9, 10, 11, 12, 14, 15, 16, 18, 19, 22, 24, 25, 27, 29, 32, 33, 34, 35, 36, 37, 41, 42, 43, 44, 45, 46, 48, 49, 51, 52, 54, 56, 57, 58, 59, 60, 61, 63, 64, 65, 67, 69, 70, 72, 73, 74], "usabl": 31, "usag": [2, 7, 29, 41, 51, 56, 57, 58, 62, 64, 67, 68, 69, 71, 72, 74], "usage_vari": 60, "usageact": [49, 60, 70], "usagedriv": 70, "usageexampletest": 70, "usageinput": [49, 60, 70], "usageoutput": [49, 60], "usageoutputnam": [49, 60, 70], "usagevari": [49, 60], "user": [2, 4, 6, 8, 10, 12, 15, 16, 18, 19, 22, 24, 27, 29, 31, 32, 34, 35, 36, 37, 41, 42, 43, 44, 45, 46, 49, 50, 51, 52, 53, 56, 57, 59, 62, 64, 65, 66, 67, 68, 69, 70, 72, 73, 74], "user_support_text": [45, 57], "usual": [7, 8, 16, 31, 38, 45, 52, 57, 59, 60], "utensil": 16, "utf": 65, "util": [10, 14, 15, 19, 31, 38, 50, 51, 56, 58, 60, 62, 66, 67, 68], "utlit": 50, "uuid": [2, 9, 15, 18, 52, 72], "v": [0, 31, 57, 63], "v0": 18, "v1": [11, 18], "v2": 18, "v4": [15, 18], "v5": 18, "val": [11, 49], "valid": [2, 8, 15, 16, 30, 41, 50, 51, 57, 58, 59, 60, 63, 66, 67, 70], "validate_someth": 57, "validation_level_to_n_char": 66, "validation_seq": 66, "validation_seq_len": 66, "validationerror": [11, 22, 55, 57, 66], "vallei": 24, "valu": [2, 11, 15, 16, 22, 30, 31, 32, 33, 35, 37, 38, 40, 45, 46, 49, 50, 52, 53, 59, 60, 63, 65, 67, 68, 69, 70, 72], "valuabl": 15, "valueerror": [11, 58, 63, 66], "vaniti": 60, "var": 46, "var_typ": 60, "varfield": 16, "vari": [32, 45, 52, 66], "variabl": [16, 18, 22, 27, 57, 59, 60, 65, 67, 68, 69, 70], "variad": 18, "variadic_input_simpl": 49, "varianc": 63, "variant": [16, 29, 57, 59], "variant1": 57, "variant2": 57, "variant_of": [16, 59], "variantfield": 59, "variat": 67, "varieti": 9, "variou": [15, 16, 17, 24, 63], "varriabl": 67, "vastli": 7, "ve": [16, 19, 31, 32, 36, 41, 44, 49, 66, 67, 68, 69, 72, 73], "vector": [33, 35, 49], "verb": [2, 43], "verbos": [67, 72], "veri": [8, 9, 11, 16, 24, 29, 30, 31, 32, 33, 35, 44, 45, 57, 65, 66, 67, 68, 69, 70], "verif": 50, "verifi": [34, 65], "version": [2, 7, 8, 9, 10, 15, 17, 19, 20, 31, 38, 44, 45, 49, 52, 57, 66, 67, 72, 73], "versu": 69, "vertic": 8, "via": [2, 5, 8, 32, 36, 37, 45, 49, 50, 53, 57, 58, 64, 68], "video": 29, "view": [2, 7, 10, 12, 15, 19, 27, 29, 30, 33, 50, 52, 54, 57, 58, 59, 60, 64, 65, 66, 67, 68, 70, 72], "view_as_metadata": 60, "view_typ": [33, 54, 60, 64, 68], "viewer": [15, 65, 73], "viewport": 65, "violat": 69, "virtu": 16, "virtual": 15, "visibl": [15, 44], "visit": [46, 57], "visual": [2, 9, 10, 13, 15, 17, 18, 22, 25, 32, 33, 41, 45, 51, 57, 66, 67, 68, 69, 70, 71, 73, 74], "viusal": 65, "vizual": 65, "vm": 15, "vocabulari": [16, 63], "volatil": 50, "volum": 67, "w": [0, 24, 52, 55, 65, 73], "wa": [2, 9, 10, 11, 15, 16, 18, 24, 27, 29, 31, 32, 35, 36, 46, 49, 52, 57, 63, 64, 66, 67, 68, 69, 73], "wai": [4, 7, 10, 11, 12, 15, 16, 22, 27, 29, 30, 31, 36, 37, 38, 42, 44, 46, 49, 52, 59, 60, 63, 65, 66, 67, 68, 69, 70, 71, 72], "wait": [8, 40, 68], "walk": [36, 52, 60, 74], "want": [15, 16, 19, 24, 27, 29, 30, 35, 36, 38, 40, 42, 43, 44, 46, 49, 50, 65, 66, 67, 68, 69, 70, 72, 73, 74], "warn": [12, 30, 66, 67, 69, 70], "warrant": 19, "wast": 29, "watch": 11, "waterman": [0, 67, 68, 69], "we": [4, 5, 7, 8, 9, 10, 11, 12, 15, 16, 18, 19, 24, 27, 28, 29, 30, 31, 32, 33, 36, 37, 38, 40, 42, 43, 44, 46, 47, 49, 50, 52, 57, 64, 65, 66, 67, 68, 69, 70, 72, 73], "web": [2, 7, 15, 36, 52], "websit": [9, 15, 18, 44, 45, 57, 67], "wednesdai": [19, 31], "week": 19, "weekend": 29, "weekli": 19, "weird": 52, "welcom": 5, "well": [2, 7, 9, 10, 11, 15, 16, 19, 29, 31, 42, 43, 44, 50, 63, 64, 65, 66, 67, 74], "went": [29, 65], "were": [2, 9, 15, 16, 18, 40, 52, 57, 59, 65, 66, 68, 70, 72, 73], "weren": 66, "weslei": 0, "what": [2, 8, 9, 10, 16, 19, 27, 29, 31, 32, 34, 36, 37, 38, 44, 49, 52, 57, 59, 60, 64, 65, 66, 68, 69, 70, 72, 73], "whatev": [8, 15, 27, 30, 35, 65, 66, 72], "whatsoev": 66, "when": [2, 7, 8, 9, 10, 11, 12, 15, 16, 18, 22, 27, 28, 29, 30, 31, 35, 37, 40, 42, 43, 44, 45, 49, 50, 52, 57, 58, 59, 61, 63, 64, 65, 66, 67, 68, 69, 70, 72, 73, 74], "whenev": [15, 18, 42, 57, 59], "where": [2, 7, 8, 9, 10, 15, 16, 19, 24, 27, 30, 31, 32, 36, 44, 45, 47, 48, 52, 57, 59, 63, 64, 65, 66, 67, 68, 69, 70, 73], "where_values_miss": 63, "wherev": [5, 16], "whether": [16, 29, 57, 59, 63, 66, 67, 69, 72], "which": [2, 7, 8, 9, 10, 11, 12, 14, 15, 16, 18, 19, 24, 27, 28, 29, 30, 32, 33, 36, 38, 44, 45, 46, 49, 50, 52, 57, 59, 60, 63, 65, 66, 67, 68, 69, 70, 72, 73, 74], "whichev": 42, "while": [2, 5, 9, 10, 11, 15, 16, 29, 31, 38, 42, 44, 45, 58, 65, 67, 69, 70, 74], "who": [15, 24, 42, 46, 52, 66, 70, 74], "whole": [18, 42, 52, 67, 68], "whose": [8, 15, 18, 27, 49], "why": [7, 10, 16, 52, 69, 70], "wide": [10, 45], "widespread": 2, "width": 65, "wikipedia": [2, 52], "wild": 18, "window": 46, "winzip": 10, "wise": 59, "wish": [38, 49, 66], "witcombe2006sword": 57, "within": [2, 7, 8, 9, 11, 15, 16, 18, 19, 22, 28, 30, 31, 38, 43, 45, 47, 49, 50, 59, 60, 63, 69], "without": [2, 9, 10, 15, 16, 27, 29, 30, 57, 59, 65, 66, 67, 68, 74], "won": [15, 19, 37, 47, 52, 65, 66, 67, 68, 72], "wonder": 49, "wood": 0, "word": [2, 10, 15, 16, 27, 44, 67], "work": [2, 3, 4, 7, 8, 10, 11, 15, 16, 19, 24, 28, 29, 30, 31, 36, 37, 38, 42, 43, 44, 45, 46, 49, 50, 52, 58, 59, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74], "workaround": 67, "workflow": [27, 31, 52, 68, 69, 73, 74], "workflow_dispatch": 31, "working_set": 15, "workload": 19, "workspac": 16, "world": [16, 59, 74], "worri": [10, 16, 49], "wors": 29, "worst": 68, "worth": [44, 52, 67, 74], "would": [2, 9, 10, 12, 15, 16, 19, 24, 29, 30, 31, 35, 36, 38, 41, 44, 45, 49, 52, 57, 59, 60, 63, 65, 67, 69, 70, 73], "wouldn": [16, 52, 67, 68], "wrap": [15, 32, 33, 43, 73], "wrapper": [30, 60], "write": [2, 4, 7, 8, 11, 16, 18, 24, 29, 34, 35, 36, 41, 45, 51, 64, 66, 68, 69, 71, 72, 73, 74], "write_csv": 57, "written": [18, 30, 35, 37, 43, 45, 52, 63, 65, 66, 70], "wrong": [15, 29, 65, 66, 73], "wrote": [49, 64, 65, 66, 68, 69, 73], "wsl": 46, "wunsch": [0, 67, 69], "x": 59, "x86_64": 15, "xopen": 15, "y": [52, 59, 69], "yaml": [10, 18, 27, 31, 36, 37, 46], "year": [10, 44, 67], "yet": [9, 10, 16, 19, 30, 31, 49, 57, 66, 67, 68], "yield": 68, "yml": [27, 31, 37, 38, 46], "you": [4, 5, 7, 9, 10, 12, 15, 16, 19, 22, 24, 27, 28, 29, 30, 31, 32, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 52, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74], "your": [0, 4, 7, 16, 27, 29, 30, 32, 35, 40, 41, 43, 49, 50, 51, 52, 57, 59, 64, 66, 67, 68, 69, 71, 73], "yourself": [2, 24, 30, 45, 50, 52, 68, 73], "zero": [2, 16, 59, 63, 67], "zip": [10, 15, 16, 49], "zipfil": 9, "zipp": 15, "zuckerberg": 24}, "titles": ["List of works cited", "Index", "Glossary", "Back matter", "Distribution Development", "Developer documentation", "Docs Development", "User documentation", "QIIME 2 architecture overview", "Anatomy of an Archive", "How Data is Stored", "File Formats and Directory Formats", "Garbage Collection", "Explanations", "Metaprogramming", "Decentralized retrospective provenance tracking", "Semantic Types, Primitives, and Visualizations", "Framework Development", "Archive versions", "QIIME 2 Development and Release Cycle Structure", "References", "Interface Development", "Interface developer API reference", "References", "<em>Developing with QIIME 2</em>", "Types of QIIME 2 Actions", "Explanations", "The structure of QIIME 2 plugin packages", "Transformers", "Semantic types, data types, file formats, and artifact classes", "Use Artifact Collections as Action inputs or outputs", "Automate testing of your plugin", "Create and register a Method", "Create and register a pipeline", "Creating and registering a Transformer", "Create and register a visualizer", "Distribute plugins on GitHub", "Distribute plugins on QIIME 2 Library", "Facilitating installation of your plugin for users", "Defining different Format validation levels", "Handling exceptions in parallel Pipelines", "How-To Guides", "Maximize compatibility between your plugin(s) and existing QIIME 2 distribution(s)", "How to play nicely with other plugins", "Publicize your QIIME 2 plugins (or other QIIME 2-based tools)", "Register a QIIME 2 plugin", "Set up your development environment", "Provide technical support for your users", "How to test QIIME 2 plugins", "Writing Usage Examples", "How to use Metadata", "Plugin Development", "Plugin development anti-patterns", "Citations", "Pipeline Context Object", "Formats", "Plugin Development API", "Plugin &amp; Registration", "Testing", "Types", "Usage Examples", "Utilities", "References", "User Metadata API", "Add a second transformer", "Add a first Visualizer", "Add a new Artifact Class", "Add a first (real) Method", "Add a Pipeline with parallel computing support", "Add a first Pipeline", "Add a Usage Example", "Conclusion", "Create your plugin from a template", "Integrate metadata in Actions", "Tutorial: A step-by-step guide to building your first QIIME 2 plugin"], "titleterms": {"": 42, "0": 18, "1": 18, "2": [8, 10, 18, 19, 24, 25, 27, 37, 38, 42, 44, 45, 46, 48, 74], "3": [18, 67, 70], "4": 18, "5": 18, "6": 18, "7": 18, "A": [8, 50, 67, 74], "In": 9, "The": [9, 15, 22, 27, 30, 63, 73], "To": 41, "__init__": 27, "_method": 27, "_pipelin": 69, "_version": 27, "access": 10, "acknowledg": 24, "action": [15, 22, 25, 30, 31, 57, 60, 65, 67, 69, 73], "activ": 46, "add": [64, 65, 66, 67, 68, 69, 70, 73], "addit": [37, 56, 67], "advanc": 50, "agnost": 18, "align": [66, 67, 68, 70], "amplicon": 46, "an": [9, 16, 30, 38, 45, 65, 66, 67, 69, 73], "analogi": 16, "anatomi": 9, "ani": 38, "annot": 60, "anti": 52, "api": [22, 30, 50, 56, 63, 67, 70], "appli": 68, "ar": 28, "architectur": 8, "archiv": [9, 18], "artifact": [29, 30, 50, 66], "assert": 60, "associ": 11, "autom": [31, 70], "avoid": 69, "awai": 15, "back": 3, "base": 44, "basic": 59, "befor": 37, "best": 19, "between": 42, "bib": 27, "binari": 11, "block": 15, "build": [46, 74], "call": 67, "can": [49, 50], "captur": 15, "categor": 50, "cfg": 27, "check": 10, "choic": 16, "ci": [27, 31], "citat": [27, 53, 67], "cite": 0, "class": [29, 63, 66], "cli": 30, "collect": [12, 30, 59, 60], "column": [50, 63], "combin": 68, "command": [8, 30, 70], "comment": 49, "commun": 44, "compar": 68, "compat": 42, "compon": 8, "comput": 68, "conclus": 71, "conda": 46, "configur": 31, "content": [24, 74], "context": [49, 54], "continu": 31, "contribut": [7, 24, 44, 46], "cookiecutt": 72, "creat": [32, 33, 34, 35, 68, 69, 72], "current": 7, "custom": 38, "cycl": 19, "data": [9, 10, 15, 27, 29, 49, 70], "decentr": 15, "defin": [16, 39, 45, 49, 64, 66, 67, 68, 70], "depend": 59, "detail": 8, "develop": [4, 5, 6, 16, 17, 19, 21, 22, 24, 46, 51, 52, 56, 66], "development": 19, "diagram": 8, "differ": 39, "directori": [11, 66], "discov": 66, "displai": 70, "distribut": [4, 36, 37, 38, 42, 46], "dna": 64, "doc": 6, "docstr": 5, "document": [5, 7, 69], "dr": [64, 65, 66, 67, 68, 69, 70, 73], "drop": 50, "duplic": 69, "dure": 72, "dwq2": 27, "each": 68, "empti": 50, "entri": 45, "environ": [15, 24, 46], "exampl": [15, 48, 49, 60, 70, 73], "except": [22, 40, 63], "execut": 15, "exercis": [65, 66, 67, 69, 70], "exist": [38, 42, 46], "expand": 36, "explan": [13, 26], "extend": 16, "extens": 10, "facilit": 38, "factori": 49, "feedback": 42, "few": 67, "file": [9, 11, 15, 29, 50, 66], "filepath": 52, "filter": 50, "find": 5, "first": [46, 65, 67, 69, 74], "fix": 11, "flowchart": 68, "follow": 8, "format": [11, 18, 29, 39, 52, 55, 66], "forum": 44, "framework": 17, "free": 50, "from": [50, 64, 72], "function": [22, 32, 33, 35, 65, 67], "fund": 24, "garbag": 12, "gener": [50, 61], "get": [24, 42], "gha": 31, "git": [27, 72], "github": [27, 31, 36], "gitignor": 27, "glossari": 2, "goal": 10, "goe": 9, "guarante": 18, "guid": [41, 74], "handl": 40, "help": [24, 44, 50], "hint": 69, "how": [10, 28, 41, 43, 44, 48, 50], "i": [10, 15], "id": 15, "identifi": 9, "import": [9, 60, 66], "index": 1, "individu": 56, "inform": 69, "init": 30, "initi": [60, 72], "input": [10, 22, 30, 52, 68, 70, 73], "instal": [36, 38, 46, 72], "instanti": 45, "instruct": 36, "integr": [31, 73], "interfac": [16, 21, 22, 30, 70], "interoper": 10, "intersect": 16, "issu": 19, "latest": 46, "layout": 11, "level": 39, "librari": [37, 44], "licens": [24, 27], "line": [30, 70], "list": [0, 56], "load": 30, "local": 68, "make": [50, 66], "makefil": 27, "manifest": 27, "matter": 3, "maxim": 42, "md": 27, "me": 50, "merg": 50, "metadata": [9, 10, 50, 59, 60, 63, 73], "metagenom": 46, "metaprogram": 14, "method": [32, 67, 68], "misc": 19, "most": 9, "need": 72, "new": [64, 66, 67, 72], "next": 46, "nice": 43, "non": 19, "normal": 50, "note": 16, "number": 68, "numer": 50, "nw": [66, 70], "nw_align": 69, "object": [22, 29, 30, 45, 54, 56, 60], "option": [65, 66, 67, 69, 70, 72, 73], "other": [43, 44, 46], "our": [67, 68], "out": 49, "output": [22, 30, 50, 52], "overview": [8, 45], "packag": 27, "pairwis": 67, "parallel": [40, 68], "paramet": [52, 60], "pattern": 52, "pipelin": [15, 33, 40, 54, 68, 69], "plai": 43, "plan": 7, "plugin": [19, 27, 28, 31, 36, 37, 38, 42, 43, 44, 45, 46, 48, 51, 52, 56, 57, 61, 65, 67, 72, 74], "plugin_setup": [27, 67, 73], "pluginmanag": 22, "point": 45, "post": 44, "practic": 19, "pre": 44, "predic": 59, "prefix": 19, "prerequisit": 46, "primit": [16, 59], "print": 44, "properti": 16, "proven": [9, 10, 15], "provid": [47, 49, 52], "public": 44, "publicli": 66, "pull": 19, "put": 29, "py": [27, 67, 69, 73], "python": [30, 65, 67, 70], "q2": 27, "q2_dwq2": [27, 64], "q2cli": 67, "qiim": [8, 10, 19, 24, 25, 27, 37, 38, 42, 44, 45, 46, 48, 63, 74], "rang": 16, "readm": 27, "real": 67, "recommend": 38, "refactor": 7, "refer": [20, 22, 23, 62], "refin": 16, "regist": [30, 32, 33, 34, 35, 45, 49, 65, 66, 67, 68, 69, 70], "registr": 57, "releas": 19, "repositori": 72, "request": [19, 37], "requir": [37, 38], "result": 60, "resultcollect": 30, "resumpt": 68, "retrospect": 15, "return": 30, "rule": 9, "run": [68, 72], "save": 30, "search": [68, 73], "search_and_summar": 68, "second": [64, 67], "semant": [16, 29, 59, 66], "sequenc": [67, 68], "serial": 68, "set": [24, 46], "setup": 27, "share": 36, "should": 68, "singl": 11, "singlerecorddnafastaformat": 64, "size": 68, "skbio": 64, "skip": 52, "sourc": 5, "specif": 19, "split": 68, "split_sequ": 68, "splitter": 68, "sql": 50, "standard": 19, "statu": 24, "step": [46, 74], "storag": 10, "store": 10, "structur": [19, 27], "subtyp": 16, "summar": [68, 73], "summari": 8, "support": [47, 68], "tabl": 74, "tabulate_las_result": 73, "take": [15, 30, 68], "technic": 47, "templat": [36, 72], "test": [27, 31, 48, 49, 58, 64, 65, 66, 67, 68, 69, 70, 72, 73], "test_method": 27, "text": 11, "them": 44, "thi": [24, 67], "through": 8, "time": 68, "tini": [38, 46], "tl": [64, 65, 66, 67, 68, 69, 70, 73], "togeth": 29, "tool": [44, 72], "top": 38, "topic": 56, "track": 15, "transfer": 10, "transfom": 64, "transform": [28, 34, 64, 66], "try": [49, 67], "tsv": 50, "tutori": [70, 74], "type": [10, 11, 16, 25, 29, 59, 66], "understand": 44, "union": 16, "uniqu": 15, "unit": [64, 65, 66, 67, 73], "up": [24, 46, 67], "updat": [66, 68, 69, 73], "us": [28, 30, 31, 38, 50, 66, 68], "usag": [49, 60, 70, 73], "user": [7, 38, 47, 63], "util": [22, 61], "valid": [10, 11, 39, 52], "variabl": 11, "version": [18, 27, 46], "versu": 68, "viewabl": 50, "visual": [16, 35, 50, 59, 65], "weekli": 31, "what": [15, 67], "why": [9, 15], "work": 0, "wrap": 67, "wrapper": 67, "write": [49, 65, 67, 70], "yaml": [9, 15], "your": [24, 31, 36, 37, 38, 42, 44, 45, 46, 47, 65, 70, 72, 74], "zip": 9}})
\ No newline at end of file
+Search.setIndex({"alltitles": {"": [[9, null], [10, null], [15, null], [27, null], [50, null], [67, null], [67, null], [67, null], [70, null]], "A few additional tests": [[67, "a-few-additional-tests"]], "A first test of our plugin action": [[67, "a-first-test-of-our-plugin-action"]], "A second test of our action": [[67, "a-second-test-of-our-action"]], "A visualizer for free!": [[50, "a-visualizer-for-free"]], "Accessibility and Transferability": [[10, "accessibility-and-transferability"]], "Acknowledgements": [[24, "acknowledgements"]], "Action registration": [[57, "action-registration"]], "Actions": [[22, "actions"], [60, "actions"]], "Activate the conda environment": [[46, "activate-the-conda-environment"]], "Add a Pipeline with parallel computing support": [[68, null]], "Add a Usage Example": [[70, null]], "Add a first (real) Method": [[67, null]], "Add a first Pipeline": [[69, null]], "Add a first Visualizer": [[65, null]], "Add a local alignment search Pipeline": [[68, "add-a-local-alignment-search-pipeline"]], "Add a new Artifact Class": [[66, null]], "Add a second transformer": [[64, null]], "Add an optional input to tabulate_las_results": [[73, "add-an-optional-input-to-tabulate-las-results"]], "Add parallel computing support to search_and_summarize": [[68, "add-parallel-computing-support-to-search-and-summarize"]], "Add tests and documentation": [[69, "add-tests-and-documentation"]], "Add unit tests and update the search-and-summarize usage example": [[73, "add-unit-tests-and-update-the-search-and-summarize-usage-example"]], "Add unit tests of the new transfomer": [[64, "add-unit-tests-of-the-new-transfomer"]], "Additional Objects": [[56, "additional-objects"]], "Advanced Filtering": [[50, "advanced-filtering"]], "Amplicon distribution": [[46, "amplicon-distribution"]], "An Analogy": [[16, "an-analogy"]], "An optional exercise": [[65, "an-optional-exercise"], [66, "an-optional-exercise"], [67, "an-optional-exercise"], [69, "an-optional-exercise"]], "Anatomy of an Archive": [[9, null]], "Annotations": [[60, "annotations"]], "Archive Version 0": [[18, "archive-version-0"]], "Archive Version 1": [[18, "archive-version-1"]], "Archive Version 2": [[18, "archive-version-2"]], "Archive Version 3": [[18, "archive-version-3"]], "Archive Version 4": [[18, "archive-version-4"]], "Archive Version 5": [[18, "archive-version-5"]], "Archive Version 6": [[18, "archive-version-6"]], "Archive Version 7": [[18, "archive-version-7"]], "Archive versions": [[18, null]], "Artifact classes": [[29, "artifact-classes"], [66, "artifact-classes"]], "Associating Formats with a Type": [[11, "associating-formats-with-a-type"]], "Automate testing of your plugin": [[31, null]], "Automated Testing using Continuous Integration (CI) and Github Actions (GHA)": [[31, "automated-testing-using-continuous-integration-ci-and-github-actions-gha"]], "Automated testing of usage examples": [[70, "automated-testing-of-usage-examples"]], "Back matter": [[3, null]], "Basic types": [[59, "basic-types"]], "Binary File Formats": [[11, "binary-file-formats"]], "Building your first plugin": [[46, "building-your-first-plugin"]], "Calling the action with q2cli and the Python 3 API": [[67, "calling-the-action-with-q2cli-and-the-python-3-api"]], "Categorical Metadata Columns": [[50, "categorical-metadata-columns"]], "Choices": [[16, "choices"]], "Citations": [[53, null]], "Collections": [[59, "collections"], [60, "collections"]], "Command line interface": [[70, "command-line-interface"]], "Comments can provide context": [[49, "comments-can-provide-context"]], "Community Contributions on the QIIME 2 Forum": [[44, "community-contributions-on-the-qiime-2-forum"]], "Compare the serial versus parallel run times of the search-and-summarize": [[68, "compare-the-serial-versus-parallel-run-times-of-the-search-and-summarize"]], "Conclusion": [[71, null]], "Configure Continuous Integration (CI) testing": [[31, "configure-continuous-integration-ci-testing"]], "Configure weekly automated testing": [[31, "configure-weekly-automated-testing"]], "Contributing": [[24, "contributing"]], "Contributing to existing plugins": [[46, "contributing-to-existing-plugins"]], "Contributing to the current user documentation": [[7, "contributing-to-the-current-user-documentation"]], "Create _pipelines.py and add a Pipeline": [[69, "create-pipelines-py-and-add-a-pipeline"]], "Create a function to register as a Method": [[32, "create-a-function-to-register-as-a-method"]], "Create a function to register as a Pipeline": [[33, "create-a-function-to-register-as-a-pipeline"]], "Create a function to register as a Visualizer": [[35, "create-a-function-to-register-as-a-visualizer"]], "Create and register a Method": [[32, null]], "Create and register a pipeline": [[33, null]], "Create and register a visualizer": [[35, null]], "Create your plugin from a template": [[72, null]], "Creating and registering a Transformer": [[34, null]], "Data Goes In /data/": [[9, "data-goes-in-data"]], "Data factories for usage examples": [[49, "data-factories-for-usage-examples"]], "Decentralized retrospective provenance tracking": [[15, null]], "Define a citation for this action": [[67, "define-a-citation-for-this-action"]], "Define a transformer from skbio.DNA to q2_dwq2.SingleRecordDNAFASTAFormat": [[64, "define-a-transformer-from-skbio-dna-to-q2-dwq2-singlerecorddnafastaformat"]], "Define input data for your usage example": [[70, "define-input-data-for-your-usage-example"]], "Defining a Type": [[16, "defining-a-type"]], "Defining a new directory format": [[66, "defining-a-new-directory-format"]], "Defining a new file format": [[66, "defining-a-new-file-format"]], "Defining a new semantic type": [[66, "defining-a-new-semantic-type"]], "Defining a split Method": [[68, "defining-a-split-method"]], "Defining a usage example for nw-align": [[70, "defining-a-usage-example-for-nw-align"]], "Defining and registering a combine method": [[68, "defining-and-registering-a-combine-method"]], "Defining and registering a transformer": [[66, "defining-and-registering-a-transformer"]], "Defining different Format validation levels": [[39, null]], "Defining the usage example": [[70, "defining-the-usage-example"]], "Defining usage examples": [[49, "defining-usage-examples"]], "Defining your plugin object as an entry point": [[45, "defining-your-plugin-object-as-an-entry-point"]], "Dependent Types": [[59, "dependent-types"]], "Detailed Component Diagram": [[8, "detailed-component-diagram"]], "Developer documentation": [[5, null]], "Developing a new artifact class": [[66, "developing-a-new-artifact-class"]], "Developing with QIIME 2": [[24, null]], "Development status of this content": [[24, null]], "Developmental Best Practices": [[19, "developmental-best-practices"]], "Directory Formats": [[11, "directory-formats"]], "Discovering artifact classes": [[66, "discovering-artifact-classes"]], "Displaying usage examples": [[70, "displaying-usage-examples"]], "Distribute plugins on GitHub": [[36, null]], "Distribute plugins on QIIME 2 Library": [[37, null]], "Distribution Development": [[4, null]], "Docs Development": [[6, null]], "Dropping Empty Columns": [[50, "dropping-empty-columns"]], "Examples": [[48, "examples"]], "Exceptions": [[22, "exceptions"], [63, "exceptions"]], "Expanding on the install instructions": [[36, "expanding-on-the-install-instructions"]], "Explanations": [[13, null], [26, null]], "Extending a Type": [[16, "extending-a-type"]], "Facilitating installation of your plugin for users": [[38, null]], "File Formats": [[11, "file-formats"]], "File Formats and Directory Formats": [[11, null]], "File types (or formats) and data types (or objects)": [[29, "file-types-or-formats-and-data-types-or-objects"]], "Finding docstring sources": [[5, "finding-docstring-sources"]], "Fixed Layouts": [[11, "fixed-layouts"]], "Following A Command Through QIIME 2": [[8, "following-a-command-through-qiime-2"]], "Formats": [[55, null]], "Framework Development": [[17, null]], "Funding": [[24, "funding"]], "Garbage Collection": [[12, null]], "General Utils": [[61, "general-utils"]], "Generating metadata as output from visualizations": [[50, "generating-metadata-as-output-from-visualizations"]], "Getting Feedback on your Plugin": [[42, "getting-feedback-on-your-plugin"]], "Getting Help": [[24, "getting-help"]], "Glossary": [[2, null]], "Goals for data storage in QIIME 2": [[10, "goals-for-data-storage-in-qiime-2"]], "Handling exceptions in parallel Pipelines": [[40, null]], "Help others understand how your tool will help them": [[44, "help-others-understand-how-your-tool-will-help-them"]], "Hint": [[69, null]], "How Data is Stored": [[10, null]], "How are transformers used by a plugin?": [[28, "how-are-transformers-used-by-a-plugin"]], "How can the Metadata API Help Me?": [[50, "how-can-the-metadata-api-help-me"]], "How to play nicely with other plugins": [[43, null]], "How to test QIIME 2 plugins": [[48, null]], "How to use Metadata": [[50, null]], "How-To Guides": [[41, null]], "Importing": [[60, "importing"]], "Index": [[1, null]], "Individual Topics": [[56, "individual-topics"]], "Initializers": [[60, "initializers"]], "Input Validation (Type Checking)": [[10, "input-validation-type-checking"]], "Inputs and outputs": [[22, "inputs-and-outputs"]], "Install Prerequisites": [[46, "install-prerequisites"]], "Install and test your new plugin": [[72, "install-and-test-your-new-plugin"]], "Install the latest development version of the QIIME 2 \u201cTiny Distribution\u201d": [[46, "install-the-latest-development-version-of-the-qiime-2-tiny-distribution"]], "Install the tools needed for templating your plugin": [[72, "install-the-tools-needed-for-templating-your-plugin"]], "Installing other QIIME 2 distributions": [[46, "installing-other-qiime-2-distributions"]], "Installing your plugin on top of an existing QIIME 2 Distribution (recommended)": [[38, "installing-your-plugin-on-top-of-an-existing-qiime-2-distribution-recommended"]], "Installing your plugin using the Tiny Distribution and any custom required plugins": [[38, "installing-your-plugin-using-the-tiny-distribution-and-any-custom-required-plugins"]], "Instantiating a plugin": [[45, "instantiating-a-plugin"]], "Integrate metadata in Actions": [[73, null]], "Interface Developer Note:": [[16, null]], "Interface Development": [[21, null]], "Interface developer API reference": [[22, null]], "Interface development API": [[22, "interface-development-api"]], "Interoperability and Extension": [[10, "interoperability-and-extension"]], "Intersections": [[16, "intersections"]], "Issue/Pull Request Prefixes": [[19, "issue-pull-request-prefixes"]], "License": [[24, "license"]], "List of works cited": [[0, null]], "Making Artifacts Viewable as Metadata": [[50, "making-artifacts-viewable-as-metadata"]], "Making the new type and formats publicly importable": [[66, "making-the-new-type-and-formats-publicly-importable"]], "Maximize compatibility between your plugin(s) and existing QIIME 2 distribution(s)": [[42, null]], "Merging Metadata": [[50, "merging-metadata"]], "Metadata": [[50, "metadata"], [59, "metadata"], [60, "metadata"]], "Metadata Columns": [[50, "metadata-columns"]], "Metadata columns": [[63, "metadata-columns"]], "Metagenome distribution": [[46, "metagenome-distribution"]], "Metaprogramming": [[14, null]], "Misc/non-standard development": [[19, "misc-non-standard-development"]], "Next steps": [[46, "next-steps"]], "Normalizing TSV Files": [[50, "normalizing-tsv-files"]], "Numeric Metadata Columns": [[50, "numeric-metadata-columns"]], "Optional exercise": [[70, "optional-exercise"]], "Optionally initialize a git repository during plugin templating": [[72, null]], "Overview": [[45, "overview"]], "Pairwise sequence alignment": [[67, "pairwise-sequence-alignment"]], "Parameter Objects for Usage.action": [[60, "parameter-objects-for"]], "Pipeline Context Object": [[54, null]], "Pipeline Provenance": [[15, "pipeline-provenance"]], "Pipeline provenance example": [[15, "pipeline-provenance-example"]], "Pipeline provenance take-aways": [[15, "pipeline-provenance-take-aways"]], "Pipeline resumption \u267b\ufe0f": [[68, null]], "Plans for refactoring of user documentation": [[7, "plans-for-refactoring-of-user-documentation"]], "Plugin & Registration": [[57, null]], "Plugin API List": [[56, "plugin-api-list"]], "Plugin Development": [[51, null]], "Plugin Development API": [[56, null]], "Plugin Utils": [[61, "plugin-utils"]], "Plugin development anti-patterns": [[52, null]], "Post a pre-print": [[44, "post-a-pre-print"]], "Predicates": [[59, "predicates"], [59, "id1"]], "Primitive Types": [[16, "primitive-types"]], "Primitive types": [[59, "primitive-types"]], "Properties": [[16, "properties"]], "Provenance Goes In /provenance/": [[9, "provenance-goes-in-provenance"]], "Provenance Metadata": [[10, "provenance-metadata"]], "Provide technical support for your users": [[47, null]], "Providing input or output filepaths as parameters": [[52, "providing-input-or-output-filepaths-as-parameters"]], "Publicize your QIIME 2 plugins (or other QIIME 2-based tools)": [[44, null]], "Putting it together": [[29, "putting-it-together"]], "Python 3 API": [[70, "python-3-api"]], "QIIME 2 Development Cycle Structure": [[19, "qiime-2-development-cycle-structure"]], "QIIME 2 Development and Release Cycle Structure": [[19, null]], "QIIME 2 Library": [[44, "qiime-2-library"]], "QIIME 2 Release Cycle Structure": [[19, "qiime-2-release-cycle-structure"]], "QIIME 2 architecture overview": [[8, null]], "Range": [[16, "range"]], "References": [[20, null], [23, null], [62, null]], "Refining a Type": [[16, "refining-a-type"]], "Register a QIIME 2 plugin": [[45, null]], "Register the Method": [[32, "register-the-method"]], "Register the Pipeline": [[69, "register-the-pipeline"]], "Register the Visualizer": [[35, "register-the-visualizer"]], "Register the action in plugin_setup.py": [[67, "register-the-action-in-plugin-setup-py"]], "Register the wrapper function as a plugin action": [[67, "register-the-wrapper-function-as-a-plugin-action"]], "Register your Python function as a plugin action": [[65, "register-your-python-function-as-a-plugin-action"]], "Registering an Action that Returns an Output Collection": [[30, "registering-an-action-that-returns-an-output-collection"]], "Registering an Action that Takes an Input Collection": [[30, "registering-an-action-that-takes-an-input-collection"]], "Registering an artifact class": [[66, "registering-an-artifact-class"]], "Registering split_sequences": [[68, "registering-split-sequences"]], "Registering the Pipeline": [[33, "registering-the-pipeline"]], "Registering the type, formats, and artifact class": [[66, "registering-the-type-formats-and-artifact-class"]], "Registering the usage example": [[70, "registering-the-usage-example"]], "Registering usage examples": [[49, "registering-usage-examples"]], "Requesting addition of your plugin to the Library": [[37, "requesting-addition-of-your-plugin-to-the-library"]], "Requirements before requesting the addition of your plugin to the Library": [[37, "requirements-before-requesting-the-addition-of-your-plugin-to-the-library"]], "Results and Assertions": [[60, "results-and-assertions"]], "Rules for identifying an archive": [[9, "rules-for-identifying-an-archive"]], "Run cookiecutter to create your plugin": [[72, "run-cookiecutter-to-create-your-plugin"]], "SQL Filtering": [[50, "sql-filtering"]], "Semantic Properties": [[16, "semantic-properties"]], "Semantic Subtyping": [[16, "semantic-subtyping"]], "Semantic Type": [[59, "semantic-type"]], "Semantic Types, Primitives, and Visualizations": [[16, null]], "Semantic types": [[29, "semantic-types"]], "Semantic types, data types, file formats, and artifact classes": [[29, null]], "Set up your development environment": [[46, null]], "Setting up your development environment": [[24, null]], "Share your plugin on GitHub": [[36, "share-your-plugin-on-github"]], "Should our sequence splitter take the size of each split or the number of splits to create as input?": [[68, null]], "Single File Directory Formats": [[11, "single-file-directory-formats"]], "Skipping format validation": [[52, "skipping-format-validation"]], "Standard/plugin-specific development": [[19, "standard-plugin-specific-development"]], "Summary": [[8, "summary"]], "Template your plugin": [[36, "template-your-plugin"]], "Testing": [[58, null]], "Testing the parallel Pipeline": [[68, "testing-the-parallel-pipeline"]], "Testing the semantic type and formats": [[66, "testing-the-semantic-type-and-formats"]], "Testing the transformer": [[66, "testing-the-transformer"]], "Testing usage examples": [[49, "testing-usage-examples"]], "Text File Formats": [[11, "text-file-formats"]], "The Most Important File: metadata.yaml": [[9, "the-most-important-file-metadata-yaml"]], "The PluginManager Object": [[22, "the-pluginmanager-object"]], "The ResultCollection object": [[30, "the-resultcollection-object"]], "The action block": [[15, "the-action-block"]], "The action.yaml file": [[15, "the-action-yaml-file"]], "The environment block": [[15, "the-environment-block"]], "The execution block": [[15, "the-execution-block"]], "The input metadata": [[73, "the-input-metadata"]], "The qiime.Metadata class": [[63, "the-qiime-metadata-class"]], "The structure of QIIME 2 plugin packages": [[27, null]], "Transformers": [[28, null]], "Trying it out": [[49, "trying-it-out"]], "Trying the new action": [[67, "trying-the-new-action"]], "Tutorial table of contents": [[74, "tutorial-table-of-contents"]], "Tutorial: A step-by-step guide to building your first QIIME 2 plugin": [[74, null]], "Types": [[59, null]], "Types of QIIME 2 Actions": [[25, null]], "Unions": [[16, "unions"]], "Unique IDs": [[15, "unique-ids"]], "Unit testing": [[66, "unit-testing"]], "Unit testing the visualizer function": [[65, "unit-testing-the-visualizer-function"]], "Update plugin_setup.py": [[73, "update-plugin-setup-py"]], "Update search-and-summarize": [[73, "update-search-and-summarize"]], "Update search-and-summarize to use split and combine Methods": [[68, "update-search-and-summarize-to-use-split-and-combine-methods"]], "Update the nw_align action to avoid duplicating information": [[69, "update-the-nw-align-action-to-avoid-duplicating-information"]], "Updating nw-align to use the new artifact class": [[66, "updating-nw-align-to-use-the-new-artifact-class"]], "Usage Examples": [[60, null]], "Use Artifact Collections as Action inputs or outputs": [[30, null]], "User Metadata API": [[63, null]], "User documentation": [[7, null]], "Using Collections": [[30, "using-collections"]], "Using Collections with the Python API": [[30, "using-collections-with-the-python-api"]], "Using Collections with the command line interface (CLI)": [[30, "using-collections-with-the-command-line-interface-cli"]], "Utilities": [[61, null]], "Utility functions": [[22, "utility-functions"]], "Validation": [[11, "validation"]], "Variable Layouts": [[11, "variable-layouts"]], "Version-agnostic format guarantees": [[18, "version-agnostic-format-guarantees"]], "Visualization type": [[59, "visualization-type"]], "What Provenance Data is Captured?": [[15, "what-provenance-data-is-captured"]], "What to test and what not to test": [[67, "what-to-test-and-what-not-to-test"]], "Why Capture Provenance Data?": [[15, "why-capture-provenance-data"]], "Why a ZIP File?": [[9, "why-a-zip-file"]], "Wrapping up testing": [[67, "wrapping-up-testing"]], "Write a wrapper function": [[67, "write-a-wrapper-function"]], "Write the visualizer function": [[65, "write-the-visualizer-function"]], "Write unit tests": [[67, "write-unit-tests"]], "Writing Usage Examples": [[49, null]], "Writing tutorials": [[70, "writing-tutorials"]], "init": [[30, "init"]], "load": [[30, "load"]], "q2-dwq2": [[27, "q2-dwq2"]], "q2-dwq2/.git": [[27, "q2-dwq2-git"]], "q2-dwq2/.github": [[27, "q2-dwq2-github"]], "q2-dwq2/.gitignore": [[27, "q2-dwq2-gitignore"]], "q2-dwq2/LICENSE": [[27, "q2-dwq2-license"]], "q2-dwq2/MANIFEST.in": [[27, "q2-dwq2-manifest-in"]], "q2-dwq2/Makefile": [[27, "q2-dwq2-makefile"]], "q2-dwq2/README.md": [[27, "q2-dwq2-readme-md"]], "q2-dwq2/ci": [[27, "q2-dwq2-ci"]], "q2-dwq2/q2_dwq2": [[27, "q2-dwq2-q2-dwq2"]], "q2-dwq2/q2_dwq2/__init__.py": [[27, "q2-dwq2-q2-dwq2-init-py"]], "q2-dwq2/q2_dwq2/_methods.py": [[27, "q2-dwq2-q2-dwq2-methods-py"]], "q2-dwq2/q2_dwq2/_version.py": [[27, "q2-dwq2-q2-dwq2-version-py"]], "q2-dwq2/q2_dwq2/citations.bib": [[27, "q2-dwq2-q2-dwq2-citations-bib"]], "q2-dwq2/q2_dwq2/plugin_setup.py": [[27, "q2-dwq2-q2-dwq2-plugin-setup-py"]], "q2-dwq2/q2_dwq2/setup.cfg": [[27, "q2-dwq2-q2-dwq2-setup-cfg"]], "q2-dwq2/q2_dwq2/setup.py": [[27, "q2-dwq2-q2-dwq2-setup-py"]], "q2-dwq2/q2_dwq2/tests": [[27, "q2-dwq2-q2-dwq2-tests"]], "q2-dwq2/q2_dwq2/tests/__init__.py": [[27, "q2-dwq2-q2-dwq2-tests-init-py"]], "q2-dwq2/q2_dwq2/tests/data": [[27, "q2-dwq2-q2-dwq2-tests-data"]], "q2-dwq2/q2_dwq2/tests/test_methods.py": [[27, "q2-dwq2-q2-dwq2-tests-test-methods-py"]], "q2-dwq2/q2_dwq2/versioneer.py": [[27, "q2-dwq2-q2-dwq2-versioneer-py"]], "save": [[30, "save"]], "split-apply-combine flowchart for search and summarize": [[68, "split-apply-combine-flowchart"]], "tl;dr": [[64, null], [65, "add-alignment-visualizer-commit"], [66, "add-artifact-class-commit"], [67, "add-nw-align-method-commit"], [68, "add-parallel-pipeline-commits"], [69, "add-pipeline-commit"], [70, "add-usage-example-commit"], [73, "integrate-metadata-commits"]]}, "docnames": ["back-matter/bibliography", "back-matter/genindex", "back-matter/glossary", "back-matter/intro", "ci/intro", "docs/developer-documentation", "docs/intro", "docs/user-documentation", "framework/explanations/architecture", "framework/explanations/archives", "framework/explanations/data-storage", "framework/explanations/formats", "framework/explanations/garbage-collection", "framework/explanations/intro", "framework/explanations/metaprogramming", "framework/explanations/provenance", "framework/explanations/types", "framework/intro", "framework/references/archive-versions", "framework/references/dev-cycle-structure", "framework/references/intro", "interfaces/intro", "interfaces/references/api", "interfaces/references/intro", "intro", "plugins/explanations/actions", "plugins/explanations/intro", "plugins/explanations/package-structure", "plugins/explanations/transformers", "plugins/explanations/types-of-types", "plugins/how-to-guides/artifact-collections-as-io", "plugins/how-to-guides/automate-testing", "plugins/how-to-guides/create-register-method", "plugins/how-to-guides/create-register-pipeline", "plugins/how-to-guides/create-register-transformer", "plugins/how-to-guides/create-register-visualizer", "plugins/how-to-guides/distribute-on-gh", "plugins/how-to-guides/distribute-on-library", "plugins/how-to-guides/facilitate-installation", "plugins/how-to-guides/format-validation-levels", "plugins/how-to-guides/handle-exceptions-in-parallel-pipelines", "plugins/how-to-guides/intro", "plugins/how-to-guides/maximize-compatibility", "plugins/how-to-guides/play-nicely-with-others", "plugins/how-to-guides/publicize", "plugins/how-to-guides/register-a-plugin", "plugins/how-to-guides/set-up-development-environment", "plugins/how-to-guides/support-your-users", "plugins/how-to-guides/test-plugins", "plugins/how-to-guides/usage-examples", "plugins/how-to-guides/use-metadata", "plugins/intro", "plugins/references/antipatterns", "plugins/references/api/citations", "plugins/references/api/context", "plugins/references/api/formats", "plugins/references/api/intro", "plugins/references/api/plugin", "plugins/references/api/testing", "plugins/references/api/types", "plugins/references/api/usage", "plugins/references/api/utils", "plugins/references/intro", "plugins/references/metadata-api", "plugins/tutorials/add-2nd-transformer", "plugins/tutorials/add-alignment-visualizer", "plugins/tutorials/add-artifact-class", "plugins/tutorials/add-nw-align-method", "plugins/tutorials/add-parallel-pipeline", "plugins/tutorials/add-pipeline", "plugins/tutorials/add-usage-examples", "plugins/tutorials/conclusion", "plugins/tutorials/create-from-template", "plugins/tutorials/integrate-metadata", "plugins/tutorials/intro"], "envversion": {"sphinx": 62, "sphinx.domains.c": 3, "sphinx.domains.changeset": 1, "sphinx.domains.citation": 1, "sphinx.domains.cpp": 9, "sphinx.domains.index": 1, "sphinx.domains.javascript": 3, "sphinx.domains.math": 2, "sphinx.domains.python": 4, "sphinx.domains.rst": 2, "sphinx.domains.std": 2, "sphinx.ext.intersphinx": 1, "sphinxcontrib.bibtex": 9}, "filenames": ["back-matter/bibliography.md", "back-matter/genindex.md", "back-matter/glossary.md", "back-matter/intro.md", "ci/intro.md", "docs/developer-documentation.md", "docs/intro.md", "docs/user-documentation.md", "framework/explanations/architecture.md", "framework/explanations/archives.md", "framework/explanations/data-storage.md", "framework/explanations/formats.md", "framework/explanations/garbage-collection.md", "framework/explanations/intro.md", "framework/explanations/metaprogramming.md", "framework/explanations/provenance.md", "framework/explanations/types.md", "framework/intro.md", "framework/references/archive-versions.md", "framework/references/dev-cycle-structure.md", "framework/references/intro.md", "interfaces/intro.md", "interfaces/references/api.md", "interfaces/references/intro.md", "intro.md", "plugins/explanations/actions.md", "plugins/explanations/intro.md", "plugins/explanations/package-structure.md", "plugins/explanations/transformers.md", "plugins/explanations/types-of-types.md", "plugins/how-to-guides/artifact-collections-as-io.md", "plugins/how-to-guides/automate-testing.md", "plugins/how-to-guides/create-register-method.md", "plugins/how-to-guides/create-register-pipeline.md", "plugins/how-to-guides/create-register-transformer.md", "plugins/how-to-guides/create-register-visualizer.md", "plugins/how-to-guides/distribute-on-gh.md", "plugins/how-to-guides/distribute-on-library.md", "plugins/how-to-guides/facilitate-installation.md", "plugins/how-to-guides/format-validation-levels.md", "plugins/how-to-guides/handle-exceptions-in-parallel-pipelines.md", "plugins/how-to-guides/intro.md", "plugins/how-to-guides/maximize-compatibility.md", "plugins/how-to-guides/play-nicely-with-others.md", "plugins/how-to-guides/publicize.md", "plugins/how-to-guides/register-a-plugin.md", "plugins/how-to-guides/set-up-development-environment.md", "plugins/how-to-guides/support-your-users.md", "plugins/how-to-guides/test-plugins.md", "plugins/how-to-guides/usage-examples.md", "plugins/how-to-guides/use-metadata.md", "plugins/intro.md", "plugins/references/antipatterns.md", "plugins/references/api/citations.md", "plugins/references/api/context.md", "plugins/references/api/formats.md", "plugins/references/api/intro.md", "plugins/references/api/plugin.md", "plugins/references/api/testing.md", "plugins/references/api/types.md", "plugins/references/api/usage.md", "plugins/references/api/utils.md", "plugins/references/intro.md", "plugins/references/metadata-api.md", "plugins/tutorials/add-2nd-transformer.md", "plugins/tutorials/add-alignment-visualizer.md", "plugins/tutorials/add-artifact-class.md", "plugins/tutorials/add-nw-align-method.md", "plugins/tutorials/add-parallel-pipeline.md", "plugins/tutorials/add-pipeline.md", "plugins/tutorials/add-usage-examples.md", "plugins/tutorials/conclusion.md", "plugins/tutorials/create-from-template.md", "plugins/tutorials/integrate-metadata.md", "plugins/tutorials/intro.md"], "indexentries": {"__iter__() (qiime2.plugin.citations method)": [[53, "qiime2.plugin.Citations.__iter__", false]], "action": [[2, "term-Action", true]], "action() (in module qiime2.sdk)": [[22, "qiime2.sdk.Action", false]], "action() (qiime2.sdk.usage.usage method)": [[60, "qiime2.sdk.usage.Usage.action", false]], "archive": [[2, "term-Archive", true]], "artifact": [[2, "term-Artifact", true]], "artifact api": [[2, "term-Artifact-API", true]], "artifact class": [[2, "term-Artifact-class", true]], "artifact() (in module qiime2.sdk)": [[22, "qiime2.sdk.Artifact", false]], "assert_has_line_matching() (qiime2.sdk.usage.usagevariable method)": [[60, "qiime2.sdk.usage.UsageVariable.assert_has_line_matching", false]], "assert_no_nans_in_tables() (in module qiime2.plugin.testing)": [[58, "qiime2.plugin.testing.assert_no_nans_in_tables", false]], "assert_output_type() (qiime2.sdk.usage.usagevariable method)": [[60, "qiime2.sdk.usage.UsageVariable.assert_output_type", false]], "assertregisteredsemantictype() (qiime2.plugin.testing.testpluginbase method)": [[58, "qiime2.plugin.testing.TestPluginBase.assertRegisteredSemanticType", false]], "assertsemantictyperegisteredtoformat() (qiime2.plugin.testing.testpluginbase method)": [[58, "qiime2.plugin.testing.TestPluginBase.assertSemanticTypeRegisteredToFormat", false]], "binaryfileformat (class in qiime2.plugin)": [[55, "qiime2.plugin.BinaryFileFormat", false]], "bool (in module qiime2.plugin)": [[59, "qiime2.plugin.Bool", false]], "categorical (in module qiime2.plugin)": [[59, "qiime2.plugin.Categorical", false]], "categoricalmetadatacolumn (class in qiime2)": [[63, "qiime2.CategoricalMetadataColumn", false]], "choices (class in qiime2.plugin)": [[59, "qiime2.plugin.Choices", false]], "citationrecord (class in qiime2.plugin)": [[53, "qiime2.plugin.CitationRecord", false]], "citations (class in qiime2.plugin)": [[53, "qiime2.plugin.Citations", false]], "collection (in module qiime2.plugin)": [[59, "qiime2.plugin.Collection", false]], "column_count (qiime2.metadata property)": [[63, "qiime2.Metadata.column_count", false]], "columns (qiime2.metadata property)": [[63, "qiime2.Metadata.columns", false]], "comment() (qiime2.sdk.usage.usage method)": [[60, "qiime2.sdk.usage.Usage.comment", false]], "conda metapackage": [[2, "term-Conda-metapackage", true]], "construct_artifact_collection() (qiime2.sdk.usage.usage method)": [[60, "qiime2.sdk.usage.Usage.construct_artifact_collection", false]], "deployment": [[2, "term-Deployment", true]], "directory format": [[2, "term-Directory-Format", true]], "directoryformat (class in qiime2.plugin)": [[55, "qiime2.plugin.DirectoryFormat", false]], "distribution": [[2, "term-Distribution", true]], "dr": [[2, "term-tl-dr", true]], "drop_missing_values() (qiime2.metadatacolumn method)": [[63, "qiime2.MetadataColumn.drop_missing_values", false]], "dry": [[2, "term-DRY", true]], "duplicate() (in module qiime2.util)": [[61, "qiime2.util.duplicate", false]], "end() (in module qiime2.plugin)": [[59, "qiime2.plugin.End", false]], "execute_examples() (qiime2.plugin.testing.testpluginbase method)": [[58, "qiime2.plugin.testing.TestPluginBase.execute_examples", false]], "file format": [[2, "term-File-Format", true]], "filter_columns() (qiime2.metadata method)": [[63, "qiime2.Metadata.filter_columns", false]], "filter_ids() (qiime2.metadata method)": [[63, "qiime2.Metadata.filter_ids", false]], "filter_ids() (qiime2.metadatacolumn method)": [[63, "qiime2.MetadataColumn.filter_ids", false]], "float (in module qiime2.plugin)": [[59, "qiime2.plugin.Float", false]], "format": [[2, "term-Format", true]], "framework": [[2, "term-Framework", true]], "galaxy": [[2, "term-Galaxy", true]], "get_action() (qiime2.sdk.context method)": [[54, "qiime2.sdk.Context.get_action", false]], "get_artifact_collection_member() (qiime2.sdk.usage.usage method)": [[60, "qiime2.sdk.usage.Usage.get_artifact_collection_member", false]], "get_available_cores() (in module qiime2.plugin.util)": [[61, "qiime2.plugin.util.get_available_cores", false]], "get_column() (qiime2.metadata method)": [[63, "qiime2.Metadata.get_column", false]], "get_data_path() (qiime2.plugin.testing.testpluginbase method)": [[58, "qiime2.plugin.testing.TestPluginBase.get_data_path", false]], "get_ids() (qiime2.metadata method)": [[63, "qiime2.Metadata.get_ids", false]], "get_ids() (qiime2.metadatacolumn method)": [[63, "qiime2.MetadataColumn.get_ids", false]], "get_metadata_column() (qiime2.sdk.usage.usage method)": [[60, "qiime2.sdk.usage.Usage.get_metadata_column", false]], "get_missing() (qiime2.metadatacolumn method)": [[63, "qiime2.MetadataColumn.get_missing", false]], "get_transformer() (qiime2.plugin.testing.testpluginbase method)": [[58, "qiime2.plugin.testing.TestPluginBase.get_transformer", false]], "get_value() (qiime2.metadatacolumn method)": [[63, "qiime2.MetadataColumn.get_value", false]], "has_missing_values() (qiime2.metadatacolumn method)": [[63, "qiime2.MetadataColumn.has_missing_values", false]], "help() (qiime2.sdk.usage.usage method)": [[60, "qiime2.sdk.usage.Usage.help", false]], "identifier": [[2, "term-Identifier", true]], "identity": [[2, "term-Identity", true]], "implementationerror() (in module qiime2.sdk)": [[22, "qiime2.sdk.ImplementationError", false]], "import_from_format() (qiime2.sdk.usage.usage method)": [[60, "qiime2.sdk.usage.Usage.import_from_format", false]], "init_artifact() (qiime2.sdk.usage.usage method)": [[60, "qiime2.sdk.usage.Usage.init_artifact", false]], "init_artifact_collection() (qiime2.sdk.usage.usage method)": [[60, "qiime2.sdk.usage.Usage.init_artifact_collection", false]], "init_artifact_from_url() (qiime2.sdk.usage.usage method)": [[60, "qiime2.sdk.usage.Usage.init_artifact_from_url", false]], "init_format() (qiime2.sdk.usage.usage method)": [[60, "qiime2.sdk.usage.Usage.init_format", false]], "init_metadata() (qiime2.sdk.usage.usage method)": [[60, "qiime2.sdk.usage.Usage.init_metadata", false]], "init_metadata_from_url() (qiime2.sdk.usage.usage method)": [[60, "qiime2.sdk.usage.Usage.init_metadata_from_url", false]], "input": [[2, "term-Input", true]], "int (in module qiime2.plugin)": [[59, "qiime2.plugin.Int", false]], "interface": [[2, "term-Interface", true]], "jobs (in module qiime2.plugin)": [[59, "qiime2.plugin.Jobs", false]], "list (in module qiime2.plugin)": [[59, "qiime2.plugin.List", false]], "load() (qiime2.metadata class method)": [[63, "qiime2.Metadata.load", false]], "load() (qiime2.plugin.citations class method)": [[53, "qiime2.plugin.Citations.load", false]], "make_artifact() (qiime2.sdk.context method)": [[54, "qiime2.sdk.Context.make_artifact", false]], "merge() (qiime2.metadata method)": [[63, "qiime2.Metadata.merge", false]], "merge_metadata() (qiime2.sdk.usage.usage method)": [[60, "qiime2.sdk.usage.Usage.merge_metadata", false]], "metadata": [[2, "term-Metadata", true]], "metadata (class in qiime2)": [[63, "qiime2.Metadata", false]], "metadata (in module qiime2.plugin)": [[59, "qiime2.plugin.Metadata", false]], "metadatacolumn (class in qiime2)": [[63, "qiime2.MetadataColumn", false]], "metadatacolumn (in module qiime2.plugin)": [[59, "qiime2.plugin.MetadataColumn", false]], "metadatafileerror (class in qiime2.metadata)": [[63, "qiime2.metadata.MetadataFileError", false]], "method": [[2, "term-Method", true]], "method() (in module qiime2.sdk)": [[22, "qiime2.sdk.Method", false]], "missing_scheme (qiime2.metadatacolumn property)": [[63, "qiime2.MetadataColumn.missing_scheme", false]], "name (qiime2.metadatacolumn property)": [[63, "qiime2.MetadataColumn.name", false]], "numeric (in module qiime2.plugin)": [[59, "qiime2.plugin.Numeric", false]], "numericmetadatacolumn (class in qiime2)": [[63, "qiime2.NumericMetadataColumn", false]], "output": [[2, "term-Output", true]], "package (qiime2.plugin.testing.testpluginbase attribute)": [[58, "qiime2.plugin.testing.TestPluginBase.package", false]], "pairwise sequence alignment": [[2, "term-Pairwise-sequence-alignment", true]], "parameter": [[2, "term-Parameter", true]], "parse_format() (in module qiime2.sdk)": [[22, "qiime2.sdk.parse_format", false]], "parse_type() (in module qiime2.sdk)": [[22, "qiime2.sdk.parse_type", false]], "payload": [[2, "term-Payload", true]], "peek() (qiime2.sdk.usage.usage method)": [[60, "qiime2.sdk.usage.Usage.peek", false]], "pipeline": [[2, "term-Pipeline", true]], "pipeline() (in module qiime2.sdk)": [[22, "qiime2.sdk.Pipeline", false]], "plugin": [[2, "term-Plugin", true]], "plugin (class in qiime2.plugin)": [[57, "qiime2.plugin.Plugin", false]], "plugin manager": [[2, "term-Plugin-Manager", true]], "pluginmanager() (in module qiime2.sdk)": [[22, "qiime2.sdk.PluginManager", false]], "pluginmethods (class in qiime2.plugin.plugin)": [[57, "qiime2.plugin.plugin.PluginMethods", false]], "pluginpipelines (class in qiime2.plugin.plugin)": [[57, "qiime2.plugin.plugin.PluginPipelines", false]], "pluginvisualizers (class in qiime2.plugin.plugin)": [[57, "qiime2.plugin.plugin.PluginVisualizers", false]], "primitive type": [[2, "term-Primitive-Type", true]], "properties (class in qiime2.plugin)": [[59, "qiime2.plugin.Properties", false]], "provenance": [[2, "term-Provenance", true]], "provenance replay": [[2, "term-Provenance-Replay", true]], "python 3 api": [[2, "term-Python-3-API", true]], "q2cli": [[2, "term-q2cli", true]], "range (class in qiime2.plugin)": [[59, "qiime2.plugin.Range", false]], "redirected_stdio() (in module qiime2.util)": [[61, "qiime2.util.redirected_stdio", false]], "register_artifact_class() (qiime2.plugin.plugin method)": [[57, "qiime2.plugin.Plugin.register_artifact_class", false]], "register_formats() (qiime2.plugin.plugin method)": [[57, "qiime2.plugin.Plugin.register_formats", false]], "register_function() (qiime2.plugin.plugin.pluginmethods method)": [[57, "qiime2.plugin.plugin.PluginMethods.register_function", false]], "register_function() (qiime2.plugin.plugin.pluginpipelines method)": [[57, "qiime2.plugin.plugin.PluginPipelines.register_function", false]], "register_function() (qiime2.plugin.plugin.pluginvisualizers method)": [[57, "qiime2.plugin.plugin.PluginVisualizers.register_function", false]], "register_semantic_type_to_format() (qiime2.plugin.plugin method)": [[57, "qiime2.plugin.Plugin.register_semantic_type_to_format", false]], "register_semantic_types() (qiime2.plugin.plugin method)": [[57, "qiime2.plugin.Plugin.register_semantic_types", false]], "register_transformer() (qiime2.plugin.plugin method)": [[57, "qiime2.plugin.Plugin.register_transformer", false]], "register_validator() (qiime2.plugin.plugin method)": [[57, "qiime2.plugin.Plugin.register_validator", false]], "register_views() (qiime2.plugin.plugin method)": [[57, "qiime2.plugin.Plugin.register_views", false]], "result": [[2, "term-Result", true]], "result() (in module qiime2.sdk)": [[22, "qiime2.sdk.Result", false]], "resultcollection() (in module qiime2.sdk)": [[22, "qiime2.sdk.ResultCollection", false]], "results() (in module qiime2.sdk)": [[22, "qiime2.sdk.Results", false]], "save() (qiime2.plugin.citations method)": [[53, "qiime2.plugin.Citations.save", false]], "semantic type": [[2, "term-Semantic-Type", true]], "semantictype() (in module qiime2.plugin)": [[59, "qiime2.plugin.SemanticType", false]], "set (in module qiime2.plugin)": [[59, "qiime2.plugin.Set", false]], "setup() (qiime2.plugin.testing.testpluginbase method)": [[58, "qiime2.plugin.testing.TestPluginBase.setUp", false]], "single-use plugin (sup)": [[2, "term-Single-Use-Plugin-SUP", true]], "singlefiledirectoryformat() (in module qiime2.plugin)": [[55, "qiime2.plugin.SingleFileDirectoryFormat", false]], "start() (in module qiime2.plugin)": [[59, "qiime2.plugin.Start", false]], "str (in module qiime2.plugin)": [[59, "qiime2.plugin.Str", false]], "teardown() (qiime2.plugin.testing.testpluginbase method)": [[58, "qiime2.plugin.testing.TestPluginBase.tearDown", false]], "test_dir_prefix (qiime2.plugin.testing.testpluginbase attribute)": [[58, "qiime2.plugin.testing.TestPluginBase.test_dir_prefix", false]], "testpluginbase (class in qiime2.plugin.testing)": [[58, "qiime2.plugin.testing.TestPluginBase", false]], "textfileformat (class in qiime2.plugin)": [[55, "qiime2.plugin.TextFileFormat", false]], "threads (in module qiime2.plugin)": [[59, "qiime2.plugin.Threads", false]], "tl": [[2, "term-tl-dr", true]], "to_dataframe() (qiime2.metadata method)": [[63, "qiime2.Metadata.to_dataframe", false]], "to_dataframe() (qiime2.metadatacolumn method)": [[63, "qiime2.MetadataColumn.to_dataframe", false]], "to_series() (qiime2.metadatacolumn method)": [[63, "qiime2.MetadataColumn.to_series", false]], "transform() (in module qiime2.plugin.util)": [[61, "qiime2.plugin.util.transform", false]], "transform_format() (qiime2.plugin.testing.testpluginbase method)": [[58, "qiime2.plugin.testing.TestPluginBase.transform_format", false]], "transformer": [[2, "term-Transformer", true]], "type": [[2, "term-Type", true]], "type_from_ast() (in module qiime2.sdk)": [[22, "qiime2.sdk.type_from_ast", false]], "typemap (class in qiime2.plugin)": [[59, "qiime2.plugin.TypeMap", false]], "typematch (class in qiime2.plugin)": [[59, "qiime2.plugin.TypeMatch", false]], "uninitializedpluginmanagererror() (in module qiime2.sdk)": [[22, "qiime2.sdk.UninitializedPluginManagerError", false]], "usageaction (class in qiime2.sdk.usage)": [[60, "qiime2.sdk.usage.UsageAction", false]], "usageaction (qiime2.sdk.usage.usage attribute)": [[60, "qiime2.sdk.usage.Usage.UsageAction", false]], "usageinputs (class in qiime2.sdk.usage)": [[60, "qiime2.sdk.usage.UsageInputs", false]], "usageinputs (qiime2.sdk.usage.usage attribute)": [[60, "qiime2.sdk.usage.Usage.UsageInputs", false]], "usageoutputnames (class in qiime2.sdk.usage)": [[60, "qiime2.sdk.usage.UsageOutputNames", false]], "usageoutputnames (qiime2.sdk.usage.usage attribute)": [[60, "qiime2.sdk.usage.Usage.UsageOutputNames", false]], "usageoutputs (class in qiime2.sdk.usage)": [[60, "qiime2.sdk.usage.UsageOutputs", false]], "usagevariable (class in qiime2.sdk.usage)": [[60, "qiime2.sdk.usage.UsageVariable", false]], "uuid": [[2, "term-UUID", true]], "validationerror (class in qiime2.plugin)": [[55, "qiime2.plugin.ValidationError", false]], "validationerror() (in module qiime2.sdk)": [[22, "qiime2.sdk.ValidationError", false]], "view": [[2, "term-View", true]], "view_as_metadata() (qiime2.sdk.usage.usage method)": [[60, "qiime2.sdk.usage.Usage.view_as_metadata", false]], "visualization": [[2, "term-Visualization", true]], "visualization (in module qiime2.plugin)": [[59, "qiime2.plugin.Visualization", false]], "visualization (type)": [[2, "term-Visualization-Type", true]], "visualization() (in module qiime2.sdk)": [[22, "qiime2.sdk.Visualization", false]], "visualizer": [[2, "term-Visualizer", true]], "visualizer() (in module qiime2.sdk)": [[22, "qiime2.sdk.Visualizer", false]]}, "objects": {"qiime2": [[63, 0, 1, "", "CategoricalMetadataColumn"], [63, 0, 1, "", "Metadata"], [63, 0, 1, "", "MetadataColumn"], [63, 0, 1, "", "NumericMetadataColumn"]], "qiime2.Metadata": [[63, 1, 1, "", "column_count"], [63, 1, 1, "", "columns"], [63, 2, 1, "", "filter_columns"], [63, 2, 1, "", "filter_ids"], [63, 2, 1, "", "get_column"], [63, 2, 1, "", "get_ids"], [63, 2, 1, "", "load"], [63, 2, 1, "", "merge"], [63, 2, 1, "", "to_dataframe"]], "qiime2.MetadataColumn": [[63, 2, 1, "", "drop_missing_values"], [63, 2, 1, "", "filter_ids"], [63, 2, 1, "", "get_ids"], [63, 2, 1, "", "get_missing"], [63, 2, 1, "", "get_value"], [63, 2, 1, "", "has_missing_values"], [63, 1, 1, "", "missing_scheme"], [63, 1, 1, "", "name"], [63, 2, 1, "", "to_dataframe"], [63, 2, 1, "", "to_series"]], "qiime2.metadata": [[63, 0, 1, "", "MetadataFileError"]], "qiime2.plugin": [[55, 0, 1, "", "BinaryFileFormat"], [59, 3, 1, "", "Bool"], [59, 3, 1, "", "Categorical"], [59, 0, 1, "", "Choices"], [53, 0, 1, "", "CitationRecord"], [53, 0, 1, "", "Citations"], [59, 3, 1, "", "Collection"], [55, 0, 1, "", "DirectoryFormat"], [59, 4, 1, "", "End"], [59, 3, 1, "", "Float"], [59, 3, 1, "", "Int"], [59, 3, 1, "", "Jobs"], [59, 3, 1, "", "List"], [59, 3, 1, "", "Metadata"], [59, 3, 1, "", "MetadataColumn"], [59, 3, 1, "", "Numeric"], [57, 0, 1, "", "Plugin"], [59, 0, 1, "", "Properties"], [59, 0, 1, "", "Range"], [59, 4, 1, "", "SemanticType"], [59, 3, 1, "", "Set"], [55, 4, 1, "", "SingleFileDirectoryFormat"], [59, 4, 1, "", "Start"], [59, 3, 1, "", "Str"], [55, 0, 1, "", "TextFileFormat"], [59, 3, 1, "", "Threads"], [59, 0, 1, "", "TypeMap"], [59, 0, 1, "", "TypeMatch"], [55, 0, 1, "", "ValidationError"], [59, 3, 1, "", "Visualization"]], "qiime2.plugin.Citations": [[53, 2, 1, "", "__iter__"], [53, 2, 1, "", "load"], [53, 2, 1, "", "save"]], "qiime2.plugin.Plugin": [[57, 2, 1, "", "register_artifact_class"], [57, 2, 1, "", "register_formats"], [57, 2, 1, "", "register_semantic_type_to_format"], [57, 2, 1, "", "register_semantic_types"], [57, 2, 1, "", "register_transformer"], [57, 2, 1, "", "register_validator"], [57, 2, 1, "", "register_views"]], "qiime2.plugin.plugin": [[57, 0, 1, "", "PluginMethods"], [57, 0, 1, "", "PluginPipelines"], [57, 0, 1, "", "PluginVisualizers"]], "qiime2.plugin.plugin.PluginMethods": [[57, 2, 1, "", "register_function"]], "qiime2.plugin.plugin.PluginPipelines": [[57, 2, 1, "", "register_function"]], "qiime2.plugin.plugin.PluginVisualizers": [[57, 2, 1, "", "register_function"]], "qiime2.plugin.testing": [[58, 0, 1, "", "TestPluginBase"], [58, 4, 1, "", "assert_no_nans_in_tables"]], "qiime2.plugin.testing.TestPluginBase": [[58, 2, 1, "", "assertRegisteredSemanticType"], [58, 2, 1, "", "assertSemanticTypeRegisteredToFormat"], [58, 2, 1, "", "execute_examples"], [58, 2, 1, "", "get_data_path"], [58, 2, 1, "", "get_transformer"], [58, 5, 1, "", "package"], [58, 2, 1, "", "setUp"], [58, 2, 1, "", "tearDown"], [58, 5, 1, "", "test_dir_prefix"], [58, 2, 1, "", "transform_format"]], "qiime2.plugin.util": [[61, 4, 1, "", "get_available_cores"], [61, 4, 1, "", "transform"]], "qiime2.sdk": [[22, 4, 1, "", "Action"], [22, 4, 1, "", "Artifact"], [22, 4, 1, "", "ImplementationError"], [22, 4, 1, "", "Method"], [22, 4, 1, "", "Pipeline"], [22, 4, 1, "", "PluginManager"], [22, 4, 1, "", "Result"], [22, 4, 1, "", "ResultCollection"], [22, 4, 1, "", "Results"], [22, 4, 1, "", "UninitializedPluginManagerError"], [22, 4, 1, "", "ValidationError"], [22, 4, 1, "", "Visualization"], [22, 4, 1, "", "Visualizer"], [22, 4, 1, "", "parse_format"], [22, 4, 1, "", "parse_type"], [22, 4, 1, "", "type_from_ast"]], "qiime2.sdk.Context": [[54, 2, 1, "", "get_action"], [54, 2, 1, "", "make_artifact"]], "qiime2.sdk.usage": [[60, 0, 1, "", "UsageAction"], [60, 0, 1, "", "UsageInputs"], [60, 0, 1, "", "UsageOutputNames"], [60, 0, 1, "", "UsageOutputs"], [60, 0, 1, "", "UsageVariable"]], "qiime2.sdk.usage.Usage": [[60, 5, 1, "", "UsageAction"], [60, 5, 1, "", "UsageInputs"], [60, 5, 1, "", "UsageOutputNames"], [60, 2, 1, "", "action"], [60, 2, 1, "", "comment"], [60, 2, 1, "", "construct_artifact_collection"], [60, 2, 1, "", "get_artifact_collection_member"], [60, 2, 1, "", "get_metadata_column"], [60, 2, 1, "", "help"], [60, 2, 1, "", "import_from_format"], [60, 2, 1, "", "init_artifact"], [60, 2, 1, "", "init_artifact_collection"], [60, 2, 1, "", "init_artifact_from_url"], [60, 2, 1, "", "init_format"], [60, 2, 1, "", "init_metadata"], [60, 2, 1, "", "init_metadata_from_url"], [60, 2, 1, "", "merge_metadata"], [60, 2, 1, "", "peek"], [60, 2, 1, "", "view_as_metadata"]], "qiime2.sdk.usage.UsageVariable": [[60, 2, 1, "", "assert_has_line_matching"], [60, 2, 1, "", "assert_output_type"]], "qiime2.util": [[61, 4, 1, "", "duplicate"], [61, 4, 1, "", "redirected_stdio"]]}, "objnames": {"0": ["py", "class", "Python class"], "1": ["py", "property", "Python property"], "2": ["py", "method", "Python method"], "3": ["py", "data", "Python data"], "4": ["py", "function", "Python function"], "5": ["py", "attribute", "Python attribute"]}, "objtypes": {"0": "py:class", "1": "py:property", "2": "py:method", "3": "py:data", "4": "py:function", "5": "py:attribute"}, "terms": {"": [0, 2, 5, 8, 9, 10, 11, 15, 16, 18, 19, 24, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 41, 43, 44, 45, 47, 49, 50, 51, 52, 53, 57, 58, 59, 60, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74], "0": [9, 11, 15, 16, 24, 30, 31, 33, 46, 49, 59, 60, 61, 65, 66, 67, 69, 72, 73], "00": 15, "001": 67, "00a294c": 18, "01": [24, 67], "03d_r": 11, "04": 15, "06": 70, "07": 15, "080381": 15, "1": [0, 11, 15, 16, 19, 24, 27, 30, 32, 33, 37, 38, 49, 59, 60, 64, 65, 66, 67, 69, 70], "10": [11, 15, 18, 19, 24, 31, 38, 59, 60, 61, 67], "100": [45, 59, 60, 68], "100014989": 24, "11": [0, 15, 18, 46, 52, 60], "1103": 15, "12": [7, 11, 15, 18, 46, 59], "13": 18, "13039": 24, "14": 66, "147": 0, "15": [42, 46, 68, 70], "16": [15, 31, 47, 68], "17": 67, "171": 66, "18": [46, 69], "184": 16, "19": 0, "195": 0, "197": 0, "1970": [0, 67], "1976": 27, "1981": 0, "1990": 0, "1u24ca248454": 24, "2": [0, 2, 4, 5, 7, 9, 11, 12, 13, 15, 16, 17, 20, 22, 26, 28, 29, 30, 31, 32, 33, 35, 36, 39, 40, 41, 43, 47, 49, 50, 51, 52, 53, 56, 57, 58, 59, 60, 61, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73], "20": [10, 15, 29, 59, 68], "2016": 18, "2017": 18, "2018": 18, "2019": [0, 18], "2021": [0, 15], "2022": 60, "2023": [0, 7, 46, 52], "2024": [2, 4, 11, 19, 31, 36, 38, 42, 44, 47, 52, 66, 67, 71, 72], "2025": 31, "207342": 24, "20px": 65, "20th": [0, 67], "20xx": 19, "21": 15, "215": 0, "21t14": 15, "22": 71, "23": [4, 44, 66, 67], "24": [18, 36], "25": [65, 68, 70], "27a5": 15, "29": 69, "2adb9": 15, "2adb9f00": 15, "2c00": 18, "2nd": 0, "3": [0, 2, 11, 15, 16, 24, 32, 45, 46, 49, 59, 60, 63, 68, 73, 74], "30": 68, "300": 37, "333fd63a2b4a102e58e364f37cd98b74": 18, "34b07e56": 15, "35": 68, "3611a0c1": 15, "37921": 24, "38": 15, "3rd": 43, "4": [0, 2, 9, 15, 24, 31, 59, 60, 66, 67, 69], "40": 68, "403": 0, "41": 67, "410": 0, "411d": 15, "414": 18, "42": [15, 60], "42b5": 15, "4308": 15, "4322": 15, "4373b96f26689f78889caeb1fbb94090": 18, "4389a0b": 18, "44": 72, "443": [0, 67], "453": [0, 67], "45c12936": 9, "469998": 15, "48": [0, 67], "484d": 9, "4886": 18, "4b60": 9, "4e2f": 15, "4f03": 15, "5": [0, 9, 11, 16, 38, 52, 59, 60, 66, 67, 68, 69], "50": 66, "5000": 11, "51": 66, "587": 15, "5a7118c14fd1bacc957ddf01e61491b7": 18, "6": [0, 15, 60, 67, 68], "610383": 15, "62c7": 15, "64": [46, 59], "66": 69, "68": 16, "684b8b7": 18, "6dada99d0c81": 18, "7": [0, 2, 15], "7a40cff7855daffa28d4082194bdf60": 18, "7zip": 10, "8": [11, 15, 18, 46, 61, 65, 67], "80": 65, "8000": 7, "81b130d538c3": 15, "85": 68, "8601": 15, "862772dbrrej": 24, "87058ae3": 15, "8dd3": 15, "9": [11, 15, 18], "90": 68, "93224813": 15, "95": 68, "98ff96bad145": 9, "999": 59, "A": [0, 2, 9, 10, 11, 15, 16, 18, 22, 24, 25, 27, 30, 32, 33, 35, 42, 45, 46, 49, 51, 53, 57, 58, 59, 60, 61, 63, 64, 66, 68, 69, 71], "And": [16, 50, 66, 68, 70, 74], "As": [4, 7, 9, 11, 15, 16, 18, 19, 27, 30, 32, 33, 36, 38, 44, 49, 52, 57, 59, 64, 65, 66, 67, 68, 69, 70, 71], "At": [5, 8, 46, 50, 57, 64, 66, 67, 68, 73], "BY": 24, "Be": 36, "But": [52, 59, 66, 67, 73], "By": [15, 27, 32, 38, 49, 50, 67, 73], "For": [2, 5, 10, 11, 12, 15, 16, 18, 24, 25, 27, 28, 29, 30, 31, 32, 36, 43, 44, 45, 46, 49, 50, 52, 61, 63, 65, 66, 67, 68, 69, 70, 72, 73], "If": [5, 9, 10, 12, 15, 16, 19, 24, 27, 29, 30, 31, 32, 35, 36, 37, 38, 40, 41, 42, 43, 44, 45, 46, 47, 49, 50, 52, 57, 58, 59, 60, 63, 64, 65, 66, 67, 68, 69, 70, 72, 73, 74], "In": [2, 5, 8, 10, 11, 15, 16, 18, 19, 25, 27, 30, 31, 32, 35, 38, 40, 45, 49, 50, 52, 57, 59, 63, 64, 65, 66, 67, 68, 69, 70, 72, 73], "It": [8, 9, 11, 12, 15, 16, 18, 22, 24, 25, 29, 30, 31, 33, 36, 44, 45, 49, 52, 57, 59, 64, 65, 66, 67, 69, 70, 74], "NOT": [30, 37], "No": [59, 66], "Not": [8, 16, 59], "Of": [16, 60], "On": [30, 66, 73], "One": [11, 16, 19, 29, 37, 60, 63, 66, 67, 68, 69, 74], "Or": [59, 67, 72], "That": [15, 16, 29, 44, 52, 65, 66, 67, 68, 69, 70, 71, 73], "Thats": 16, "The": [0, 2, 7, 8, 10, 11, 12, 14, 16, 18, 19, 24, 26, 28, 29, 31, 32, 33, 34, 35, 36, 37, 38, 40, 42, 43, 44, 45, 46, 49, 50, 51, 52, 53, 54, 57, 58, 59, 60, 61, 64, 65, 66, 67, 68, 69, 70, 71, 72, 74], "Then": [7, 8, 9, 27, 65, 66, 67, 68, 70, 73], "There": [2, 9, 10, 15, 16, 27, 29, 31, 40, 43, 45, 49, 52, 59, 60, 66, 67, 68], "These": [2, 7, 8, 9, 10, 11, 15, 16, 18, 19, 25, 28, 30, 31, 32, 34, 37, 45, 49, 52, 56, 59, 60, 63, 67, 68, 69, 70], "To": [7, 8, 10, 11, 16, 24, 27, 29, 31, 36, 42, 46, 49, 51, 52, 58, 63, 65, 66, 67, 68, 69, 70, 72, 73, 74], "WILL": 37, "Will": [22, 59], "With": [15, 18, 31, 38, 42, 64, 66], "_": [11, 27, 32, 45, 57, 66, 67, 69], "_0": 57, "_001": 11, "_1": [34, 50, 57, 66], "_2": [34, 64, 66], "_3": 66, "_4": 66, "__all__": 66, "__getitem__": 16, "__init__": [5, 18, 66], "__iter__": 53, "__release__": 60, "__repr__": 65, "__super__": 58, "__version__": [45, 57, 67], "_action": 69, "_align_and_summarize_output": 69, "_align_and_summarize_output_descript": 69, "_archiv": [9, 18], "_batch": 68, "_confirm_acgt_onli": 66, "_confirm_single_record": 66, "_create_seq_artifact": [64, 70], "_exampl": [64, 70], "_exit": 12, "_fn": 57, "_html_templat": [65, 73], "_l": 11, "_method": [66, 67, 68, 69], "_nw_align_default": 69, "_nw_align_input": 69, "_nw_align_input_descript": 69, "_nw_align_paramet": 69, "_nw_align_parameter_descript": 69, "_pipelin": [68, 73], "_r": 11, "_result": 40, "_split_seqs_default": 68, "_tabulate_las_default": 73, "_tabulate_las_paramet": 73, "_tabulate_las_parameter_descript": 73, "_test_simple1_help": 68, "_transform": [18, 64, 66], "_transform_singlerecorddnafastaformat_to_dna": 66, "_types_and_format": 66, "_validate_": [11, 39, 52, 66], "_validate_field_": 16, "_validate_n_int": 11, "_visual": [65, 73], "_ziparch": 9, "a10d5d44": 15, "a416": 15, "a692": 15, "a6d07fc80a01": 15, "a983": 15, "a_boo": 60, "a_div_vector": 49, "aaa": 67, "aaaa": 67, "aaaaaaaagg": [65, 67], "aaaaaaaaggggcctttttttt": 67, "aaaaaaaaggtggcctttttttt": [65, 67], "aaaag": 67, "aaaaggttt": 67, "aaaattt": 67, "aaccgctggcgaa": [64, 70], "aaccggttaacacccac": [65, 67], "aaccggttggccaa": [64, 70], "abbrevi": [15, 68], "abil": [39, 66], "abl": [9, 10, 11, 15, 16, 18, 27, 36, 43, 46, 47, 60, 65, 66, 67, 69, 70, 74], "about": [2, 7, 8, 10, 11, 15, 16, 27, 29, 36, 37, 44, 45, 48, 49, 50, 52, 57, 59, 63, 64, 67, 68, 70, 72, 73, 74], "abov": [7, 8, 15, 16, 18, 19, 27, 31, 32, 37, 38, 42, 45, 46, 49, 59, 65, 66, 67, 68, 69, 70], "absenc": 59, "absolut": 37, "abstract": [10, 15, 16, 22, 63, 70], "abstractli": 70, "ac92": 15, "acactcaccacccaattgct": 68, "acactctccacccatttgct": 68, "acactctccagccatttgct": 68, "accept": [2, 5, 16, 25, 32, 33, 35, 44, 49, 57, 67, 68], "access": [2, 9, 15, 22, 24, 32, 42, 45, 52, 57, 58, 59, 60, 63, 64, 65, 66, 67, 68, 69, 74], "accggt": [65, 67], "accggtaaccggttaacacccac": [64, 66, 67], "accggtggaaccgg": [65, 67], "accggtggaaccggtaacacccac": [64, 66, 67], "accident": [10, 15, 29, 59], "accomplish": [10, 24, 33], "accord": [16, 36, 49], "accordingli": 67, "account": 38, "accur": [11, 15], "accuraci": 32, "acgt": 66, "achiev": [10, 14, 29, 41, 52, 67, 68, 69, 74], "acid": [0, 67], "acknowledg": 5, "acronym": 2, "across": [15, 18, 27, 32, 52, 63, 67, 68, 69], "act": [22, 70], "actinomycetota": 73, "action": [2, 7, 8, 9, 10, 11, 14, 16, 18, 19, 26, 27, 28, 29, 33, 41, 43, 45, 49, 50, 51, 52, 54, 59, 63, 66, 68, 70, 72, 74], "action_id": [49, 60, 70], "activ": [4, 8, 15, 19, 24, 29, 31, 44, 47, 67], "actor": 8, "actual": [15, 16, 29, 30, 40, 49, 50, 60, 65, 66, 67, 68, 70, 73], "ad": [9, 11, 16, 18, 19, 27, 29, 32, 33, 35, 37, 43, 49, 59, 64, 65, 66, 67, 68, 69, 70, 71, 73], "adapt": [8, 24, 64, 66, 68, 69, 70], "add": [7, 16, 18, 19, 36, 37, 40, 42, 51, 57, 59, 72, 74], "add_plugin": 22, "addion": 70, "addison": 0, "addit": [2, 9, 10, 12, 15, 16, 19, 27, 31, 35, 36, 38, 44, 46, 49, 50, 57, 59, 63, 65, 66, 68, 70, 73, 74], "addition": [10, 12, 16, 29, 50, 70], "additon": 9, "address": [10, 19, 29, 31, 42, 65, 66, 67, 69], "adequ": 10, "adher": [32, 69], "adjust": [31, 67], "adopt": [16, 27, 52, 66, 67], "advanc": [10, 30, 31, 44], "advantag": 10, "advis": 24, "ae0d0e26da5b84a6c0722148789c51e0": 18, "ae57": 15, "afb": 15, "afford": 59, "after": [27, 29, 31, 36, 40, 46, 63, 66, 67, 68, 69, 70, 72, 73, 74], "ag": [44, 50, 60], "again": [8, 27, 30, 31, 38, 43, 63, 64, 65, 67, 68, 69, 73], "against": [31, 36, 37, 60, 66, 68], "agnost": [4, 15], "ahead": [8, 49], "aid": [19, 24], "aim": [11, 15, 19], "airplan": 59, "alabast": 15, "alert": 31, "alfr": 24, "algorithm": [15, 29, 32, 67, 68, 74], "alia": [15, 18, 59], "alias": 15, "align": [0, 2, 15, 18, 65, 69, 73], "align_and_summar": 69, "aligned_sequ": [67, 70], "aligned_sequence1": [65, 67], "aligned_sequence2": [65, 67], "alignedproteinsequ": 66, "alignedrnasequ": 66, "alignedsequ": [65, 67, 69], "all": [2, 7, 8, 9, 10, 11, 15, 16, 18, 19, 22, 24, 27, 28, 29, 30, 31, 32, 36, 38, 44, 45, 48, 49, 50, 52, 57, 58, 59, 60, 63, 65, 66, 67, 68, 69, 70, 72, 73, 74], "alloc": 12, "allot": 68, "allow": [2, 8, 9, 10, 11, 15, 16, 18, 22, 24, 27, 29, 31, 42, 45, 49, 50, 52, 57, 59, 63, 66, 67, 68, 69, 70, 73], "almost": [2, 16, 36, 73], "alon": 18, "along": [2, 19, 27, 28, 30, 42, 68, 72, 73], "alongsid": [10, 18], "alpha": [18, 25, 33, 35, 45, 49], "alpha_divers": 35, "alpha_group_signific": 35, "alphadivers": [33, 35, 49], "alreadi": [15, 16, 29, 36, 41, 42, 47, 49, 52, 66, 67, 68, 72, 73, 74], "also": [4, 8, 9, 11, 15, 16, 18, 22, 24, 29, 30, 31, 36, 38, 44, 47, 49, 50, 52, 57, 58, 59, 63, 64, 65, 66, 67, 68, 69, 70, 72, 73, 74], "alter": 2, "altern": [10, 42, 61, 67, 68, 69], "although": [11, 50], "altschul": 0, "alwai": [8, 9, 11, 12, 15, 16, 31, 50, 59, 60, 63, 64, 65, 66, 67, 68, 69], "am": [27, 70], "ambigu": [2, 59, 66], "amino": [0, 67], "among": [15, 66], "amongst": 50, "amount": [8, 14, 68], "ampl": [19, 31], "amplicon": [2, 7, 31, 36, 38, 42, 50], "an": [0, 2, 4, 8, 10, 11, 12, 13, 15, 17, 18, 19, 22, 24, 27, 28, 29, 31, 32, 33, 34, 35, 36, 37, 41, 42, 43, 48, 49, 50, 52, 53, 54, 57, 58, 59, 60, 63, 64, 68, 70, 72], "an_input_filepath": 52, "an_output_filepath": 52, "anaconda": 45, "analys": [15, 70], "analysi": [2, 10, 15, 25, 32, 35, 53, 67], "analyt": [35, 66], "analyz": [44, 68], "anatomi": [10, 13, 15, 17], "ancestor": [9, 18], "ancestor_uuid": 18, "ancestr": [2, 9, 67], "andrew": 0, "angl": 8, "angri": 67, "ani": [2, 7, 8, 9, 10, 11, 12, 15, 16, 19, 24, 25, 27, 28, 30, 31, 32, 36, 37, 42, 45, 46, 49, 50, 57, 58, 59, 63, 64, 65, 66, 67, 68, 69, 70, 72, 73], "anniversari": [0, 67], "annot": [2, 16, 28, 30, 32, 33, 34, 35, 49, 50, 57, 67, 68], "announc": [19, 44], "anoth": [2, 9, 10, 11, 12, 16, 25, 27, 34, 44, 47, 50, 59, 65, 66, 68, 69, 70, 73], "answer": [12, 36, 42, 47, 72], "anti": [11, 51, 62, 66], "antipattern": 67, "anual": 19, "anyon": [4, 16, 19, 66], "anyth": [10, 12, 16, 24, 27, 29, 30, 31, 32, 35, 40, 49, 59, 60, 65, 66, 67, 68, 70, 73], "anytim": 31, "anywai": 16, "anywher": [16, 45, 50, 69], "api": [2, 5, 8, 14, 15, 16, 19, 21, 23, 24, 31, 32, 33, 45, 49, 51, 52, 54, 58, 60, 62, 64, 65, 66, 69, 74], "app": 52, "appar": 68, "appear": [15, 16, 52, 67, 68], "append": [33, 68], "appl": [16, 46, 59], "appli": [0, 2, 27, 29, 32, 33, 52, 57, 63, 64, 67, 69, 73, 74], "applic": [0, 32, 46, 63, 67, 69, 70, 73, 74], "approach": [4, 7, 10, 15, 24, 38, 42, 43, 44, 52, 66, 68, 74], "appropri": [9, 12, 18, 28, 29, 33, 45, 49, 54, 67], "approv": [4, 19], "april": [4, 19, 31, 36, 44, 66], "apt": 27, "aptli": 9, "ar": [2, 4, 5, 7, 8, 9, 10, 11, 12, 14, 15, 16, 18, 19, 22, 24, 25, 27, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 52, 56, 57, 59, 60, 61, 63, 64, 65, 66, 67, 68, 69, 70, 72, 73, 74], "arbitrari": [15, 52, 57, 59, 66, 68, 73], "arbitrarili": 2, "arbitrary_kei": 59, "architectur": [4, 13, 17], "archiv": [2, 8, 10, 11, 13, 15, 17, 20, 24, 29], "archiveformat": 18, "area": 4, "aren": [11, 16, 18, 52, 67], "arg": [16, 40, 66, 67], "argument": [8, 16, 18, 30, 49, 52, 54, 57, 59, 60, 66, 69], "argumentless": 57, "aris": [16, 29, 31, 66], "aritfact": 64, "around": [10, 27, 30, 31, 47, 60, 67, 68], "arrai": [10, 49], "arrow": [8, 18], "art": 10, "articl": [27, 29, 44, 53, 66, 67, 70], "artifact": [2, 8, 9, 10, 11, 12, 14, 15, 16, 18, 22, 25, 26, 27, 28, 32, 33, 34, 35, 41, 42, 43, 49, 51, 52, 54, 57, 59, 60, 63, 64, 65, 67, 68, 69, 70, 72, 73, 74], "artifact_collect": 60, "artifact_for_md": 60, "artifact_format": 57, "artifactapiusag": [49, 70], "artifactclass": 66, "arvum": 73, "arxiv": 44, "ask": [16, 36, 42, 44], "aspect": [10, 14, 15, 17, 48, 66, 67], "assembl": 67, "assert": [16, 49, 58], "assert_frame_equ": 68, "assert_has_line_match": [49, 60], "assert_no_nans_in_t": 58, "assert_output_typ": [49, 60], "assertequ": [64, 66, 67], "assertin": [65, 68], "assertionerror": 60, "assertnotequ": 67, "assertraisesregex": 66, "assertregisteredsemantictyp": [58, 66], "assertsemantictyperegisteredtoformat": 58, "assess": 70, "asset": [9, 45, 46, 58], "assign": [15, 16, 18, 19, 29, 49, 50, 59, 67, 69, 70], "assist": [19, 27, 38, 42, 46], "associ": [2, 7, 15, 16, 18, 27, 28, 29, 38, 45, 52, 57, 59, 60, 63, 64, 66, 67, 68, 69, 70, 72, 73], "assum": [10, 31, 36, 38, 52, 63, 67], "assur": 59, "ast": 22, "astut": 11, "asynchron": 8, "atom": 37, "attach": 16, "attempt": [49, 50, 66, 67], "attent": [19, 36], "attribut": [22, 30, 58, 68], "attt": 67, "audienc": 8, "august": [31, 42, 47, 71], "auth": 36, "authent": 36, "author": [5, 24, 44, 60, 67, 69], "authorit": 69, "auto": 59, "autodoc": 5, "autom": [7, 27, 41, 47, 49, 51, 66, 74], "automat": [12, 15, 16, 32, 33, 35, 37, 53, 54, 57, 66, 69, 70], "avail": [2, 8, 9, 11, 24, 29, 38, 42, 43, 49, 50, 54, 56, 60, 61, 66, 67, 68, 69, 70, 73], "avoid": [7, 16, 29, 42, 43, 45, 49, 52, 66, 67, 70, 74], "awai": [16, 52, 57, 66], "awar": [16, 19, 29, 38, 47, 52, 54, 66, 68, 73], "ax": 59, "b": [0, 16, 59, 60, 67], "b733": 18, "bacillota": 73, "bacillus_a": 73, "back": [10, 15, 16, 31, 52, 61, 63, 64, 65, 66, 67, 69, 70, 71, 72, 74], "backfir": 44, "background": [66, 67], "backlog": 19, "backward": [9, 30, 43, 74], "bacteri": 29, "bacteria": 73, "bad": [52, 66], "baerheim1994effect": 57, "bag": 16, "bail": 11, "balanc": 19, "banana": [16, 59], "bandwidth": 19, "bar": [30, 37, 57, 59, 60], "bar1": 60, "bar2": 60, "bar3": 60, "bar4": 60, "bar5": 60, "bar6": 60, "bar7": 60, "barcod": [11, 50], "barcode_id": 11, "base": [2, 4, 10, 11, 14, 19, 22, 27, 28, 29, 31, 41, 42, 47, 50, 51, 52, 57, 59, 63, 65, 66, 67, 68, 70], "basetyp": 57, "basi": [19, 29, 31, 67], "basic": [0, 11, 15, 16, 30, 31, 38, 49, 66, 67], "baz": 59, "bbe1": 9, "bdc8a": 18, "beauti": 4, "becaus": [2, 8, 9, 10, 11, 12, 15, 16, 18, 27, 29, 31, 38, 40, 49, 52, 63, 64, 65, 66, 67, 68, 69, 70, 73], "becom": [8, 11, 12, 16, 28, 31, 57, 59, 66, 68, 70], "been": [9, 16, 18, 19, 24, 27, 28, 30, 36, 42, 52, 63, 66, 67, 68, 69, 72, 74], "befor": [7, 8, 16, 19, 29, 31, 40, 41, 42, 43, 45, 49, 50, 64, 65, 66, 67, 68, 69, 70, 73, 74], "begin": [19, 28, 44, 47, 63, 66, 67, 69, 74], "behav": 73, "behavior": [2, 8, 33, 49, 50, 57, 59, 67, 68, 69], "behind": [15, 16, 19, 64, 69], "being": [5, 10, 12, 15, 16, 18, 19, 29, 32, 38, 40, 43, 50, 52, 63, 66, 67], "believ": 10, "belong": 16, "below": [8, 9, 15, 18, 19, 30, 31, 38, 45, 60, 63, 66], "benchmark": 47, "benefici": 31, "benefit": [15, 52, 66, 68, 70], "best": [16, 52, 59, 66, 67, 68], "beta": [28, 32, 33, 45], "beta_phylogenet": [28, 32], "beta_result": 33, "better": [8, 10, 12, 15, 16, 19, 29, 46, 57, 64, 66], "between": [2, 4, 7, 8, 9, 10, 11, 15, 16, 18, 19, 22, 28, 29, 31, 32, 33, 41, 51, 52, 59, 64, 66, 68, 73], "beyond": 49, "bi": 19, "bib": [15, 18, 32, 45, 67], "bibtex": [15, 27, 32, 45, 53, 67], "bibtext": 67, "big": [52, 68, 70], "bigger": [45, 65], "binaryfileformat": [2, 11, 55, 57], "bio": [65, 66, 67], "bioconda": [31, 38], "bioinformat": [0, 2, 66, 67, 68, 73, 74], "biol": 0, "biolog": [2, 11], "biologi": [44, 67], "biom": [11, 27, 28, 29, 49, 67], "biomv210dirfmt": 9, "biopython": 66, "birthdai": 16, "bit": [11, 16, 31, 45, 59, 65, 66, 67, 68, 69], "blame": 52, "blank": [16, 59, 63], "blast": [67, 68], "blith": 16, "blob": 46, "block": [40, 49, 66, 68, 69, 73], "blue": [15, 18], "blur": 7, "board": 19, "bodi": [50, 65, 66], "bolyen": [0, 5, 24], "book": [24, 27, 33, 67, 70], "bool": [16, 30, 57, 58, 59, 63], "bool_dict": 30, "bool_list": 30, "boolean": [16, 59, 60, 67], "bore": 66, "both": [8, 11, 15, 16, 29, 37, 43, 45, 49, 59, 66, 67, 68, 69, 70], "bother": 70, "bottleneck": 4, "bottom": [8, 15, 66, 67, 70], "bound": [16, 59], "boundari": 67, "bowtie2index": 66, "box": [8, 15, 18, 52, 69], "brackendb": 66, "bracket": [8, 31, 38], "brai": 33, "branch": [7, 19, 31, 37, 38, 59], "bray_curtis_distance_matrix": 33, "bray_curtis_emperor": 33, "bray_curtis_pcoa_result": 33, "braycurti": 33, "break": [9, 11, 16, 27, 70], "breviti": 8, "brief": [37, 44, 45, 66, 67, 73], "briefli": [48, 66, 67, 68], "bring": [15, 16, 67], "broad": [16, 59], "broadli": [52, 56, 70], "broken": [15, 24, 70], "browser": [2, 7, 36, 52], "bsd": [24, 67], "bug": [15, 19, 52, 69], "buggi": 52, "bui": 44, "build": [4, 7, 16, 24, 27, 31, 41, 42, 51, 52, 56, 66, 67, 68, 69, 72], "built": [7, 8, 10, 16, 24, 27, 41, 44, 52, 63, 65, 66, 67, 69, 73], "bump": 19, "bunch": [42, 65, 67], "bundl": 16, "burn": 52, "busi": [11, 44, 52], "bytesio": 61, "c": [0, 16, 52, 59, 60, 67], "c1": 59, "c9811bcaa3e6": 15, "cach": [7, 49, 65, 66, 67, 69, 73], "cake": 16, "calcul": [25, 45], "call": [8, 9, 10, 11, 12, 16, 22, 27, 28, 29, 30, 32, 33, 34, 35, 40, 45, 49, 50, 52, 57, 58, 60, 61, 65, 66, 68, 69, 70, 72, 73], "callabl": [54, 57, 60], "came": 49, "can": [2, 4, 5, 7, 8, 9, 10, 11, 12, 15, 16, 18, 19, 24, 25, 27, 28, 29, 30, 31, 32, 33, 35, 36, 37, 38, 39, 42, 44, 45, 46, 47, 48, 52, 53, 57, 58, 59, 60, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74], "cancer": [7, 24], "cannot": [2, 8, 16, 25, 35, 61, 63], "canon": [24, 60], "cap": 19, "capabl": [2, 11], "capit": 16, "caporaso": [0, 5, 19, 24, 38, 42, 64, 65, 66, 67, 68, 69, 70, 72, 73], "captur": [9, 18, 42, 49, 74], "care": [8, 15, 28, 29, 49, 68], "carri": [10, 16, 29, 57], "casava": 11, "casavaoneeightsinglelanepersampledirfmt": 11, "case": [2, 5, 8, 9, 11, 12, 15, 16, 27, 29, 30, 32, 38, 42, 46, 49, 50, 52, 59, 60, 63, 65, 66, 67, 68, 69, 70, 72, 73], "cast": [50, 63, 70], "cat": [59, 67], "cat1": 18, "catch": [19, 31], "categor": [16, 59, 63], "categori": [16, 19, 44, 47], "categorical_md_col": 50, "categoricalmetadatacolumn": [50, 63], "caught": 40, "caus": [8, 59], "caveat": [42, 74], "cc": 24, "cd": [7, 46], "cd4015db31da": 15, "cell": 50, "central": [2, 15, 47, 50, 64], "certain": [5, 10, 63, 69], "certainli": [2, 36], "chain": [15, 64, 66, 69], "chalk": 16, "challeng": [10, 66], "chan": 24, "chang": [2, 4, 7, 8, 18, 19, 24, 27, 30, 31, 36, 43, 44, 46, 49, 52, 57, 60, 65, 66, 67, 68, 69, 70, 72, 74], "changelog": [18, 19], "channel": [31, 38], "chapter": [2, 24, 30, 41, 67, 68, 69, 73], "charact": [37, 45, 59, 63, 65, 66, 67], "characterist": [15, 18], "charset": 65, "chart": 68, "check": [8, 9, 11, 18, 29, 44, 46, 49, 50, 58, 60, 64, 65, 66, 67, 68, 70, 72], "checkbox": [16, 67], "checksum": 18, "chef": 16, "child": 12, "chloe": 0, "choic": [28, 29, 32, 36, 44, 59, 69], "choos": [10, 12, 15, 29, 43, 47, 50, 68], "chose": [15, 67, 73], "christian": 67, "christoph": 0, "ci": [19, 46], "circl": [15, 16, 64], "circular": 43, "circumst": 52, "circumv": 52, "citabl": 44, "citat": [10, 15, 18, 32, 33, 35, 45, 51, 52, 56, 57, 62, 65, 69, 70, 72], "citation_text": 57, "citationrecord": [53, 57], "citatonrecord": 57, "cite": [2, 3, 9, 15, 18, 44, 67], "clang": 15, "clarifi": [10, 16], "class": [2, 10, 11, 15, 16, 18, 22, 26, 28, 30, 32, 34, 42, 43, 48, 49, 50, 51, 52, 53, 55, 57, 58, 59, 60, 64, 65, 67, 68, 69, 70, 73, 74], "classmethod": [53, 63], "claus": [24, 63], "clean": [12, 27, 54], "cleaner": 49, "cleanup": [12, 54], "clear": [37, 44, 67], "cleric": 15, "clever": [49, 57], "cli": 15, "click": [15, 67], "client": [15, 27], "clinic": [52, 67], "clone": [7, 46], "close": [9, 10, 16, 42, 63, 66], "closest": 73, "clunki": [49, 65, 66, 67], "cluster": [29, 68], "co": 44, "code": [2, 5, 7, 8, 9, 11, 15, 18, 19, 22, 27, 28, 31, 37, 40, 42, 45, 49, 50, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74], "coerc": [28, 59], "cogniz": 42, "cohes": 2, "colin": 0, "colleagu": 15, "collect": [2, 13, 15, 16, 17, 18, 22, 33, 41, 49, 51, 53, 57, 63, 66, 67, 68], "collection_1": 60, "collection_2": 60, "collector": 12, "collis": 43, "color": 65, "column": [8, 16, 59, 60, 68, 73], "column_a": 60, "column_count": 63, "column_missing_schem": 63, "column_nam": 60, "column_ord": 73, "column_typ": [50, 63], "columnar": 2, "columnproperti": [59, 63], "com": [7, 15, 18, 31, 38, 45, 46], "combin": [2, 10, 11, 15, 16, 25, 32, 33, 35, 40, 49, 58], "combinator": 16, "combine_act": 68, "combine_las_report": 68, "come": [16, 25, 28, 29, 37, 47, 52, 59, 64, 66, 67, 70, 71, 72, 73, 74], "comfort": [41, 46, 68, 72, 74], "comma": 69, "command": [2, 7, 15, 16, 25, 27, 29, 32, 36, 38, 42, 45, 46, 49, 52, 66, 67, 69, 72, 73, 74], "comment": [60, 63], "commentari": 60, "commerci": 24, "commit": [18, 19, 27, 31, 36, 37, 43, 66, 68, 70, 72], "common": [0, 2, 9, 10, 11, 15, 16, 18, 22, 28, 49, 52, 57, 66, 67, 69, 73], "commonli": [29, 50, 56, 67], "commun": [2, 8, 19, 24, 31, 37, 45, 47, 60, 69, 70], "compabl": 43, "compar": [8, 35, 57, 65, 66, 67, 69], "comparison": 35, "compat": [8, 9, 10, 22, 31, 37, 38, 41, 45, 51, 52, 59], "complet": [7, 8, 10, 15, 16, 19, 24, 29, 34, 36, 40, 42, 45, 57, 65, 66, 67, 68, 69, 70, 72, 74], "complex": [9, 15, 16, 45, 49, 65, 68], "compliant": 37, "complic": 73, "compon": [11, 18, 24, 27], "compos": [10, 11, 42, 59, 63, 69], "composit": [10, 15, 16, 38, 59], "compound": 16, "comprehens": 16, "compromis": [15, 16], "comput": [0, 2, 7, 10, 15, 16, 29, 32, 33, 36, 40, 49, 50, 51, 52, 66, 69, 70, 72, 74], "computation": 69, "concat": 68, "concaten": 68, "concept": [29, 67], "conceptu": [19, 59, 66], "concern": [8, 15, 24, 29, 32, 66, 67], "concis": 16, "conclud": 29, "conclus": [51, 74], "concret": [16, 50, 57, 61, 63], "concurr": 43, "conda": [2, 15, 31, 36, 37, 38, 42, 49], "conda_subdir": 46, "condit": [58, 67], "confid": 52, "config": 46, "configur": [9, 11, 27, 47, 68, 69], "confirm": [7, 36, 44, 49, 64, 66, 67, 68, 70, 73], "conflict": [10, 31, 42], "confound": 12, "confus": [10, 29, 31], "congratul": 72, "connect": [45, 57], "consensu": 16, "consequ": [16, 59], "consid": [2, 10, 11, 15, 16, 18, 27, 42, 52, 59, 63, 66, 67, 68, 69], "consider": [16, 43, 63, 68], "consist": [9, 18, 50, 59, 63], "constrain": [16, 59], "constraint": [8, 10, 36], "construct": [8, 11, 14, 16, 22, 42, 59, 63], "construct_artifact_collect": 60, "constructor": 60, "consum": [50, 52], "consumm": [15, 67], "consumpt": [2, 67], "contain": [2, 8, 9, 10, 11, 15, 16, 19, 24, 27, 29, 30, 32, 33, 35, 37, 45, 50, 52, 53, 57, 60, 63, 66, 67, 70, 72, 73, 74], "content": [2, 4, 7, 9, 15, 29, 30, 38, 49, 63, 65, 66, 67, 71], "context": [2, 12, 15, 16, 27, 38, 45, 46, 51, 56, 57, 61, 62, 66, 68, 69, 70], "contigu": 59, "continu": [19, 27, 36, 52, 66, 68, 72], "contract": 32, "contraint": 10, "contrast": [2, 9, 15, 25], "contribut": [5, 15, 19], "contributor": 5, "control": [27, 66, 68, 69, 72], "convei": 67, "conveni": [9, 10, 16, 18, 27, 50, 52, 57, 58, 64, 65, 66], "convent": [27, 34, 45, 49, 59, 66, 67, 69, 70, 73], "convers": 28, "converst": 64, "convert": [2, 8, 10, 22, 28, 34, 57, 60, 61, 63, 64, 66, 73], "convinc": [67, 70], "cook": 16, "cookiecutt": [24, 27, 71], "cool": [27, 36, 44, 50, 52, 57, 64, 67, 68], "cool_project": 50, "coordin": [2, 8, 32], "copi": [64, 67, 72], "copyfil": 61, "copyright": 67, "core": [9, 12, 14, 15, 16, 18, 33, 50, 59, 60, 61, 67, 68], "core_metr": 33, "core_metrics_phylogenet": 15, "correct": [15, 49, 52], "correctli": [52, 65], "correspond": [30, 32, 38, 59, 63, 66, 67, 73], "corrupt": 11, "cost": [16, 52], "costli": 52, "could": [10, 15, 16, 25, 29, 30, 32, 38, 44, 45, 49, 52, 57, 59, 65, 66, 67, 68, 70, 73], "couldn": [15, 52], "count": [29, 32, 65], "counter": 67, "counterpart": 16, "counterproduct": 52, "coupl": [8, 31, 52, 64, 66, 67], "courier": 65, "cours": [16, 31, 47, 67, 69], "cover": [7, 24, 45, 49], "cpu": 59, "crash": [40, 52], "creat": [4, 7, 9, 11, 12, 15, 16, 24, 27, 29, 30, 31, 36, 37, 38, 41, 42, 43, 44, 45, 46, 49, 50, 51, 52, 54, 57, 58, 59, 60, 63, 64, 65, 66, 67, 70, 71, 73, 74], "creation": [10, 15, 68], "creator": 66, "credit": 70, "criteria": [47, 63], "critic": [2, 69], "cron": 31, "cross": [7, 15, 52], "crude": 65, "cryptosporangium": 73, "csvdirformat": 57, "csvformat": 57, "ctx": [33, 54, 56, 57, 68, 69], "curiou": 49, "current": [4, 9, 11, 12, 15, 16, 18, 19, 24, 30, 31, 36, 38, 42, 44, 46, 49, 61, 63], "curti": 33, "custom": [4, 15, 18, 31, 72], "custom_ax": 15, "cut": 16, "cutadapt": [43, 50], "cutleri": 16, "cycl": [17, 20, 38], "czi": 24, "d": [0, 5, 24, 27, 31, 32, 42, 45, 65, 66, 67, 69, 70, 72], "d_001": 11, "dada2": [15, 43], "daf": 24, "daf2019": 24, "dag": 15, "dai": 24, "daniel": [0, 74], "darn": 36, "dash": [8, 45], "data": [2, 7, 8, 11, 12, 13, 16, 17, 18, 26, 28, 32, 34, 44, 50, 51, 52, 57, 58, 59, 60, 61, 63, 65, 66, 67, 68, 72, 74], "databas": 68, "datafram": [29, 50, 52, 57, 59, 60, 63, 68, 69, 73], "dataset": [7, 32], "date": [19, 24, 31, 37], "datetim": 15, "david": 0, "de": 30, "deadlin": 19, "deal": [7, 16, 64], "debug": 31, "decemb": 52, "decentr": [10, 13, 17, 18], "decid": [8, 52, 59, 67, 69], "decis": [10, 16, 29, 68], "declar": [11, 29], "decor": [14, 16, 34, 57, 66], "decoupl": 8, "decreas": 68, "dedic": 49, "deep": [12, 15, 16], "def": [11, 28, 30, 32, 33, 34, 35, 49, 50, 52, 57, 60, 64, 65, 66, 67, 68, 69, 70, 73], "default": [15, 27, 31, 32, 36, 38, 50, 53, 57, 58, 60, 63, 66, 67, 68, 69, 70, 72], "default_missing_schem": 63, "defer": [8, 60], "defin": [2, 5, 8, 10, 11, 15, 18, 19, 22, 25, 27, 28, 29, 30, 31, 32, 33, 34, 35, 38, 41, 42, 46, 50, 51, 52, 57, 58, 59, 60, 63, 65, 69, 73, 74], "definit": [11, 16, 25, 30, 35, 49, 58, 66, 67, 68, 70], "defunct": 57, "degre": 32, "delai": 29, "delet": [64, 67, 72], "deliber": 58, "deliv": 10, "deliver": 19, "demonstr": [10, 57, 60, 67, 72], "demultiplex": [11, 29], "demultiplexed_seq": 18, "demutiplex": 66, "demux": 50, "denot": [2, 8], "dep": 19, "depend": [2, 8, 9, 15, 18, 19, 29, 31, 36, 38, 42, 45, 46, 49, 50, 66, 68, 69], "deploi": [43, 70], "deploy": [2, 29, 42, 43, 64, 69, 72], "deprec": [19, 24, 57, 59], "depth": 25, "deriv": [2, 24, 67], "descend": 68, "describ": [2, 4, 8, 9, 10, 11, 15, 16, 18, 27, 29, 31, 32, 33, 35, 45, 46, 49, 52, 60, 63, 64, 65, 66, 67, 68, 69, 70], "descript": [8, 9, 10, 15, 30, 32, 33, 35, 37, 45, 52, 57, 63, 64, 65, 66, 67, 69, 73], "descriptor": [14, 16, 43, 61], "design": [9, 10, 19, 28, 31, 63, 64, 68, 69], "desir": 60, "destin": [10, 28, 30, 61], "destroi": 12, "destruct": 12, "destructor": 12, "detail": [2, 4, 9, 10, 15, 16, 18, 30, 32, 34, 37, 39, 45, 49, 50, 56, 63, 66, 67, 68], "detect": [29, 66], "determin": [9, 10, 15, 16, 19, 27, 28, 32, 50, 63, 65, 67, 68], "dev": [19, 24, 27, 31, 46, 49, 65, 66, 67, 69, 73], "dev0": 46, "develop": [2, 7, 8, 10, 11, 15, 18, 20, 23, 27, 29, 31, 34, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 47, 49, 50, 57, 58, 62, 63, 64, 65, 67, 68, 69, 70, 71, 72, 73, 74], "devic": 65, "df": [50, 60, 66], "diagram": [18, 19], "dialog": [16, 52], "diataxi": [0, 70], "dict": [22, 30, 53, 57, 59, 60, 63, 67, 68, 69], "dict_of_int": 60, "dictat": [59, 60], "dictionari": [22, 30, 32, 45, 49, 57, 59, 68, 69, 70, 73], "did": [64, 66, 67, 68, 69, 73], "didn": [2, 16, 40, 65, 67], "diff": 66, "differ": [2, 7, 9, 10, 11, 15, 16, 18, 22, 24, 29, 31, 32, 35, 38, 41, 45, 46, 51, 52, 60, 63, 64, 65, 66, 67, 68, 69, 70, 72], "differec": 52, "differenti": [11, 16, 18, 68, 73], "difficult": [10, 12, 29, 38], "digress": 66, "dillon": 0, "dimens": 32, "dine": 16, "dir": [58, 67, 72], "direct": [8, 15, 16, 31, 47, 74], "directli": [8, 10, 12, 15, 18, 22, 27, 28, 29, 30, 32, 34, 49, 50, 59, 64, 66, 67, 69, 73], "directori": [2, 9, 10, 12, 13, 15, 17, 18, 27, 29, 30, 31, 36, 37, 38, 46, 49, 57, 60, 65, 67, 69, 70, 72], "directory_format": [14, 57], "directoryformat": [2, 11, 55, 57, 66], "disabl": 66, "disambigu": 29, "disassoci": 15, "discontinu": 59, "discourag": 9, "discours": 47, "discov": [15, 29, 31, 36, 44, 67, 70], "discoveri": [29, 52], "discret": 2, "discuss": [4, 7, 10, 15, 16, 19, 24, 27, 29, 31, 39, 42, 52, 66, 67, 70, 71], "disk": [2, 10, 11, 29, 30, 60, 63, 66], "dispatch": [9, 16, 18], "displai": [15, 27, 45, 49, 60, 65, 67, 72], "disregard": 49, "dissemin": 70, "distanc": [32, 33, 50, 66], "distance_matrix": [28, 32, 33], "distancematrix": [28, 32, 33, 34, 66], "distinct": [15, 16, 33, 57, 59, 67, 73], "distinguish": [2, 10, 16, 59], "distribut": [2, 7, 15, 19, 24, 31, 41, 45, 50, 51, 52, 67, 68, 72], "distro": [19, 37], "dive": [15, 16], "divers": [15, 25, 32, 33, 35, 43, 45, 49, 69], "diversity_lib": 49, "divid": 68, "di\u00e1taxi": [0, 24, 74], "dm": 33, "dna": [2, 11, 65, 66, 67, 68, 69, 70], "dnafastaformat": [11, 67], "dnaiter": [18, 66, 67, 68], "dnasequencesdirectoryformat": [11, 18], "do": [7, 10, 15, 16, 18, 19, 24, 27, 28, 30, 32, 33, 34, 35, 36, 37, 40, 42, 45, 47, 49, 50, 52, 57, 59, 60, 64, 65, 66, 67, 68, 69, 70, 71, 73, 74], "doc": [7, 19, 24, 37, 60, 63, 70], "docstr": [63, 67], "doctyp": 65, "document": [0, 6, 8, 10, 15, 16, 17, 18, 19, 24, 27, 29, 30, 36, 37, 41, 42, 45, 47, 48, 49, 52, 57, 60, 61, 63, 67, 70, 72, 74], "documentat": 70, "docx": 10, "doe": [2, 8, 9, 10, 12, 15, 16, 24, 25, 27, 30, 32, 35, 37, 44, 49, 57, 58, 59, 61, 63, 66, 67, 68, 69, 70], "doen": 9, "doesn": [11, 15, 16, 19, 27, 29, 32, 42, 44, 46, 48, 63, 65, 66, 67, 68, 69, 70], "doi": [24, 44], "domain": [8, 16, 43, 57, 59], "don": [2, 4, 7, 10, 16, 19, 27, 31, 34, 36, 38, 44, 49, 52, 64, 65, 66, 67, 69, 70, 71, 72, 73], "done": [7, 8, 15, 29, 31, 32, 36, 42, 45, 53, 60, 66, 67, 68, 69, 70, 73], "dot": 8, "doubl": 59, "doubt": 44, "down": [15, 16, 66], "download": [15, 46, 52, 60, 72], "downstream": [31, 52, 73], "dozen": 16, "dr": 2, "draft": 42, "drill": 15, "driven": [2, 67], "driver": [7, 49, 57, 60, 70], "drop": 63, "drop_all_miss": 63, "drop_all_uniqu": 63, "drop_missing_valu": [50, 63], "drop_zero_vari": 63, "dropdown": 16, "dry": [2, 69, 73], "dst": 61, "dtype": 63, "due": [10, 30, 31, 68], "dull": 16, "dull_par": 16, "dummi": 52, "dummy_output": 52, "dummy_plugin": [30, 60], "dump": 16, "duplic": [9, 15, 61, 70, 72, 73], "duplicate_t": [29, 67], "durat": 15, "dure": [7, 15, 36, 45, 49, 52, 57, 60, 66, 67, 69], "dwq2": [4, 24, 29, 38, 45, 64, 65, 66, 67, 68, 69, 70, 72, 73], "dwq2_action": 70, "dynam": [8, 12], "e": [0, 2, 7, 9, 10, 11, 12, 15, 18, 19, 22, 24, 27, 29, 30, 31, 32, 33, 35, 36, 37, 38, 42, 43, 44, 45, 49, 50, 52, 53, 57, 59, 60, 61, 63, 65, 66, 67, 68, 69, 70, 72, 74], "e072706": 18, "e1011676": 0, "e168": 15, "e5c5": 15, "each": [8, 9, 10, 15, 16, 18, 19, 24, 27, 29, 31, 32, 33, 37, 38, 42, 49, 50, 57, 59, 60, 63, 65, 66, 67, 69, 70, 74], "earli": [4, 74], "earlier": [16, 30, 66, 67, 69], "eas": [10, 15], "easi": [9, 16, 49, 66, 67, 69], "easier": [15, 16, 18, 36, 38, 42, 64, 66, 67], "easiest": [38, 49, 71, 72], "easili": [15, 27, 29, 70], "eat": 16, "ebb5968ebafb": 15, "ecosystem": [19, 31, 47, 66], "ed": 59, "ed5d": 15, "edg": 67, "edit": [0, 7, 27, 40, 52, 66, 67], "editor": 27, "effect": [8, 15, 59, 68], "effici": [29, 66], "effort": [8, 15, 52], "eigendecomposit": 32, "eigenvalu": 32, "eigenvector": 32, "eigh": 32, "either": [2, 8, 16, 19, 29, 31, 36, 42, 52, 59, 63, 66, 67, 68, 69, 72], "element": [15, 16, 45, 50, 59, 60], "elev": 50, "elig": [47, 50], "elizabeth": 0, "els": [10, 27, 29, 30, 49, 66, 69], "elsevi": 67, "elsewher": [52, 69], "email": [15, 47], "emp": 50, "emperor": [15, 33, 45], "emperor_plot": 33, "emploi": [43, 65], "emppairedenddirfmt": 11, "empti": [27, 30, 52, 57, 59], "en": 65, "enabl": [2, 9, 10, 15, 27, 36, 40, 44, 49, 50, 64, 65, 66, 67, 68, 69, 70, 73], "enclos": 38, "encod": [9, 10, 63], "encode_miss": 63, "encount": [42, 66, 68], "encourag": [47, 57, 73], "end": [8, 15, 30, 44, 45, 59, 65, 66, 67, 69, 71, 72, 74], "endnot": 67, "energi": 68, "enforc": [16, 59, 63], "engin": [2, 19, 52, 67, 69], "enough": [9, 16, 49, 68], "ensur": [9, 11, 12, 31, 46, 49, 50, 52, 58, 65, 66, 67, 68, 70], "entir": [8, 9, 11, 12, 16, 38, 50, 57, 65, 69], "entireti": [66, 68], "entiti": [5, 10, 66], "entri": [2, 8, 27, 52, 53, 57, 59], "entry_point": [27, 45], "enumer": [8, 11, 30, 59, 68], "env": [31, 38, 46, 67], "environ": [2, 7, 10, 18, 19, 31, 36, 37, 38, 41, 42, 49, 51, 66, 67, 70, 72, 73], "environment": 67, "epeat": 69, "epoch": [31, 37, 38, 60], "epub": 10, "equal": [11, 16, 68], "equenc": 67, "equival": [7, 22, 59, 69], "erron": 69, "error": [10, 11, 29, 52, 60, 63, 66, 67, 73], "especi": [29, 72], "essenti": [16, 30, 45, 52, 57, 59, 66], "establish": 43, "etc": [11, 15, 16, 18, 19, 32, 45, 50], "euclidean": 50, "eval": 14, "evalu": [16, 60], "evan": [0, 5, 16, 24], "evelop": 24, "even": [10, 15, 16, 27, 29, 33, 42, 49, 52, 65, 66, 67, 68], "evenness_vector": 33, "event": [15, 31, 59, 60, 67], "eventu": 40, "ever": [15, 16, 27, 35, 59, 64, 73], "everi": [9, 10, 11, 15, 35, 57, 59, 63, 67, 69, 70, 74], "everyon": [16, 19, 44, 52], "everyth": [29, 46, 49, 52, 56, 64, 65, 66, 67, 68, 72], "everywher": 14, "evid": 68, "evil": 11, "evolut": 67, "evolv": [9, 18], "exact": 32, "exactli": [2, 10, 15, 25, 35, 49, 63, 64, 66, 67, 73], "examin": 28, "exampl": [2, 4, 7, 8, 9, 11, 12, 16, 18, 19, 24, 25, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 40, 41, 43, 44, 45, 46, 50, 51, 52, 56, 57, 58, 59, 61, 62, 63, 64, 65, 66, 67, 68, 69, 71, 72, 74], "example1": 57, "example2": 57, "example_funct": 30, "example_function_variant1": 57, "example_function_variant2": 57, "excacerb": 12, "except": [11, 12, 15, 16, 33, 35, 41, 44, 51, 59, 65, 66, 67, 69], "excit": [50, 70], "exclud": [16, 27, 45, 59], "exclus": [43, 49, 58, 59, 69], "execut": [2, 8, 32, 49, 57, 58, 60, 67, 68, 69, 70, 72, 74], "execute_exampl": [49, 58, 70], "executionusag": 49, "executionusagevari": 60, "exemplifi": 29, "exercis": 68, "exist": [2, 4, 10, 11, 15, 16, 19, 27, 29, 30, 32, 36, 40, 41, 43, 47, 50, 51, 52, 57, 59, 60, 61, 66, 67, 68, 72], "exit": [12, 22, 29, 40, 67, 72], "exp": 49, "exp_format": 58, "expand": [4, 7, 15, 57, 65, 74], "expect": [7, 10, 11, 16, 22, 24, 29, 30, 32, 35, 42, 44, 46, 49, 52, 58, 64, 65, 66, 67, 68, 70, 72], "expected_hit": 68, "expens": 69, "experi": [15, 44, 46, 68, 70], "experienc": [27, 42], "expert": 47, "expertis": [52, 70], "explain": 16, "explan": [17, 24, 27, 29, 39, 51, 66], "explanatori": [19, 66], "explicit": 73, "explicitli": [16, 27, 30, 40, 52, 59], "explor": [24, 35, 45, 65, 69, 70], "export": [7, 50, 65, 67, 70], "expos": [11, 49, 50, 69], "express": [15, 16, 22, 49, 57, 59, 60, 70], "ext": 60, "extend": [2, 10, 30, 58, 67], "extens": [5, 31, 35, 39, 60, 66], "extension": 16, "extent": 44, "extern": [19, 52, 57, 69], "extol": 16, "extra": [11, 16, 37, 52, 58, 67, 73], "extract": [9, 10, 15], "extrem": 66, "f": [0, 11, 38, 49, 53, 60, 66, 73], "f1000": 44, "f6105891": 18, "f95f324": 18, "face": [49, 66, 70], "facet": 10, "facilit": [0, 7, 10, 31, 37, 41, 42, 51, 67, 72, 73], "fact": [30, 42, 67], "facto": 30, "factori": [11, 16, 22, 59, 60, 64, 70], "factory1": 60, "factory2": 60, "fail": [8, 29, 31, 52, 58, 65, 66], "failur": [29, 31, 52, 66, 67], "fair": [10, 67], "fairli": [38, 68], "faith_pd": 18, "fall": [19, 67], "fallen": 31, "fals": [15, 34, 57, 58, 59, 63, 66, 67, 68], "familar": 73, "famili": 65, "familiar": [29, 38, 45, 49, 50, 66], "fanci": 16, "far": [16, 32, 73], "fast": 32, "fasta": [10, 11, 29, 66, 67], "faster": [7, 8], "fastq": [10, 11, 29, 66], "fastqgzformat": 11, "favorit": 67, "featur": [2, 10, 19, 25, 29, 33, 37, 38, 49, 50, 52, 57, 59, 63, 66, 68, 70, 72, 73], "feature_data": [18, 67], "feature_t": [33, 49, 52], "feature_table1": 49, "feature_table2": 49, "feature_table3": 49, "feature_table_merge_exampl": 49, "feature_table_merge_three_tables_exampl": 49, "featuredata": [52, 65, 66, 67, 68, 69, 73], "featuret": [9, 28, 29, 32, 33, 49, 52, 72], "feb": 15, "feedback": [4, 5, 27, 71], "feel": [15, 31, 42, 44, 52, 66, 68, 70, 72], "few": [15, 16, 19, 28, 29, 31, 33, 35, 37, 43, 47, 48, 58, 65, 66, 69, 73, 74], "fewer": 68, "ff": [34, 57, 60, 64, 66, 70], "ff427b50aaa1": 15, "fh": [11, 34, 57, 58, 65, 66, 68, 73], "field": [15, 16, 22, 37, 52, 53, 59, 60, 66, 67], "field_memb": [16, 59], "field_nam": [16, 59], "fifteen": 15, "fig": [9, 15, 18, 37], "figur": [2, 8, 35, 52, 65, 66, 68], "file": [2, 8, 10, 13, 16, 17, 18, 19, 25, 26, 27, 30, 31, 32, 34, 35, 36, 37, 38, 45, 46, 49, 51, 52, 53, 57, 58, 60, 61, 63, 64, 65, 67, 68, 69, 70, 72, 73], "file1": 60, "file2": 60, "filecollect": 11, "fileformat": 11, "filehandl": 53, "filenam": [10, 11, 15, 18, 27, 31, 58, 66], "filepath": [27, 53, 58, 59, 63, 66], "filesystem": [12, 59], "fill": 38, "fillet": 16, "filter": [7, 63, 68, 73], "filter_column": [50, 63], "filter_id": 63, "final": [8, 15, 16, 35, 42, 45, 49, 50, 59, 66, 67, 68, 69, 70, 73, 74], "find": [15, 16, 24, 27, 29, 33, 35, 38, 41, 44, 45, 52, 57, 59, 61, 64, 67, 68, 69, 70, 72, 73, 74], "fine": [15, 36, 42, 46, 52], "finish": 8, "first": [7, 8, 11, 16, 19, 24, 27, 28, 31, 33, 35, 36, 38, 41, 42, 49, 51, 52, 54, 57, 59, 64, 66, 68, 70, 71, 72, 73], "first_memb": 60, "fish": 16, "fit": 59, "five": 15, "fix": [10, 16, 19, 31, 52, 59, 66], "flake8": 46, "flavor": [25, 37], "flexibl": [42, 65, 66, 70, 73], "flexilib": 49, "float": [16, 59, 63, 66, 67, 69], "flow": 68, "flower": 16, "fly": 11, "fn": 66, "focu": [11, 15, 24, 42, 46, 49, 66], "focus": [47, 63, 67], "fold": 73, "folder": 37, "folk": 70, "follow": [2, 9, 10, 16, 18, 19, 27, 30, 31, 32, 33, 35, 36, 37, 38, 40, 42, 45, 46, 49, 57, 63, 64, 65, 66, 67, 68, 69, 70, 72, 73], "font": 65, "foo": [30, 57, 59, 60], "forg": [15, 31, 38], "forget": [15, 16, 67, 71], "fork": [7, 16], "form": [2, 8, 15, 16, 30, 52, 66, 67], "formal": [16, 68, 69], "format": [2, 8, 9, 10, 13, 15, 16, 17, 26, 27, 28, 31, 32, 34, 37, 41, 42, 43, 45, 48, 49, 50, 51, 56, 57, 58, 60, 62, 63, 64, 65, 67, 68, 70, 73, 74], "format_inst": 11, "format_str": 22, "former": 42, "formerli": 2, "fortun": [12, 30], "forum": [19, 30, 42, 45, 47, 52, 57, 66, 67, 70, 71], "forward": [11, 19, 31, 36, 67, 69, 70, 74], "found": [5, 8, 15, 18, 19, 31, 58, 59, 64, 65, 66, 67, 68, 72, 73], "foundat": [24, 42], "four": [8, 67], "fp": 66, "fr": 0, "fraction": 68, "fragil": 65, "fragment": [18, 57, 59, 68], "frame": 19, "framework": [0, 2, 8, 9, 11, 14, 15, 16, 18, 24, 28, 39, 43, 45, 46, 49, 50, 52, 58, 60, 67, 70], "free": [2, 15, 27, 44, 45, 47, 52, 66, 67, 68, 72], "freedom": [16, 66], "freez": 19, "frequenc": [9, 28, 29, 31, 32, 33, 49, 52, 72], "frequent": [29, 70], "fridai": [19, 29], "friendli": [16, 45, 67, 68], "from": [2, 4, 5, 7, 8, 9, 10, 11, 12, 15, 16, 18, 19, 22, 24, 27, 28, 29, 30, 31, 32, 33, 34, 36, 38, 40, 42, 43, 44, 45, 46, 47, 49, 51, 52, 53, 54, 57, 58, 59, 60, 63, 65, 66, 67, 68, 69, 70, 71, 73, 74], "from_typ": [58, 61, 67], "front": [27, 37], "frost": 16, "fruit": 16, "frustrat": [29, 52, 68], "fsvd": 32, "ft": 49, "ft1_factori": 49, "ft2_factori": 49, "full": [15, 18, 24, 48, 65, 67, 68, 69, 70], "fulli": [7, 15, 37, 52, 69], "fun": 70, "function": [2, 4, 8, 9, 11, 15, 16, 27, 28, 29, 30, 31, 34, 37, 39, 42, 45, 46, 49, 50, 52, 54, 57, 58, 60, 64, 66, 68, 69, 70, 73, 74], "fund": 19, "fundament": [16, 67, 74], "funder": 24, "further": [8, 12, 15, 16, 59, 63], "futur": [7, 10, 11, 19, 24, 30, 40, 52, 59, 69, 70], "fuzzi": 16, "g": [9, 10, 11, 12, 15, 18, 22, 24, 27, 29, 31, 33, 35, 36, 37, 38, 42, 43, 44, 45, 49, 50, 52, 53, 60, 63, 66, 68, 69, 70, 72, 74], "g1827eab": 46, "g7cf7a7a": 46, "g8ac7e3": 46, "gain": 63, "galaxi": [2, 52, 67, 70, 74], "game": 67, "gap": [65, 67], "gap_extend_penalti": [66, 67, 68, 69], "gap_open_penalti": [66, 67, 68, 69], "garbag": [13, 17, 52], "gatekeep": 4, "gave": 30, "gehret": 0, "gene": 68, "gener": [0, 2, 4, 7, 8, 9, 10, 11, 15, 16, 19, 22, 24, 25, 27, 28, 29, 31, 32, 35, 36, 38, 43, 44, 47, 49, 52, 57, 59, 60, 64, 65, 66, 67, 68, 69, 70, 71, 73, 74], "genera": 29, "genom": 67, "genu": 73, "get": [8, 10, 15, 16, 27, 30, 34, 36, 44, 45, 46, 49, 52, 58, 65, 66, 67, 68, 69, 70, 72, 73, 74], "get_act": [33, 54, 68, 69], "get_artifact_collection_memb": 60, "get_available_cor": 61, "get_column": [59, 63], "get_data_path": [58, 66, 67], "get_id": [50, 63], "get_index_path": 68, "get_metadata_column": 60, "get_miss": 63, "get_sequence_id": 66, "get_transform": [58, 64], "get_valu": 63, "ggcctttttttt": [65, 67], "gh": [36, 72], "gish": 0, "git": [7, 31, 36, 38, 46, 67], "github": [4, 5, 7, 15, 18, 19, 24, 37, 38, 41, 42, 45, 46, 47, 51, 66, 70, 72], "githubusercont": [38, 46], "give": [8, 15, 16, 37, 45, 49, 66, 69, 70], "given": [2, 10, 15, 16, 19, 22, 29, 49, 54, 57, 59, 60, 65, 66, 67, 68], "glanc": [8, 10], "global": [15, 43, 57, 67, 69], "global_pairwise_align_nucleotid": [66, 67, 69], "glossari": 3, "go": [7, 16, 19, 27, 31, 36, 44, 49, 52, 65, 66, 67, 68, 69, 70, 71, 72], "goal": [8, 16, 24, 29, 41, 44, 52, 64, 65, 67, 68, 69, 70, 73], "goe": [11, 15, 19], "golden": [67, 72], "gone": 52, "good": [16, 19, 27, 31, 45, 50, 60, 65, 66, 67, 68, 70, 71, 72], "googl": 67, "gotcha": 11, "grab": 46, "grai": 8, "grain": 15, "grammar": 16, "grant": [19, 24], "granular": 16, "grape": 16, "graph": 15, "graphic": [2, 10, 16, 35, 52, 67], "grasp": 16, "great": [16, 37, 49, 66, 70], "greater": [18, 59, 67], "greg": [5, 24, 44, 67], "gregcaporaso": 46, "gregori": 0, "gross": 16, "groundwork": 5, "group": [2, 8, 16, 35, 68, 70], "grow": 27, "grumpi": 36, "gttt": 67, "guarante": 52, "guid": [24, 27, 31, 38, 39, 46, 49, 51, 70], "guidanc": [42, 74], "guidelin": [38, 70], "gz": 11, "gzip": 11, "ha": [8, 9, 10, 11, 15, 16, 18, 24, 27, 29, 31, 33, 36, 40, 42, 45, 49, 50, 52, 59, 63, 65, 66, 67, 68, 69, 72, 73, 74], "habit": 45, "hack": [46, 49], "had": [9, 16, 29, 44, 57, 65, 66, 69], "hadn": 9, "halfwai": 8, "halko2011": 32, "hand": [8, 15, 16, 29, 50, 52, 66, 73], "handl": [12, 15, 28, 30, 41, 50, 51, 52, 63, 64, 68], "happen": [15, 16, 19, 27, 29, 32, 60, 66, 68], "happi": [16, 70, 71], "har": [48, 58], "hard": [15, 16, 29, 43, 66], "harder": 16, "hardwar": 15, "has_missing_valu": [50, 63], "hash": 16, "hassl": 31, "have": [2, 5, 8, 9, 10, 11, 12, 15, 16, 18, 19, 24, 28, 29, 30, 31, 32, 33, 36, 37, 38, 40, 42, 43, 44, 46, 47, 49, 50, 52, 58, 59, 60, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74], "haven": [10, 16, 19, 31, 52, 66, 67, 68], "head": [16, 58, 65], "header": 63, "hear": [5, 12, 29], "hello": [59, 60], "help": [4, 7, 10, 15, 16, 19, 27, 29, 31, 35, 36, 37, 38, 42, 45, 46, 47, 49, 52, 57, 60, 66, 67, 69, 70, 71, 72, 73], "helper": [58, 64, 66, 68, 70], "here": [2, 4, 7, 8, 11, 15, 16, 18, 24, 27, 28, 29, 31, 32, 33, 34, 35, 36, 38, 44, 45, 46, 48, 49, 50, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73], "herman": 0, "hesit": 19, "heurist": 32, "hide": 15, "hierarchi": 16, "high": [8, 15, 45, 66, 67, 68, 69], "highest": [8, 37, 68], "highli": [11, 52, 67, 70], "highlight": 10, "hint": [65, 66, 67, 70], "histor": [9, 18, 27], "histori": [2, 10, 15, 18], "hit": [68, 73], "hoc": [11, 59], "hold": [15, 16], "home": 16, "homebrew": 27, "homologi": [68, 73], "honor": 70, "hood": [64, 68, 70], "hook": [14, 58, 65], "hope": [19, 29, 44, 68], "hopefulli": [31, 66], "host": [2, 7, 15, 24, 37, 38, 72], "hour": 29, "hous": [15, 19, 38, 73], "how": [2, 4, 7, 8, 9, 11, 13, 15, 16, 17, 24, 27, 29, 31, 32, 34, 36, 37, 39, 42, 45, 46, 49, 51, 52, 59, 60, 63, 65, 66, 67, 68, 69, 70, 72, 73, 74], "howev": [2, 5, 8, 10, 16, 38, 42, 50, 52, 66, 73], "html": [7, 9, 35, 65, 68, 73], "http": [0, 7, 15, 18, 24, 31, 38, 45, 46, 60, 63, 67], "huge": [9, 29, 67], "human": [18, 32, 57, 59, 65, 66, 67, 68], "hunt": [0, 2], "hurt": 44, "hyphen": 57, "hypothes": 67, "hypothesi": [2, 67], "i": [2, 4, 5, 7, 8, 9, 11, 12, 13, 14, 16, 17, 18, 19, 22, 24, 25, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 42, 43, 44, 45, 46, 48, 49, 50, 52, 53, 54, 56, 57, 58, 59, 60, 61, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74], "i_tabl": 49, "icon": [15, 18], "id": [2, 49, 50, 57, 59, 60, 63, 64, 66, 68, 70, 73], "id_count": 63, "id_head": 63, "idea": [2, 4, 7, 8, 9, 10, 16, 19, 27, 29, 31, 44, 66, 67, 70, 73], "ideal": [7, 16, 42, 44, 57, 66, 67, 70], "ident": [2, 9, 18, 66, 67, 69], "identfii": 66, "identif": 0, "identifi": [2, 8, 15, 28, 31, 49, 50, 52, 57, 59, 60, 63, 66, 67, 68, 73], "identity_with_metadata_column_get_mdc": 49, "ids_to_keep": 63, "idx": 11, "ignor": [9, 10, 27, 52, 57, 59, 63, 67], "ignore_missing_sampl": 15, "ignore_pcoa_featur": 15, "iim": 24, "illumina": 11, "illustr": [8, 9, 16, 18, 28, 36, 37, 42, 67, 69], "imag": 37, "imagin": [16, 30, 49], "immedi": [19, 44, 74], "immutablemetadata": 50, "imp": 19, "impact": [10, 15, 29, 32, 59, 67, 68], "imped": 16, "implement": [9, 16, 30, 31, 38, 49, 52, 60, 63, 66, 67, 68, 69, 73, 74], "implementationerror": 22, "impli": [9, 66, 67, 69], "implic": 67, "implicit": 59, "import": [7, 8, 10, 14, 15, 16, 18, 27, 29, 31, 32, 34, 43, 44, 45, 49, 52, 57, 59, 64, 65, 67, 68, 69, 70, 73], "import_data": [33, 49, 60, 64, 68, 70], "import_from_format": 60, "import_modul": 66, "importantli": [8, 15, 67, 70, 73], "importlib": 66, "imposs": [15, 29], "improv": [4, 19, 44], "in_": 64, "inaccur": [15, 24], "inact": 8, "inadvertantli": 15, "inappropri": 29, "incident": 70, "includ": [2, 7, 9, 10, 11, 15, 16, 19, 24, 27, 31, 32, 33, 35, 37, 38, 44, 45, 49, 50, 52, 57, 59, 60, 63, 66, 67, 68, 69, 70, 72, 73, 74], "include_suffix": 63, "inclus": 59, "inclusive_end": [16, 59, 67], "inclusive_start": [59, 67], "incom": 19, "incompat": [30, 74], "incomplet": [15, 52, 69], "incomprehens": 15, "inconveni": 10, "incorpor": 25, "incorrect": 29, "increas": [67, 68], "incredibli": 10, "increment": [44, 59], "incur": 67, "indent": 16, "independ": [29, 59, 66], "index": [3, 9, 35, 59, 60, 63, 65, 68, 73], "index_fp": 68, "indic": [5, 8, 15, 29, 30, 32, 36, 42, 45, 46, 49, 58, 59, 63, 65, 66, 67, 68, 69, 73], "indistinct": 16, "individu": [2, 15, 27, 45, 49, 53, 63, 67, 68], "ineffect": 52, "inequ": 16, "inf": 52, "infer": [49, 50, 63, 67, 73], "infin": 59, "influenc": 32, "info": 46, "inforamt": 27, "inform": [2, 8, 9, 10, 11, 12, 14, 15, 16, 18, 19, 24, 27, 29, 31, 32, 34, 42, 44, 45, 47, 50, 57, 65, 66, 67, 68, 72, 73], "informat": 24, "infrastructur": [19, 68], "infrequ": 64, "inher": 66, "inherit": [18, 67], "ini": 9, "init_artifact": [49, 60, 70], "init_artifact_collect": 60, "init_artifact_from_url": 60, "init_format": 60, "init_metadata": 60, "init_metadata_from_url": 60, "initi": [11, 24, 27, 29, 31, 36, 49, 65, 66, 67, 74], "inject": 49, "inner": [15, 63, 73], "inplac": [68, 73], "input": [2, 8, 9, 11, 12, 15, 16, 18, 25, 28, 29, 32, 33, 34, 35, 41, 49, 50, 51, 57, 58, 59, 60, 65, 66, 67, 69, 72], "input_descript": [32, 33, 35, 52, 57, 65, 67, 69], "inputtypea": 59, "inputtypeb": 59, "insdc": 63, "insert": [18, 65, 67], "insid": [10, 16, 18, 32, 49, 66, 68, 73], "insight": [19, 44], "inspect": 16, "inspir": 60, "instal": [2, 7, 10, 27, 31, 37, 41, 42, 43, 44, 45, 49, 51, 64, 66, 70, 73], "instanc": [2, 16, 30, 32, 45, 49, 50, 57, 58, 66, 67, 69], "instanti": [22, 27, 30, 32, 50, 57, 60, 66, 67, 70], "instead": [8, 12, 16, 22, 29, 33, 45, 52, 53, 57, 59, 63, 65, 67, 68, 69], "institut": 24, "instruct": [7, 10, 24, 27, 31, 32, 37, 38, 41, 42, 46, 70, 72, 74], "int": [11, 16, 30, 32, 33, 57, 59, 60, 61, 63, 68], "int_collect": 60, "int_collection6": 60, "int_collection7": 60, "int_dict": 30, "int_list": 30, "int_seq_collect": 60, "integ": [9, 11, 16, 30, 57, 59, 63], "integr": [15, 19, 27, 40, 42, 49, 51, 68, 74], "intellig": 16, "intend": [2, 8, 22, 24, 29, 36, 46, 49, 50, 66, 67, 68, 70, 74], "intent": [2, 8, 29, 59], "intention": [9, 65], "inter": [8, 16, 67], "interact": [2, 8, 9, 16, 22, 30, 45, 50, 52, 67, 69], "interest": [11, 15, 16, 24, 27, 38, 44, 50, 57, 59, 68, 71], "interestingdataformat": 50, "interfac": [2, 4, 7, 8, 10, 11, 15, 18, 19, 23, 24, 25, 27, 32, 36, 45, 46, 49, 50, 52, 57, 59, 60, 66, 67, 74], "intermedi": [15, 25, 66], "intern": [10, 29, 30, 50, 57, 60, 66, 69, 70], "interoper": 42, "interpret": [2, 9, 15, 18, 25, 44, 52, 59, 63, 68, 70], "interrupt": 68, "intersect": 59, "intervent": 7, "intial": 60, "introduc": [4, 18, 29, 36], "introduct": [0, 2, 49, 67, 68, 73], "introspect": 8, "intsequence1": [57, 60], "intsequence2": 57, "intsequenceformat": [11, 60], "intuit": [16, 67], "invalid": [11, 29, 52, 63, 66, 67], "invent": 10, "invers": 59, "invert": 16, "invest": 44, "investig": 15, "invoc": 16, "invok": [8, 12, 49, 54, 58, 60], "involv": [10, 16], "io": [53, 66], "ipython": [67, 70], "iq": 29, "is_semantic_typ": 59, "isn": [7, 11, 16, 27, 37, 44, 58, 60, 66, 67, 68, 70, 73], "iso": 15, "issu": [12, 15, 29, 31, 42, 45, 47, 49, 66, 71], "itcr": 31, "item": [19, 30, 67], "iter": [7, 30, 44, 53, 59, 60, 63, 67, 68], "ith": 24, "its": [2, 7, 8, 10, 11, 15, 16, 18, 27, 28, 29, 30, 32, 35, 39, 45, 49, 50, 54, 57, 60, 63, 65, 66, 67, 68, 69, 70, 72, 73], "itself": [8, 9, 10, 15, 30, 59, 66, 67], "iupac": 66, "j": 0, "jaccard": 33, "jaccard_distance_matrix": 33, "jaccard_emperor": 33, "jaccard_pcoa_result": 33, "januari": [7, 52], "jargon": 66, "jewel": 0, "job": [29, 31, 59, 68], "join": [63, 65, 68, 71, 73], "journal": [44, 67], "journei": [0, 67], "json": [16, 22], "jsonp": 18, "juggl": 12, "jupyt": [2, 24, 70], "just": [8, 14, 15, 16, 24, 27, 29, 30, 42, 44, 46, 49, 50, 52, 59, 64, 65, 66, 67, 68, 70, 72, 73], "k": 57, "keef": 0, "keep": [11, 15, 16, 27, 31, 33, 37, 43, 65, 68], "kei": [8, 15, 18, 30, 32, 37, 45, 49, 52, 53, 57, 59, 60, 67, 70], "kept": 73, "key1": 59, "key2": 59, "keyerror": 73, "keyword": 49, "kind": [2, 8, 11, 16, 29, 50, 66], "kishitanii": 73, "kit": 8, "kitchen": 16, "knife": 16, "knive": 16, "know": [9, 11, 16, 19, 24, 27, 29, 36, 44, 49, 52, 65, 66, 67, 68, 70, 72, 73], "knowledg": [8, 47, 67, 69], "known": [10, 12, 16, 29, 32, 59], "kruskal1952us": 35, "kwarg": 60, "la": [68, 73], "lab": [19, 24, 38, 42, 64, 65, 66, 67, 68, 69, 70, 72, 73], "label": [8, 16, 49], "lack": 16, "lai": 5, "lane_numb": 11, "lang": 65, "languag": [10, 14, 15, 16, 29], "laptop": [68, 70], "larg": [9, 15, 29, 32, 44, 57, 66, 67, 74], "larger": [8, 59, 68], "las_act": 68, "las_result": 68, "last": [14, 16, 36, 52, 65, 66, 68, 72], "latebindingattribut": 14, "later": [8, 10, 66, 67, 72], "latest": [31, 37, 49, 72], "latter": 42, "launch": 7, "layer": 8, "layout": [2, 10], "lead": [27, 29, 40, 52, 66], "learn": [10, 24, 27, 28, 44, 48, 67, 69, 70, 72, 74], "least": [2, 11, 19, 29, 30, 35, 52, 63, 66], "leav": [16, 27, 29, 31, 38, 65], "left": [29, 63, 73], "left_on": 73, "legal": 59, "legendrelegendr": 32, "len": [66, 73], "length": [68, 73], "lengthi": 16, "less": [8, 24, 29, 61, 66], "lesson": [65, 67], "let": [15, 16, 24, 27, 33, 36, 49, 52, 59, 64, 65, 66, 67, 68, 69, 70, 72, 73, 74], "level": [8, 11, 15, 27, 31, 36, 37, 38, 41, 45, 50, 51, 52, 57, 63, 65, 66, 67, 69, 70, 72], "lib": [31, 67], "librari": [31, 32, 41, 42, 45, 49, 51, 66, 67], "licens": 67, "life": 28, "lifetim": 12, "lift": 10, "lightli": 27, "lignment": 67, "like": [2, 7, 8, 9, 10, 11, 15, 16, 18, 24, 27, 29, 30, 31, 32, 33, 35, 36, 38, 40, 41, 42, 43, 45, 46, 47, 49, 50, 52, 57, 59, 60, 61, 64, 65, 66, 67, 68, 69, 70, 72, 73], "limit": [11, 15, 16, 38, 42, 43, 59], "line": [2, 7, 11, 15, 16, 18, 28, 29, 32, 36, 45, 46, 52, 57, 60, 65, 66, 67, 73], "linear": 9, "link": [5, 15, 35, 49, 61, 63, 66, 67, 68, 69], "linkcod": 5, "linux": [36, 46], "lipman": 0, "list": [3, 7, 11, 14, 15, 16, 18, 19, 29, 30, 32, 33, 35, 37, 38, 42, 45, 46, 49, 53, 57, 58, 59, 60, 66, 67, 68, 69, 71, 73], "liter": [49, 57, 60], "littl": [7, 16, 45, 65, 66, 67, 72], "live": [15, 19, 27, 42, 45, 66], "ll": [15, 16, 24, 27, 29, 31, 36, 38, 41, 46, 49, 52, 64, 65, 66, 67, 68, 69, 70, 72, 73, 74], "llm": 15, "load": [8, 11, 18, 27, 29, 32, 37, 45, 49, 50, 52, 53, 57, 58, 63, 65, 66, 67, 70, 72], "local": [0, 7, 36, 46, 49, 58, 67, 69, 72, 73], "local_alignment_search": 68, "local_pairwise_align_nucleotid": [67, 69], "localalignmentsearchresult": [68, 73], "localalignmentsearchresultsformat": 73, "localhost": 7, "locat": [8, 12, 37, 38, 52], "log": [15, 33, 36], "logic": [9, 11, 59, 61], "login": 36, "long": [2, 8, 10, 11, 28, 29, 32, 37, 38, 42, 57, 59, 65, 66, 67, 68], "longer": [57, 65, 66, 67, 68], "longitudin": 50, "look": [8, 9, 11, 16, 18, 27, 29, 30, 31, 33, 35, 38, 40, 41, 45, 49, 50, 58, 59, 64, 65, 66, 67, 68, 69, 70, 72, 73, 74], "lookup": [60, 67], "loop": 68, "loss": 32, "lot": [16, 27, 29, 31, 44, 45, 47, 49, 52, 64, 65, 66, 68, 70, 73], "loudli": 29, "love": [5, 12, 42, 44], "lower": 63, "lsmat": 34, "lsmatformat": 34, "luck": 44, "luckili": 65, "m": [0, 7, 27, 49, 65, 66, 67, 68, 69, 70, 72], "m3": 68, "macbook": 68, "machin": [15, 16, 52, 66], "machineri": [36, 58, 66], "maco": 46, "macosx": 15, "made": [10, 18, 24, 29, 40, 49, 50, 60, 66, 67, 72], "magic": [27, 68], "magnitud": 32, "mai": [2, 4, 7, 8, 10, 15, 16, 18, 19, 24, 27, 29, 30, 31, 32, 41, 42, 49, 50, 52, 54, 57, 59, 60, 63, 66, 67, 68, 69, 70, 72, 74], "mail": 45, "main": [16, 19, 31, 38, 40, 63, 65, 66], "maint": 19, "maintain": [10, 27, 31, 38, 42, 47, 49, 69, 73], "mainten": [15, 19, 31], "major": [52, 65, 66], "make": [4, 7, 9, 10, 11, 15, 16, 18, 27, 29, 30, 31, 32, 35, 36, 37, 38, 42, 43, 44, 46, 49, 52, 57, 59, 63, 64, 65, 67, 68, 69, 70, 72, 73, 74], "make_artifact": [33, 54, 69], "makefil": 36, "manag": [2, 9, 12, 15, 19, 27, 46, 52, 54, 58, 60, 61, 66, 67, 68, 69, 72], "mani": [5, 9, 10, 11, 15, 16, 18, 27, 29, 32, 35, 43, 44, 49, 50, 66, 67, 68, 69, 73], "manipul": [8, 9, 10, 59, 60, 63], "manner": [32, 50], "manual": [15, 30, 31, 49, 66], "manuscript": [2, 15, 44], "map": [22, 32, 59, 60, 63, 67, 68, 70], "mapping_1": 60, "mapping_2": 60, "mappingproxytyp": 63, "march": [0, 2, 11], "mari": 0, "markdown": [24, 37], "market": 44, "massiv": 15, "masteri": [0, 67], "match": [16, 18, 43, 45, 46, 54, 57, 59, 60, 63, 65, 67, 68, 73], "match_scor": [66, 67, 68, 69], "materi": [7, 50, 58, 60, 70], "matric": 32, "matrix": [32, 33, 66], "matter": [16, 32, 59], "matthew": 0, "max": [11, 57, 66], "maxim": [41, 51, 66], "mayb": [65, 69], "md": [18, 36, 37, 42, 50, 59, 60, 72], "md1": 60, "md2": 60, "md3": 60, "md5": 18, "md5sum": 18, "md_for_column": 60, "me": [16, 27, 52, 65, 66, 67, 69, 70, 72], "mean": [5, 8, 9, 10, 12, 15, 16, 24, 29, 38, 43, 45, 59, 66, 67, 68, 72], "meaning": [49, 52], "meaningless": 52, "meant": [2, 59], "meantim": 66, "mechan": [16, 36, 42, 52, 57], "medic": 67, "meet": [37, 49, 63, 70], "member": [11, 16, 19, 22, 59, 60], "memori": [2, 10, 12, 29, 63, 68], "mention": [36, 65, 66, 67, 69, 70], "menu": 16, "merg": [9, 19, 37, 49, 60, 63, 73], "merge_metadata": 60, "merged_t": 49, "messag": [29, 52, 57, 63, 67, 72, 73], "met": 37, "meta": [27, 46, 65], "metaclass": 14, "metadata": [2, 15, 16, 18, 25, 27, 33, 35, 41, 45, 49, 51, 56, 62, 64, 65, 66, 68, 70, 74], "metadata_column": 73, "metadata_index": 73, "metadatacolumn": [16, 50, 59, 63], "metadatafileerror": 63, "metagenom": [2, 31, 38, 42], "metapackag": [2, 31, 42], "metaprogram": [13, 17], "method": [0, 2, 11, 14, 15, 16, 18, 19, 22, 25, 27, 28, 30, 33, 35, 38, 41, 43, 49, 50, 51, 52, 54, 57, 58, 60, 63, 65, 66, 69, 70, 71, 72, 73, 74], "methodnam": 58, "metric": [15, 28, 32, 33, 45], "mi": 15, "microbiom": [2, 7], "microsecond": 15, "mid": 68, "middl": 19, "might": [10, 11, 16, 29, 30, 38, 45, 46, 49, 50, 58, 60, 66, 67, 68], "migrat": 57, "miller": 0, "min": [11, 57, 66], "mind": [15, 16, 42, 43, 66, 70], "mine": [16, 66, 68, 70], "mini": 47, "miniconda": 46, "miniconda3": [46, 67], "minim": [11, 39, 40, 46, 52, 66], "minimum": 65, "minor": [40, 67], "minut": [14, 29, 64, 65, 66, 67, 68], "mirror": 15, "miscellan": [67, 72], "misdiagnos": 52, "misialq": 24, "misinform": 52, "misinterpret": 29, "mismatch": [16, 65, 67], "mismatch_scor": [66, 67, 68, 69], "miss": [29, 42, 50, 52, 63, 68, 73], "missing_id": 73, "missing_schem": [59, 63], "mission": 16, "mistak": 66, "misus": 10, "mix": [16, 74], "mode": [7, 8, 11, 46, 55, 66], "model": [11, 14, 15, 16, 52, 66], "moder": 47, "modestli": 70, "modif": [40, 66], "modifi": [18, 67, 68], "modul": [2, 5, 16, 27, 56, 57, 59, 65, 66, 67, 69, 70], "modulo": 16, "mol": 0, "molecular": [0, 67], "moment": [5, 7, 48, 67], "mondai": 29, "monitor": [45, 47, 68], "monospac": 65, "month": [19, 47], "more": [2, 4, 8, 9, 10, 11, 12, 15, 16, 18, 19, 24, 25, 27, 29, 31, 32, 33, 36, 37, 38, 39, 41, 42, 44, 45, 47, 48, 49, 50, 52, 57, 59, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74], "morn": 29, "most": [7, 8, 10, 15, 16, 19, 24, 29, 31, 37, 40, 43, 44, 50, 52, 57, 59, 65, 66, 67, 68, 69, 70, 74], "mostli": 66, "motiv": [10, 29], "mouth": [16, 44], "move": [7, 8, 9, 10, 19, 30, 31, 46, 60, 64, 66, 67, 68, 69, 74], "mroe": 27, "msa": [65, 66, 67, 69, 70], "msa_summari": 69, "much": [8, 10, 11, 16, 29, 30, 46, 49, 60, 66, 67], "multi": [7, 68, 69], "multiindex": 73, "multipl": [7, 8, 10, 11, 15, 16, 18, 22, 24, 29, 30, 38, 52, 57, 58, 59, 60, 65, 66, 67, 68, 74], "multiprocess": 12, "must": [2, 8, 11, 15, 16, 18, 19, 28, 30, 32, 33, 35, 37, 40, 45, 49, 57, 58, 59, 60, 61, 63, 66, 67, 68, 69], "mutual": 58, "mv": 2, "my": [27, 29, 37, 44, 49, 52, 57, 64, 65, 66, 67, 68, 69, 70, 72, 73, 74], "my_act": [52, 60], "my_artifact": 60, "my_column": 60, "my_int": 60, "my_metadata": 60, "my_method": 57, "my_pipelin": 57, "my_plugin": 60, "my_visu": 57, "my_viz": 50, "myer": 0, "mynewformat": 52, "mypi": 32, "myself": 70, "myst": 24, "n": [11, 38, 46, 68], "n_char": 66, "n_job": 33, "n_jobs_or_thread": 15, "n_less": 61, "name": [2, 8, 9, 10, 11, 15, 16, 18, 22, 27, 30, 31, 32, 33, 34, 35, 37, 38, 43, 45, 46, 49, 52, 55, 57, 58, 59, 60, 63, 65, 66, 67, 68, 69, 70, 73], "namedtupl": [22, 53], "namespac": [22, 43], "nan": [58, 63], "narrow": [8, 59], "nation": 24, "nativ": 2, "natur": [59, 63, 70, 74], "navig": [36, 59], "nc": 24, "nd": 24, "nearli": 67, "neat": 27, "necessari": [10, 11, 16, 50, 56, 68], "necessarili": [8, 16, 29, 47, 57], "necessit": [31, 74], "need": [4, 7, 8, 9, 10, 11, 16, 19, 22, 24, 27, 29, 30, 31, 33, 36, 37, 38, 42, 44, 45, 46, 49, 50, 52, 57, 59, 60, 61, 64, 65, 66, 67, 68, 69, 70, 71, 73], "needleman": [0, 67, 69], "needleman1970": [67, 70], "needleman1970gener": 67, "neg": [52, 59, 67], "neither": [15, 16], "nest": [2, 8, 15, 16, 27], "network": 31, "never": [8, 16, 31, 34, 41, 52, 66, 67, 69], "new": [2, 4, 7, 9, 10, 11, 12, 15, 16, 18, 19, 24, 29, 30, 31, 32, 36, 37, 38, 39, 42, 43, 44, 45, 46, 51, 52, 54, 59, 61, 63, 65, 68, 69, 70, 71, 73, 74], "newer": 19, "newick": [10, 29, 66], "next": [15, 19, 31, 35, 36, 44, 45, 47, 52, 66, 67, 68, 69, 70, 71, 72, 73, 74], "nexu": 66, "nice": [16, 41, 51, 70], "nicer": 65, "nih": 24, "node": [15, 66, 68], "nois": 57, "nomenclatur": 16, "non": [8, 10, 15, 22, 32, 33, 49, 50, 59, 60, 66, 67], "non_definite_chars_count": 66, "none": [8, 11, 22, 32, 33, 35, 49, 50, 53, 54, 55, 57, 58, 59, 60, 61, 63, 65, 66, 67, 73], "nonetheless": 16, "nonsens": 59, "nor": 15, "normal": [12, 15, 16, 33, 59, 63, 66, 67], "notabl": [10, 15], "note": [8, 15, 30, 31, 36, 38, 48, 49, 57, 59, 61, 63, 64, 66, 67, 68], "notebook": [2, 15], "noth": [15, 27, 57, 59, 60, 61, 63], "notic": [11, 19, 29, 32, 47, 66, 68, 69], "notif": [29, 47, 74], "notion": 15, "noun": 2, "novemb": 0, "now": [8, 10, 11, 16, 18, 24, 31, 36, 40, 42, 44, 46, 49, 59, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73], "np": [49, 63], "nucleotid": [65, 67], "null": [9, 15], "num": 59, "num1": 57, "num2": 57, "num_split": 68, "number": [8, 11, 15, 16, 27, 28, 32, 45, 46, 50, 57, 59, 60, 61, 63, 67, 72, 73], "number_of_dimens": 32, "numer": [16, 59, 63], "numeric_md_col": 50, "numericmetadatacolumn": [50, 63], "numpi": 49, "nw": [65, 67, 69], "nw_align": [65, 66, 67, 70], "nw_align_act": 69, "nw_align_example_1": 70, "nwaligntest": 67, "o": [15, 30, 49, 53, 59, 61, 65, 67, 70, 72, 73], "o1": 49, "o2": 49, "ob": 58, "object": [2, 8, 12, 14, 15, 16, 19, 27, 28, 32, 33, 34, 35, 50, 51, 53, 57, 58, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 73], "obs_feat_vector": 49, "obscur": [52, 64, 66], "observ": [8, 11, 16, 33, 42, 52, 64, 65, 66, 67, 68], "observed_featur": 49, "observed_features_exampl": 49, "observed_hit": 68, "observed_index": 68, "observed_otu": 33, "observed_otus_vector": 33, "observed_viz": 68, "obtain": [50, 60, 63, 68], "obviou": 16, "obvious": [16, 44], "occur": [8, 11, 12, 15, 49, 67], "occurr": 31, "octob": [0, 18, 19, 31], "odd": 67, "off": [12, 16, 31, 38, 44, 52, 66, 69], "offend": 43, "offens": 66, "offer": [12, 18, 47, 50], "offici": [31, 38], "often": [10, 15, 16, 27, 29, 34, 38, 52, 65, 67, 68, 70, 74], "ok": [29, 52, 65, 66], "okai": 46, "old": [7, 16, 24], "older": [9, 15, 19, 29, 57, 72], "omiss": 59, "omit": 63, "onc": [8, 10, 11, 16, 19, 31, 32, 37, 44, 49, 59, 64, 66, 68], "one": [2, 8, 9, 10, 11, 15, 16, 18, 25, 27, 29, 30, 31, 32, 33, 34, 35, 36, 38, 40, 42, 43, 45, 48, 49, 50, 52, 57, 59, 63, 65, 66, 67, 68, 69, 70, 72, 73], "oner": 8, "ones": [42, 66, 67], "ongo": 19, "onion": 8, "onli": [2, 5, 8, 9, 11, 15, 16, 18, 24, 25, 29, 32, 33, 35, 36, 37, 42, 44, 45, 46, 50, 52, 57, 59, 60, 61, 63, 64, 65, 66, 67, 68, 69, 72, 73, 74], "onlin": [31, 44], "opaqu": 66, "open": [4, 7, 10, 11, 15, 34, 37, 46, 50, 52, 57, 65, 66, 67, 68, 70, 73], "oper": [2, 10, 15, 16, 25, 27, 29, 50, 52, 57, 68, 73], "opinion": 11, "opportun": [50, 52, 68, 69], "oppos": [2, 46, 66, 68], "opposit": [59, 68], "opt": [68, 72], "option": [11, 15, 22, 31, 36, 38, 44, 45, 47, 49, 58, 59, 63, 68], "optional1": 57, "optional2": 57, "orang": 59, "orchestr": 2, "order": [10, 11, 15, 16, 30, 31, 49, 57, 59, 60, 63, 67, 68, 73], "ordereddict": 53, "ordinationresult": 32, "org": [0, 7, 15, 18, 24, 31, 38, 46, 60, 63, 67], "organ": [16, 19, 24, 38, 42, 46, 66], "orient": 57, "origin": [2, 9, 10, 18, 30, 32, 33, 35, 58, 63, 68, 73], "osx": 46, "other": [2, 4, 5, 8, 9, 10, 11, 15, 16, 19, 24, 25, 27, 29, 30, 32, 35, 36, 37, 38, 41, 42, 45, 51, 52, 54, 57, 58, 60, 63, 65, 66, 67, 68, 69, 70, 72, 73, 74], "other_plugin": 16, "otherwis": [11, 30, 50, 57, 58, 59, 63, 72, 73], "otu": 33, "our": [4, 7, 10, 15, 16, 19, 24, 29, 38, 42, 44, 49, 52, 64, 65, 66, 69, 70, 71, 72, 73], "ourself": 69, "ourselv": [16, 67], "out": [9, 11, 14, 16, 19, 27, 29, 31, 37, 42, 44, 50, 52, 57, 60, 63, 65, 66, 67, 68, 69, 70, 72, 73], "outcom": [15, 29, 49, 50, 52, 67], "outdat": [15, 24, 29], "outer": 15, "outf": 52, "outlin": [19, 31, 38, 60], "output": [2, 11, 15, 16, 18, 25, 28, 29, 32, 33, 34, 35, 41, 49, 51, 57, 59, 60, 65, 66, 67, 68, 69, 70, 72, 73], "output_descript": [32, 33, 35, 52, 57, 67, 69], "output_dir": [35, 50, 57, 65, 73], "outsid": [27, 40, 59, 67], "outweigh": 68, "over": [7, 8, 9, 11, 15, 16, 18, 29, 33, 44, 45, 53, 60, 66, 67, 68, 69], "overal": [8, 18], "overhead": 68, "overlap": [49, 59, 63], "overlap_method": 49, "overload": 29, "overrid": [58, 60, 63], "overridden": 58, "overriden": 60, "oversel": 44, "oversight": 66, "overview": [13, 17], "overwrit": 61, "own": [2, 4, 7, 11, 15, 16, 28, 31, 41, 42, 47, 49, 52, 54, 64, 67, 70, 71, 72, 73, 74], "owner": [31, 37, 38], "p": [24, 49, 65, 67], "pacakg": 27, "packag": [2, 8, 14, 15, 19, 26, 31, 32, 38, 45, 46, 51, 53, 57, 58, 65, 66, 67, 68, 70, 72], "pad": 65, "page": [5, 7, 12, 27, 36, 37, 44, 45, 52, 60, 65, 67], "pai": [36, 52], "pain": 67, "pair": [2, 10, 28, 33, 37, 50, 53, 59, 67], "pairedendsequenceswithqu": 11, "pairwis": [2, 50, 65, 68, 69], "panda": [29, 35, 50, 59, 60, 63, 68, 69], "paper": [16, 44, 67], "paperpil": 67, "paragraph": 15, "parallel": [7, 8, 27, 41, 51, 69, 74], "parallel_config": 68, "parallelconfig": 68, "paramet": [2, 8, 10, 15, 16, 22, 25, 28, 30, 32, 33, 35, 45, 46, 49, 50, 53, 57, 58, 59, 61, 63, 65, 66, 67, 68, 69, 70, 72, 73], "parameter_descript": [32, 33, 35, 50, 52, 57, 65, 67, 69], "params_only_method": 60, "paranthraci": 73, "pare": 16, "parent": 15, "parenthesi": 8, "pars": [9, 18, 29], "parse_format": 22, "parse_typ": [14, 22], "parser": [9, 18], "parsl": 68, "part": [4, 11, 12, 17, 24, 30, 31, 38, 39, 42, 48, 52, 56, 59, 60, 65, 66, 67, 70, 71, 73], "parti": 43, "particular": [2, 8, 9, 10, 19, 38, 50, 59, 60], "particularli": 12, "partit": 50, "pass": [2, 10, 11, 15, 18, 19, 29, 30, 31, 36, 38, 45, 46, 49, 50, 52, 59, 65, 66, 67, 68, 69, 70, 73], "passag": 8, "passthrough": 15, "past": [38, 64, 67], "pastri": 16, "pastrybag": 16, "patch": 19, "path": [5, 12, 29, 30, 35, 37, 45, 49, 52, 53, 55, 58, 59, 60, 63, 64, 65, 67, 70, 72, 73], "pathlib": 58, "pathlik": 53, "pathspec": 55, "pattern": [11, 27, 38, 51, 62, 66], "payload": [2, 9, 10, 11], "pcoa": [15, 32, 33], "pcoa_result": 33, "pcoaresult": [32, 33], "pd": [29, 35, 50, 52, 57, 59, 60, 63, 68, 73], "pdt": 68, "pear": 16, "peek": [60, 67, 70], "peer": 44, "pen": 16, "penalti": 67, "pencil": 16, "pend": [18, 48, 66], "peopl": [16, 27, 44, 69], "per": [10, 11, 15, 29, 59, 65, 68], "percent": [68, 73], "perciev": 66, "perfect": 16, "perform": [2, 8, 9, 10, 11, 15, 16, 29, 31, 36, 39, 50, 52, 53, 60, 63, 64, 65, 66, 67, 68, 69], "permit": [10, 16, 57], "persist": [10, 11, 15], "person": [10, 16, 38, 70], "perspect": 44, "ph": 50, "phone": 52, "photobacterium": 73, "phrase": 29, "phylogenet": [15, 29, 32, 33, 66, 67], "phylogenetic_metr": 28, "phylogeni": [15, 28, 29, 32, 66], "phylum": 73, "pick": 19, "pictur": [7, 8, 60], "piec": [2, 9, 10, 16, 69], "pielou": 33, "pielou_": 33, "pin": 19, "pip": [7, 31, 36, 38, 42, 49], "pipelin": [2, 18, 22, 25, 28, 41, 51, 56, 57, 62, 73, 74], "pipx": 72, "pivot": 50, "pkg_resourc": 15, "place": [10, 11, 27, 30, 37, 47, 48, 59, 63, 66, 67, 68, 69, 73], "placehold": 48, "plai": [31, 41, 51], "plain": [10, 16], "plan": [15, 18, 29, 31, 47, 49, 52, 66, 71, 72], "platform": [15, 47], "pleas": [15, 19, 24, 42, 44, 47, 49, 52, 66, 67], "plo": 0, "plot": [15, 33, 35], "plu": 11, "plugin": [2, 4, 5, 7, 8, 10, 11, 14, 15, 16, 18, 24, 25, 26, 29, 30, 32, 33, 34, 35, 40, 41, 47, 49, 50, 53, 54, 55, 58, 59, 60, 62, 63, 64, 66, 68, 69, 70, 71, 73], "plugin_id": [49, 60, 70], "plugin_setup": [34, 45, 49, 65, 66, 68, 69, 70], "pluginmanag": [2, 7, 27, 60], "pluginmethod": 57, "pluginpipelin": 57, "pluginvisu": 57, "png": [15, 35], "point": [8, 9, 15, 27, 35, 36, 42, 57, 59, 63, 64, 66, 67, 68, 69, 73], "poke": [27, 72], "popular": [44, 70], "port": [15, 24], "posit": [2, 59, 65, 66, 67], "possess": [16, 59, 60], "possibl": [9, 10, 15, 16, 18, 29, 37, 38, 49, 52, 58, 59, 61, 64, 65, 66, 67, 68, 69, 70], "possibli": [9, 15], "post": 67, "potenti": 29, "pound": 63, "power": [16, 27, 49, 66, 67, 68, 70], "pr": [31, 37], "practic": [16, 52, 60, 65, 66, 72], "pragmat": [0, 67, 69], "pre": [27, 65], "predecessor": 18, "predefin": [2, 73], "predetermin": 16, "predic": 16, "predict": 31, "prefer": [15, 16, 27, 29, 31, 45, 49, 60, 66], "prefix": [49, 58], "prepar": [44, 60, 69, 73], "presenc": [11, 58], "present": [4, 7, 9, 11, 15, 18, 30, 32, 35, 38, 49, 58, 63, 65, 66, 67, 68, 70, 73], "preserv": [60, 63], "presum": [44, 66], "pretend": 49, "pretti": [27, 36, 68], "prevent": [10, 11, 15, 43, 66, 69], "preview": 7, "previou": [11, 15, 38, 45, 64, 65, 66, 67], "previous": [9, 18, 24, 31, 42, 66, 69], "previous_v": 11, "primari": [2, 15], "primarili": [2, 15, 24, 40], "primit": [2, 10, 13, 17, 22, 30, 32, 49, 57, 60, 67, 69], "princip": 32, "principl": [2, 10, 69, 73], "print": [16, 49, 60, 70], "prior": [10, 15, 18, 19, 30, 33, 38, 50], "priorit": 19, "prioriti": [44, 52], "privat": [27, 59, 66, 67], "privileg": 8, "pro": 68, "probabl": [16, 29, 44, 49, 52, 66, 68], "problem": [9, 10, 29, 31, 52, 66], "problemat": [15, 52, 68], "proce": [38, 68, 73], "proceed": 40, "process": [2, 7, 8, 12, 16, 19, 31, 36, 37, 40, 44, 45, 49, 52, 61, 66, 67, 68, 72], "processor": 68, "procida": [0, 74], "produc": [2, 12, 15, 16, 18, 22, 25, 28, 32, 33, 35, 49, 52, 57, 59, 67, 68, 69, 70], "profession": 0, "program": 29, "programat": 15, "programm": [0, 29, 67, 69], "programmat": 16, "progress": [19, 44, 74], "project": [5, 10, 19, 24, 27, 32, 44, 45, 46, 52], "project_nam": 57, "prolifer": 73, "promis": 52, "promot": [4, 44], "prompt": [67, 72], "prone": 66, "proof": 10, "propag": 27, "properli": 49, "properti": [14, 50, 59, 63, 65, 66], "proport": [16, 59], "prospect": [15, 36], "protein": [0, 2, 66, 67], "protocol": 14, "prototyp": [52, 67], "proud": 44, "proven": [0, 2, 7, 8, 13, 17, 18, 33, 52, 63, 65, 68, 72, 74], "provid": [2, 4, 5, 8, 9, 10, 11, 12, 15, 16, 19, 22, 24, 25, 27, 28, 29, 30, 31, 32, 33, 34, 35, 37, 38, 39, 41, 42, 45, 46, 48, 50, 51, 53, 59, 60, 61, 63, 64, 65, 66, 67, 68, 69, 70, 72, 73, 74], "proxi": [49, 68], "pseudomonadota": 73, "public": [4, 9, 11, 22, 41, 42, 49, 51, 52, 56, 66], "publish": [29, 44, 67, 74], "pull": [7, 9, 18, 27, 31, 37], "pull_request": 31, "punctuat": 45, "purpos": [8, 10, 16, 24, 50, 57, 60, 65, 67, 70, 72], "push": [12, 31, 36], "put": [27, 31, 38, 66, 67, 68, 69, 73], "py": [5, 16, 18, 45, 49, 64, 65, 66, 68, 70], "pypi": 45, "pytest": [46, 49], "python": [2, 7, 8, 12, 14, 15, 16, 19, 27, 32, 34, 40, 45, 46, 49, 52, 53, 57, 63, 66, 68, 69, 74], "python3": 67, "q": [24, 68], "q1": 68, "q2": [15, 18, 25, 28, 29, 34, 38, 43, 45, 46, 48, 49, 50, 57, 64, 65, 66, 67, 68, 69, 70, 72, 73], "q2_divers": [28, 32, 33, 35, 45], "q2_dwq2": [65, 66, 67, 68, 69, 70], "q2_feature_t": 49, "q2_type": [18, 32, 67], "q2cli": [2, 15, 46, 49, 66, 70, 74], "q2dev": 46, "q2galaxi": 70, "q2view": 15, "qiim": [0, 2, 4, 5, 7, 9, 11, 12, 13, 15, 16, 17, 18, 20, 22, 26, 28, 29, 30, 31, 32, 33, 35, 36, 39, 40, 41, 43, 47, 49, 50, 51, 52, 53, 56, 57, 58, 59, 60, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73], "qiime2": [2, 5, 7, 9, 11, 12, 14, 15, 16, 18, 22, 24, 27, 31, 32, 35, 37, 38, 45, 46, 48, 49, 50, 52, 53, 55, 56, 57, 58, 59, 60, 61, 63, 64, 65, 66, 67, 68, 69, 70, 72, 73], "qual": 29, "qualiti": [29, 67], "quantit": 44, "queri": [50, 63, 68, 73], "query_seq": 68, "query_sequ": 68, "query_sequences_art": 68, "query_split": 68, "question": [8, 9, 11, 19, 36, 42, 45, 47, 49, 50, 66, 72], "quick": [2, 11, 65, 66], "quickli": [11, 19, 29, 44, 66, 70], "quiet": [29, 67, 72], "quietli": 29, "quit": 45, "quot": 74, "qza": [10, 15, 29, 30, 49, 66, 67, 70], "qzv": [7, 10, 15], "r": [0, 7, 11, 16, 32, 52, 60, 65, 66, 68, 69], "r1": 68, "r2": 68, "r3": 68, "race": 44, "raii": 12, "rais": [11, 16, 22, 40, 57, 58, 60, 63, 66, 73], "ram": [29, 68], "ran": [15, 65, 68, 70], "random": 9, "randomli": 2, "rang": [32, 33, 59, 66, 67, 68], "rank": 57, "rare": 59, "rarefi": [25, 33, 66], "rarefied_t": 33, "rather": [7, 15, 16, 29, 31, 43, 44, 52, 65, 66, 67, 70], "raw": [38, 46, 66], "re": [2, 4, 5, 7, 10, 15, 16, 19, 24, 27, 31, 32, 36, 37, 38, 41, 43, 44, 46, 49, 52, 64, 65, 66, 67, 68, 69, 70, 72, 73, 74], "reach": [19, 30, 42, 44, 47, 49, 52, 66], "read": [2, 8, 9, 11, 16, 24, 27, 30, 31, 34, 52, 63, 64, 65, 66, 67, 68, 70, 71, 74], "read_csv": 57, "read_numb": 11, "readabl": [32, 65, 68], "reader": [8, 24, 36, 67], "readi": [7, 8, 19, 32, 36, 44, 64, 66, 67, 68, 70, 72, 73], "readiab": 0, "readm": [36, 37, 42, 72], "real": [15, 16, 24, 49, 51, 60, 68, 72, 73, 74], "realiti": 52, "realiz": [29, 59], "realli": [7, 12, 14, 70, 73], "reason": [10, 15, 29, 40, 52, 66, 69, 72, 73], "reassign": 67, "recal": [64, 66, 73], "receiv": [8, 16, 19, 33, 52, 57, 59, 66, 68, 73, 74], "recent": [7, 10, 16, 29, 31, 36, 66], "reciev": 66, "recip": [27, 46], "recogn": [16, 27, 59, 67], "recommend": [7, 11, 16, 19, 31, 36, 44, 46, 50, 57, 66, 67, 68, 70, 72], "reconsid": 67, "record": [8, 10, 11, 15, 18, 66, 67, 72, 74], "record_map": 11, "recreat": 15, "recur": 52, "recycl": [7, 68], "redesign": 4, "redirect": 61, "redirected_stdio": 61, "reduc": [15, 32, 42, 52, 66, 68], "redund": 15, "ref": [15, 18, 19, 73], "refactor": [19, 64, 68], "refer": [2, 4, 7, 9, 15, 17, 21, 24, 27, 29, 30, 31, 32, 37, 38, 39, 42, 44, 45, 48, 49, 50, 51, 64, 65, 66, 67, 68, 69, 70, 72, 73], "referenc": [27, 30, 37, 38, 67], "reference_metadata": 73, "reference_seq": [68, 73], "reference_sequ": 68, "reference_sequences_art": 68, "referenti": 9, "reflect": [15, 19, 29, 38], "reformat": 9, "refresh": [49, 65, 66, 67, 69, 73], "refus": 16, "regard": [29, 32, 44], "regardless": [15, 29, 38, 44, 63], "regex": 60, "regist": [2, 8, 10, 11, 15, 16, 18, 25, 27, 28, 29, 41, 43, 50, 51, 52, 54, 57, 58, 64, 73], "register_artifact_class": [57, 66], "register_format": [57, 66], "register_funct": [28, 30, 32, 33, 35, 49, 50, 52, 57, 65, 66, 67, 68, 69, 70], "register_semantic_typ": [16, 57, 66], "register_semantic_type_to_format": 57, "register_transform": [34, 50, 57, 64, 66], "register_valid": 57, "register_view": 57, "registr": [11, 15, 28, 30, 45, 48, 49, 50, 51, 56, 59, 62, 67, 68, 69, 70, 73], "regroup": 50, "regular": [19, 59, 60], "regularli": [31, 37], "reimplement": 49, "reindex": 73, "reinstal": 49, "rel": [15, 19, 27, 31, 37, 52, 53, 60, 63, 66, 67, 68, 73], "relat": [2, 8, 9, 10, 15, 16, 19, 27, 36, 47, 66, 67, 74], "relationship": [16, 29], "releas": [7, 17, 18, 20, 30, 31, 37, 38, 42, 46, 49, 72], "relev": [4, 8, 15, 18, 19, 24, 27, 29, 31, 38, 42, 45, 46, 50, 66, 67, 70, 73], "reli": [31, 38], "reliabl": 15, "relianc": 15, "remain": [15, 16, 18, 24, 31, 36, 68], "rememb": [15, 16, 67, 73], "remind": [38, 70], "remot": [31, 52], "remov": [4, 11, 19, 50, 63, 66, 67, 73], "renam": [2, 27], "render": [7, 37, 49, 50, 60, 70], "reorgan": [27, 66], "repair": 15, "repeat": [2, 9, 16], "repercuss": 52, "repetit": 48, "replac": [42, 44, 57, 61, 65, 67, 70], "replai": [0, 2, 7, 15, 52, 74], "replay": 52, "repo": [31, 36], "report": [67, 68], "repositori": [7, 19, 24, 27, 31, 36, 37, 38, 46, 49, 67], "repr": 65, "repres": [2, 9, 10, 11, 15, 16, 18, 22, 29, 50, 57, 59, 60, 63, 66, 67, 68, 73], "represent": [2, 9, 11, 15, 16, 18, 29, 35, 50, 59, 65, 69], "reproduc": [0, 10, 15, 52], "reproduct": 15, "request": [7, 8, 10, 18, 27, 29, 31, 42, 44, 47, 50, 58, 61, 63, 66, 67, 68, 72], "requir": [7, 8, 11, 15, 16, 19, 27, 28, 30, 31, 33, 35, 36, 40, 45, 46, 48, 49, 52, 54, 59, 63, 65, 66, 67, 68, 69, 70, 72], "research": [15, 19, 24], "reserv": 16, "reset": 58, "reset_index": 73, "resolut": 59, "resolv": [5, 40, 42], "resourc": [7, 12, 27, 37, 47, 59, 68, 69], "respect": [5, 15, 18, 27, 29, 59, 63, 67, 69], "respons": [2, 8, 9, 12, 42, 44, 47, 52, 72], "rest": 9, "restart": 68, "restrict": [8, 27, 44, 46, 50, 63, 73], "result": [2, 7, 8, 9, 15, 18, 22, 24, 29, 30, 32, 33, 35, 40, 44, 49, 50, 52, 57, 58, 59, 63, 64, 65, 66, 67, 68, 69, 70, 72, 73], "result1": 40, "result2": 40, "result_as_str": 58, "resultcollect": [22, 60], "resulttypea": 59, "resulttypeb": 59, "retain": [58, 63], "retract": [52, 67], "retriev": [60, 63, 69], "retrospect": [2, 10, 13, 17], "return": [2, 8, 11, 16, 18, 22, 29, 32, 33, 34, 35, 36, 40, 49, 50, 52, 53, 54, 57, 58, 59, 60, 61, 63, 64, 65, 66, 67, 68, 69, 70], "reus": [10, 22, 42, 68, 73], "revers": [11, 68], "review": [10, 15, 16, 19, 42, 44, 64, 65, 66, 67, 68, 73], "revis": [27, 67], "rewrit": 14, "rfc": 2, "rich": [8, 10, 16, 70], "right": [8, 16, 37, 42, 49, 52, 63, 66, 67, 74], "right_on": 73, "rightli": 69, "risk": 52, "rm": 67, "rna": [2, 66, 67], "robin": 19, "robust": [12, 16], "role": 64, "root": [2, 9, 15, 18, 28, 29, 32, 37, 49, 66], "root_uuid": 18, "rough": 8, "roughli": [10, 27, 68], "round": [8, 19, 64, 68], "roundtripp": 63, "row": [59, 63], "rrna": 66, "rstrip": 11, "rule": [10, 15, 16, 30, 59], "run": [2, 7, 11, 15, 18, 27, 29, 31, 36, 40, 42, 44, 46, 47, 49, 52, 58, 64, 65, 66, 67, 69, 70, 73, 74], "runner": 58, "runtest": 58, "runtim": [9, 14, 15, 66, 68], "s1": [49, 59, 67], "s2": [49, 67], "s3": 49, "s42": 60, "s_": 11, "s_l": 11, "sai": [16, 29, 69], "said": [44, 67], "sake": [46, 68], "same": [8, 10, 15, 16, 18, 22, 29, 30, 31, 33, 35, 38, 43, 44, 45, 49, 52, 59, 63, 64, 65, 66, 68, 69, 70, 72, 73], "sampl": [2, 10, 11, 15, 18, 25, 29, 33, 35, 45, 59, 60, 63, 73], "sample_id": [11, 49], "sampledata": [11, 29, 33, 35, 49], "sampling_depth": [15, 33], "sapienn": 48, "satisfi": 16, "saul": 67, "save": [8, 9, 10, 11, 15, 18, 50, 52, 53, 57, 63, 65, 67, 68, 70], "scale": 65, "scene": [19, 64], "schedul": [19, 31], "schema": 9, "scheme": [9, 15, 37, 63], "scholar": 67, "scienc": [2, 24], "scientif": 52, "scientist": [10, 27, 31], "scikit": [65, 66, 67], "scipi": 32, "scope": [15, 22, 27, 49, 70], "score": [60, 67, 68, 73], "scratch": [24, 36], "script": 15, "sdk": [2, 7, 8, 12, 14, 22, 49, 60, 67, 68, 69], "search": [0, 42, 47, 59, 63, 66, 67], "search_and_summarize_pipelin": 68, "searchabl": 50, "searchandsummarizetest": 68, "second": [15, 16, 33, 38, 51, 57, 59, 65, 66, 68, 70, 74], "section": [10, 15, 16, 18, 19, 24, 37, 52, 56, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73], "see": [2, 8, 9, 10, 11, 15, 16, 18, 24, 27, 28, 29, 32, 33, 35, 36, 37, 42, 44, 45, 46, 47, 48, 49, 57, 59, 61, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73], "seek": [10, 12], "seem": [8, 16, 29, 44, 47, 67], "seen": [8, 9, 11, 60, 72], "select": [7, 15, 16, 36, 52], "self": [9, 10, 11, 15, 16, 19, 52, 64, 65, 66, 67, 68, 70], "sell": 44, "semant": [2, 8, 10, 11, 13, 17, 18, 22, 26, 32, 34, 43, 48, 51, 57, 58, 60, 74], "semantic_express": 57, "semantic_typ": [57, 58, 60], "semantictyp": [16, 30, 59, 66], "semat": [11, 66], "send": [27, 68], "sens": [10, 16, 27, 29, 42, 65, 68, 69], "sentenc": 64, "separ": [15, 32, 45, 73], "seper": 16, "sept": 38, "septemb": 0, "seq": [64, 66, 67, 68, 70], "seq1": [64, 66, 67, 69, 70, 73], "seq1_factori": [64, 70], "seq2": [64, 66, 67, 69, 70, 73], "seq2_factori": [64, 70], "seq3": 73, "seq_num": 66, "sequenc": [0, 2, 8, 10, 11, 29, 64, 65, 66, 69, 70, 73], "sequence1": 67, "sequence2": 67, "sequences_path_mak": 11, "sequenceswithqu": 29, "seri": [24, 35, 36, 59, 63, 70], "serial": [9, 63, 66], "seriou": 67, "serv": [9, 12, 24, 49], "server": [7, 44, 52, 65], "session": 67, "set": [7, 8, 9, 11, 16, 18, 27, 30, 31, 32, 41, 42, 44, 50, 51, 57, 58, 59, 60, 63, 65, 66, 67, 68, 69, 70, 72, 73], "set_index": [68, 73], "set_path_mak": 11, "setup": [45, 58, 68], "setupi": 27, "setuptool": [27, 45], "sever": [2, 19, 35, 43, 45, 58, 59, 68, 73], "shannon": 33, "shannon_vector": 33, "shape": 67, "share": [4, 10, 15, 18, 22, 37, 38, 42, 44, 63, 68, 69, 72, 74], "sharp": 16, "sharp_fillet": 16, "sharpen": 16, "shell": 70, "short": [34, 37, 57, 65, 69], "short_descript": [45, 57], "shortcut": 69, "shorthand": 59, "shortli": [67, 74], "shotgun": 2, "should": [8, 10, 11, 12, 15, 16, 19, 22, 24, 27, 29, 31, 32, 33, 35, 36, 37, 38, 42, 44, 45, 46, 47, 49, 50, 52, 57, 59, 60, 63, 65, 66, 67, 69, 70, 72, 73, 74], "shouldn": [11, 27, 29, 66, 67, 73], "show": [14, 16, 18, 19, 44, 49, 67, 72, 73, 74], "shown": [8, 15, 18, 30, 45], "shred": 16, "shutil": 61, "side": [49, 58, 68], "signatur": [14, 22, 32, 35, 60, 66, 67, 68, 69, 73], "signific": [14, 18], "silenc": [67, 72], "silicon": [24, 46], "silli": [16, 66, 72], "silvers1997effect": 57, "similar": [0, 16, 22, 25, 31, 33, 35, 38, 59, 65, 67, 68, 69, 70, 73], "similarli": [24, 29, 66, 67], "simpl": [9, 15, 16, 30, 37, 45, 49, 53, 59, 65, 66, 67, 68, 69, 72, 73], "simpler": [15, 16], "simplest": [11, 68], "simpli": [9, 15, 16, 30, 50, 52, 67, 68], "simplifi": [9, 15, 44, 45, 48, 58, 64, 66, 69], "simultan": [16, 59], "sinc": [16, 27, 29, 35, 43, 47, 52, 57, 64, 65, 66, 67, 68, 73, 74], "singl": [2, 7, 9, 10, 15, 16, 18, 25, 27, 29, 30, 33, 35, 37, 38, 43, 45, 49, 50, 57, 58, 63, 65, 66, 67, 68, 69, 70, 73], "singlednasequ": [29, 64, 66, 69, 70], "singlednasequencetest": 66, "singlednasequencetransformertest": 66, "singlefiledirectoryformat": [11, 55, 57, 66], "singleint": [30, 60], "singlelanepersamplepairedendfastqdirfmt": 18, "singlerecorddnafastadirectoryformat": [64, 66], "singlerecorddnafastaformat": [66, 70], "singlerecorddnafastaformattest": 66, "singleton": [2, 57], "singular": 30, "site": [15, 50, 67, 72], "situat": [9, 11, 16, 57, 60], "size": [15, 67], "skbio": [28, 32, 34, 65, 66, 67, 68, 69, 70], "skd": 14, "skip": [11, 49, 66], "sklearn_n_jobs_descript": 33, "slate": 24, "sleev": 16, "sloan": 24, "slow": [16, 29, 32, 66, 67, 68, 69], "small": [9, 11, 57, 59, 64, 67, 68, 70], "smaller": [16, 59, 68], "smith": [0, 67, 68, 69], "smoke": 49, "sneak": 66, "snif": 11, "so": [7, 10, 11, 15, 16, 18, 19, 25, 27, 29, 30, 31, 32, 34, 35, 36, 43, 44, 45, 49, 50, 52, 57, 58, 59, 60, 64, 65, 66, 67, 68, 69, 70, 72, 73, 74], "softwar": [2, 8, 9, 10, 11, 15, 19, 27, 29, 31, 32, 42, 44, 52, 61, 67, 69, 74], "software_entri": 18, "sole": 63, "solid": 8, "solut": [10, 69], "solv": [10, 29], "some": [2, 4, 8, 9, 10, 11, 14, 15, 16, 18, 24, 25, 27, 29, 32, 33, 35, 36, 38, 42, 43, 44, 45, 48, 49, 50, 52, 57, 60, 64, 65, 66, 67, 68, 69, 70, 72, 73, 74], "some_act": 40, "some_artifact": 60, "some_plugin": 18, "somedai": 16, "someexcept": 40, "someon": [19, 27, 44, 67, 69], "someth": [16, 19, 29, 38, 40, 44, 46, 50, 52, 57, 65, 66, 67, 68, 70, 72, 74], "sometim": [10, 31, 52, 67], "somewher": 52, "soon": [37, 47], "sooner": 31, "sophist": 16, "sorri": 29, "sort": [8, 19, 29, 65, 68, 73], "sort_kei": 16, "sortabl": 50, "soup": 16, "sourc": [2, 7, 15, 18, 22, 28, 32, 33, 35, 37, 43, 46, 52, 53, 54, 55, 57, 58, 59, 60, 61, 63, 67, 74], "source_format": 58, "space": 45, "span": 38, "spars": 7, "spatula": 16, "speak": [52, 56], "spec": 63, "speci": 73, "special": [11, 15, 16, 27, 59, 67, 68], "specif": [2, 5, 7, 8, 10, 15, 16, 18, 24, 27, 31, 32, 36, 37, 38, 41, 45, 46, 49, 50, 57, 63, 66, 67, 68, 70, 72, 73, 74], "specifi": [2, 15, 27, 30, 31, 32, 38, 50, 58, 63, 65, 66, 67, 68], "spend": [44, 65], "split": [24, 29, 40, 49], "split_act": 68, "split_int": 60, "split_siz": 68, "spoon": 16, "spork": 16, "sqlite": 63, "squar": 15, "src": 61, "stabl": 72, "stackoverflow": 45, "stage": [27, 46, 66, 67, 68], "stai": 31, "standalon": 45, "standard": [9, 10, 27, 67], "start": [8, 15, 16, 27, 29, 31, 35, 36, 38, 42, 44, 45, 46, 59, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74], "stat": 65, "state": [7, 8, 10, 12, 69], "statement": [27, 49, 66, 67], "static": [9, 12], "statist": [35, 45], "stderr": [61, 67, 72], "stdin": 16, "stdio": 61, "stdout": [61, 67, 72], "steak": 16, "stem": 67, "step": [7, 8, 10, 15, 24, 27, 36, 37, 38, 40, 41, 45, 51, 58, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73], "still": [2, 5, 10, 16, 19, 24, 29, 30, 37, 38, 47, 64, 65, 67, 68, 71, 72], "stitch": 33, "storag": [8, 66], "store": [9, 11, 13, 17, 18, 19, 27, 29, 31, 57, 58, 59, 60, 63, 65, 66, 67, 68, 69], "stori": 16, "str": [16, 22, 28, 33, 34, 35, 50, 52, 53, 57, 58, 59, 60, 63, 64, 65, 66, 69, 70, 73], "straight": [16, 36, 67, 69, 70], "straightforward": [38, 45], "strategi": [43, 68], "strict": [16, 59], "strictli": [8, 59], "strike": 19, "string": [9, 10, 16, 18, 22, 32, 45, 50, 52, 53, 57, 58, 59, 60, 63, 65, 66, 67, 70], "strip": 30, "structur": [2, 9, 10, 12, 15, 16, 17, 18, 20, 26, 29, 31, 32, 38, 51, 59, 70, 72], "struggl": 66, "stuck": [65, 66, 69], "studi": [11, 15, 50, 63], "stuff": [15, 27], "style": 65, "sub": [2, 8, 33, 47, 66], "subclass": [2, 18, 49, 53, 57, 58, 63, 66, 70], "subcommand": 43, "subdir": 46, "subdirectori": [9, 10, 15, 66], "subject": 50, "submiss": 19, "submit": [7, 19, 27, 37, 44, 59], "submodul": [22, 27, 67], "suboptim": 66, "subsequ": [0, 15, 25, 32, 50, 59, 67, 68, 69], "subset": [11, 59, 68], "substanti": 74, "substitut": 16, "substr": 65, "subsystem": 46, "subtyp": [2, 59], "succeed": 66, "success": [8, 31, 36, 66, 67, 72], "successfulli": [29, 49, 70, 72], "suffer": 32, "suffic": [16, 65], "suffici": [59, 74], "suggest": [5, 16, 31, 38, 44, 57, 68, 72], "suit": [16, 48, 68, 70], "suitabl": 46, "sum": [49, 66], "summar": [65, 69, 70], "summari": [2, 35, 65, 66, 68, 69], "summarize_align": [65, 69], "summarize_alignment_act": 69, "summarizealignmenttest": 65, "sun": 31, "sup": 2, "super": [57, 68], "supersed": 18, "supertyp": 16, "suppli": [57, 63], "support": [2, 4, 7, 9, 10, 11, 15, 18, 19, 24, 31, 36, 37, 40, 41, 42, 44, 45, 46, 49, 50, 51, 52, 57, 59, 61, 63, 66, 67, 69, 70, 74], "suppos": [16, 65, 67], "sure": [29, 31, 36, 42, 46, 49, 64, 66, 72], "surround": 8, "sw": 67, "swap": [14, 16], "sweet": 65, "switch": 7, "sy": [12, 15, 61], "symbol": [31, 38], "symmetr": 66, "sync": [31, 73], "synchron": 12, "synonym": [10, 16, 29], "syntax": [16, 22, 30, 32, 59, 67], "system": [2, 10, 15, 16, 18, 27, 29, 30, 32, 37, 45, 46, 52, 59, 69], "t": [0, 2, 4, 7, 9, 10, 11, 15, 16, 18, 19, 27, 29, 31, 32, 34, 36, 37, 38, 40, 42, 44, 46, 47, 48, 49, 52, 58, 59, 60, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73], "t_in": 59, "t_out": 59, "t_parama": 59, "t_paramb": 59, "taacacccac": [65, 67], "tab": [15, 31, 65, 72, 73], "tabl": [15, 25, 27, 28, 29, 32, 33, 35, 38, 49, 50, 52, 58, 59, 61, 63, 66, 67, 68, 72, 73], "tabul": [50, 68, 73], "tabular": [59, 63, 68], "tabularmsa": [65, 66, 67, 69], "tabulate_las_result": 68, "tabulate_las_results_act": 73, "tag": [15, 18, 45], "take": [18, 28, 29, 31, 32, 33, 35, 42, 43, 44, 47, 57, 60, 63, 64, 65, 66, 67, 69, 70, 73], "taken": 60, "talk": [16, 27], "tar": 9, "target": [24, 31, 36, 37, 38, 41, 42, 44, 58, 70, 72, 74], "task": [8, 16, 19, 41, 65, 74], "taxa": 43, "taxonom": [68, 73], "taxonomi": [52, 67, 73], "team": [15, 19, 24, 46], "tear": 16, "teardown": 58, "tech": 47, "technic": [4, 15, 41, 44, 45, 51, 65, 67, 69], "technologi": 24, "tediou": 66, "tell": [15, 44, 45, 66, 67], "temp_dir": [11, 65], "tempfil": 70, "templat": [7, 24, 27, 42, 51, 60, 65, 71, 74], "temporari": [27, 58, 67], "temptat": 74, "ten": [15, 19], "tend": [44, 57, 64, 68, 70], "term": [2, 10, 15, 19, 25, 29, 31, 38, 63, 66, 67, 70], "termin": [15, 25, 35, 46, 59, 73], "test": [16, 19, 24, 36, 41, 44, 45, 46, 47, 51, 52, 56, 59, 60, 62, 71, 74], "test_alt_gap_extend_penalti": 67, "test_alt_gap_open_penalti": 67, "test_alt_match_scor": 67, "test_alt_mismatch_scor": 67, "test_dir_prefix": 58, "test_dna_to_single_record_fasta_simple1": 64, "test_dna_to_single_record_fasta_simple2": 64, "test_exampl": 70, "test_invalid_default_valid": 66, "test_invalid_max_valid": 66, "test_invalid_min_valid": 66, "test_method": [66, 67, 68], "test_pipelin": 68, "test_semantic_type_registr": 66, "test_simple1": [65, 66, 67, 68], "test_simple1_parallel": 68, "test_simple1_seri": 68, "test_simple2": [66, 67], "test_single_record_fasta_to_dna_simple1": 66, "test_single_record_fasta_to_dna_simple2": 66, "test_transform": [64, 66], "test_types_and_format": 66, "test_visu": 65, "testcas": 58, "testpluginbas": [48, 49, 58, 65, 66, 67, 68, 70], "text": [8, 9, 10, 15, 27, 31, 33, 35, 45, 52, 59, 60, 63, 64, 65, 67, 69, 70, 72, 73], "textfileformat": [2, 11, 52, 55, 57, 66], "textual": 35, "than": [7, 8, 11, 15, 16, 29, 30, 31, 46, 49, 50, 52, 59, 61, 63, 64, 65, 66, 67, 68, 69, 70, 72], "thank": [24, 71], "thei": [2, 8, 10, 11, 15, 16, 18, 19, 27, 28, 29, 30, 34, 36, 37, 38, 42, 44, 47, 50, 52, 57, 59, 60, 61, 64, 65, 66, 67, 68, 69, 70], "them": [7, 8, 10, 12, 15, 16, 18, 19, 24, 27, 30, 31, 32, 36, 38, 40, 42, 49, 52, 53, 64, 65, 66, 67, 68, 69, 70, 73, 74], "theme": 2, "themselv": [8, 15, 49, 67, 68], "theoret": 15, "theori": 68, "therefor": [2, 9, 15, 27, 38, 63, 66, 67, 68, 70], "therein": 31, "thereof": 60, "thermophili": 66, "thi": [2, 4, 5, 7, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 19, 22, 25, 27, 28, 29, 30, 31, 32, 33, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 52, 53, 54, 56, 57, 58, 59, 60, 61, 63, 64, 65, 66, 68, 69, 70, 71, 72, 73, 74], "thing": [7, 11, 15, 16, 19, 27, 29, 31, 37, 44, 49, 52, 57, 60, 65, 66, 67, 68, 69, 70, 73], "think": [12, 16, 19, 29, 50, 64, 66, 67], "third": [29, 68], "thoma": [0, 2], "thorough": 24, "those": [11, 15, 24, 28, 35, 36, 38, 41, 42, 49, 50, 52, 59, 63, 64, 66, 67, 68, 69, 70, 72, 73], "though": [8, 10, 16, 18, 24, 29, 32, 40, 44, 46, 65, 66, 70, 72], "thought": 59, "thread": [40, 59, 69], "three": [8, 11, 15, 19, 25, 29, 49, 60, 66, 67], "three_tabl": 49, "through": [2, 11, 15, 19, 24, 27, 29, 30, 31, 35, 36, 38, 42, 45, 46, 47, 49, 52, 65, 66, 67, 68, 69, 70, 72, 73, 74], "throughout": [24, 67], "throw": 73, "thu": [25, 35, 63], "ti": 47, "tie": 12, "time": [7, 8, 9, 10, 15, 18, 19, 27, 28, 29, 30, 31, 38, 42, 43, 44, 46, 50, 52, 57, 60, 64, 65, 66, 67, 69, 70, 74], "timelin": 19, "timepoint": 19, "timestamp": 15, "tini": [42, 68], "tip": [36, 68], "titl": [15, 57, 65, 67, 73], "tl": 2, "to_ast": [16, 22], "to_datafram": [50, 63, 73], "to_html": 73, "to_import": 60, "to_list": 73, "to_seri": 63, "to_typ": [58, 60, 61, 67], "togeth": [2, 9, 11, 16, 18, 31, 33, 66, 68, 69], "toggl": 69, "toi": [31, 68], "told": 29, "toler": 43, "too": [2, 11, 15, 50, 52, 66], "tool": [0, 2, 4, 10, 15, 18, 27, 29, 41, 42, 43, 47, 51, 66, 67, 68, 69, 70], "top": [8, 15, 27, 31, 36, 37, 65, 66, 67, 68, 69, 70, 72], "topic": [7, 24, 39, 44, 67], "total": [33, 42, 61], "touch": [15, 67], "toward": [66, 70], "traceback": 16, "track": [9, 10, 13, 17, 18, 19, 52, 53, 54, 63], "tracker": [45, 47, 71], "trade": 66, "train": 31, "trait": 18, "tranch": 74, "tranform": 58, "transfer": 16, "transform": [2, 15, 18, 26, 41, 43, 48, 50, 51, 57, 58, 60, 61, 67, 68, 69, 74], "transform_format": [58, 66], "transit": [7, 29, 66], "translat": [8, 70], "transpar": 15, "travers": 15, "treat": [27, 29, 59, 63], "treatment": [63, 67], "tree": [9, 22, 27, 29, 66], "treenod": 28, "tri": [40, 52, 66], "triag": 19, "trick": 16, "tricker": 65, "trigger": 31, "trip": 64, "trivial": [59, 64], "troubleshoot": [31, 38, 42], "true": [16, 22, 58, 59, 60, 63, 67, 68, 73], "truli": 44, "trust": [10, 66, 67], "try": [11, 16, 40, 44, 47, 59, 60, 64, 65, 66, 68, 69, 70, 72, 73], "tsv": [11, 15, 35, 49, 60, 63, 73], "tt": 67, "ttt": 67, "tupl": [22, 32, 33, 57, 59, 63, 69], "ture": 16, "turn": [8, 30, 67, 70], "tutori": [7, 24, 27, 36, 40, 41, 44, 46, 50, 51, 63, 66, 69, 71, 72], "twice": 9, "two": [0, 8, 11, 15, 16, 29, 31, 34, 35, 38, 43, 49, 50, 52, 59, 60, 64, 66, 67, 68, 69, 70, 72, 73], "tx": 64, "txt": [7, 52, 60], "type": [2, 5, 8, 9, 13, 15, 17, 18, 19, 22, 26, 28, 30, 32, 33, 34, 35, 42, 43, 46, 48, 49, 50, 51, 52, 53, 54, 56, 57, 58, 60, 61, 62, 63, 64, 65, 67, 68, 69, 70, 73, 74], "type_frag": 57, "type_from_ast": 22, "typeerror": [11, 16, 22, 60], "typeexpress": 22, "typemap": 59, "typematch": 59, "typevarexp": 59, "typic": [2, 11, 19, 27, 28, 29, 31, 36, 43, 50, 59, 60, 66, 67, 68, 69], "u": [15, 16, 19, 24, 27, 30, 37, 38, 42, 44, 49, 52, 64, 65, 66, 67, 68, 69, 70], "ubiquit": [9, 68], "ubuntu": 46, "ui": [8, 16], "ultim": [16, 27, 42, 44, 47, 70, 72, 74], "ultipl": 67, "uml": 8, "unabl": [5, 16], "unadorn": 16, "unambigu": [52, 66, 69], "unbound": 59, "uncommon": [15, 52], "under": [18, 19, 24, 27, 31, 38, 44, 46, 47, 52, 60, 64, 67, 68, 70], "underli": [11, 16, 33, 34, 49, 61, 65, 67, 68, 69], "underscor": [27, 45, 49], "understand": [8, 10, 12, 15, 16, 19, 24, 29, 31, 64, 67], "understood": 9, "unexpect": 69, "unfamilar": 16, "unfortun": [31, 44], "unicod": [16, 59], "unifi": 50, "unimport": 57, "uninitializedpluginmanagererror": [22, 60], "uninterest": 16, "union": [57, 59], "uniqu": [2, 9, 33, 43, 44, 49, 50, 59, 63, 66], "unit": [2, 27, 31, 44, 45, 49, 68, 69, 70, 71, 72], "unitl": 39, "unittest": [49, 58], "univers": [2, 29, 64], "unix": 2, "unkown": 12, "unless": [16, 18, 33, 45, 46, 59, 72], "unlik": [11, 15, 16, 24, 45, 57, 61, 66, 69, 73], "unnecessari": [66, 68, 73], "unnecessarili": 49, "unpack": [49, 59, 60], "unrecognizedformaterror": 66, "unrel": 16, "unreli": 52, "unroot": [29, 66], "unschedul": 19, "unshred": 16, "unspecifi": [67, 72], "until": [7, 16, 19, 29, 65, 67, 68, 69, 70], "unus": 67, "unusu": 67, "unweighted_unifrac_emperor": 15, "unzip": [10, 15], "up": [9, 12, 16, 18, 19, 27, 30, 31, 37, 41, 47, 49, 50, 51, 58, 64, 65, 66, 68, 69, 73], "upcom": [19, 31], "upda": 49, "updat": [9, 10, 15, 16, 19, 24, 31, 36, 44, 46, 70], "upfront": 52, "upkeep": 19, "upload": 52, "upon": [8, 36], "uppercas": 45, "upstream": [31, 68, 73], "urgent": 19, "url": [0, 24, 37, 38, 45, 57, 60], "us": [2, 4, 7, 8, 9, 10, 11, 12, 14, 15, 16, 18, 19, 22, 24, 25, 27, 29, 32, 33, 34, 35, 36, 37, 41, 42, 43, 44, 45, 46, 48, 49, 51, 52, 54, 56, 57, 58, 59, 60, 61, 63, 64, 65, 67, 69, 70, 72, 73, 74], "usabl": 31, "usag": [2, 7, 29, 41, 51, 56, 57, 58, 62, 64, 67, 68, 69, 71, 72, 74], "usage_vari": 60, "usageact": [49, 60, 70], "usagedriv": 70, "usageexampletest": 70, "usageinput": [49, 60, 70], "usageoutput": [49, 60], "usageoutputnam": [49, 60, 70], "usagevari": [49, 60], "user": [2, 4, 6, 8, 10, 12, 15, 16, 18, 19, 22, 24, 27, 29, 31, 32, 34, 35, 36, 37, 41, 42, 43, 44, 45, 46, 49, 50, 51, 52, 53, 56, 57, 59, 62, 64, 65, 66, 67, 68, 69, 70, 72, 73, 74], "user_support_text": [45, 57], "usual": [7, 8, 16, 31, 38, 45, 52, 57, 59, 60], "utensil": 16, "utf": 65, "util": [10, 14, 15, 19, 31, 38, 50, 51, 56, 58, 60, 62, 66, 67, 68], "utlit": 50, "uuid": [2, 9, 15, 18, 52, 72], "v": [0, 31, 57, 63], "v0": 18, "v1": [11, 18], "v2": 18, "v4": [15, 18], "v5": 18, "val": [11, 49], "valid": [2, 8, 15, 16, 30, 41, 50, 51, 57, 58, 59, 60, 63, 66, 67, 70], "validate_someth": 57, "validation_level_to_n_char": 66, "validation_seq": 66, "validation_seq_len": 66, "validationerror": [11, 22, 55, 57, 66], "vallei": 24, "valu": [2, 11, 15, 16, 22, 30, 31, 32, 33, 35, 37, 38, 40, 45, 46, 49, 50, 52, 53, 59, 60, 63, 65, 67, 68, 69, 70, 72], "valuabl": 15, "valueerror": [11, 58, 63, 66], "vaniti": 60, "var": 46, "var_typ": 60, "varfield": 16, "vari": [32, 45, 52, 66], "variabl": [16, 18, 22, 27, 57, 59, 60, 65, 67, 68, 69, 70], "variad": 18, "variadic_input_simpl": 49, "varianc": 63, "variant": [16, 29, 57, 59], "variant1": 57, "variant2": 57, "variant_of": [16, 59], "variantfield": 59, "variat": 67, "varieti": 9, "variou": [15, 16, 17, 24, 63], "varriabl": 67, "vastli": 7, "ve": [16, 19, 31, 32, 36, 41, 44, 49, 66, 67, 68, 69, 72, 73], "vector": [33, 35, 49], "verb": [2, 43], "verbos": [67, 72], "veri": [8, 9, 11, 16, 24, 29, 30, 31, 32, 33, 35, 44, 45, 57, 65, 66, 67, 68, 69, 70], "verif": 50, "verifi": [34, 65], "version": [2, 7, 8, 9, 10, 15, 17, 19, 20, 31, 38, 44, 45, 49, 52, 57, 66, 67, 72, 73], "versu": 69, "vertic": 8, "via": [2, 5, 8, 32, 36, 37, 45, 49, 50, 53, 57, 58, 64, 68], "video": 29, "view": [2, 7, 10, 12, 15, 19, 27, 29, 30, 33, 50, 52, 54, 57, 58, 59, 60, 64, 65, 66, 67, 68, 70, 72], "view_as_metadata": 60, "view_typ": [33, 54, 60, 64, 68], "viewer": [15, 65, 73], "viewport": 65, "violat": 69, "virtu": 16, "virtual": 15, "visibl": [15, 44], "visit": [46, 57], "visual": [2, 9, 10, 13, 15, 17, 18, 22, 25, 32, 33, 41, 45, 51, 57, 66, 67, 68, 69, 70, 71, 73, 74], "viusal": 65, "vizual": 65, "vm": 15, "vocabulari": [16, 63], "volatil": 50, "volum": 67, "w": [0, 24, 52, 55, 65, 73], "wa": [2, 9, 10, 11, 15, 16, 18, 24, 27, 29, 31, 32, 35, 36, 46, 49, 52, 57, 63, 64, 66, 67, 68, 69, 73], "wai": [4, 7, 10, 11, 12, 15, 16, 22, 27, 29, 30, 31, 36, 37, 38, 42, 44, 46, 49, 52, 59, 60, 63, 65, 66, 67, 68, 69, 70, 71, 72], "wait": [8, 40, 68], "walk": [36, 52, 60, 74], "want": [15, 16, 19, 24, 27, 29, 30, 35, 36, 38, 40, 42, 43, 44, 46, 49, 50, 65, 66, 67, 68, 69, 70, 72, 73, 74], "warn": [12, 30, 66, 67, 69, 70], "warrant": 19, "wast": 29, "watch": 11, "waterman": [0, 67, 68, 69], "we": [4, 5, 7, 8, 9, 10, 11, 12, 15, 16, 18, 19, 24, 27, 28, 29, 30, 31, 32, 33, 36, 37, 38, 40, 42, 43, 44, 46, 47, 49, 50, 52, 57, 64, 65, 66, 67, 68, 69, 70, 72, 73], "web": [2, 7, 15, 36, 52], "websit": [9, 15, 18, 44, 45, 57, 67], "wednesdai": [19, 31], "week": 19, "weekend": 29, "weekli": 19, "weird": 52, "welcom": 5, "well": [2, 7, 9, 10, 11, 15, 16, 19, 29, 31, 42, 43, 44, 50, 63, 64, 65, 66, 67, 74], "went": [29, 65], "were": [2, 9, 15, 16, 18, 40, 52, 57, 59, 65, 66, 68, 70, 72, 73], "weren": 66, "weslei": 0, "what": [2, 8, 9, 10, 16, 19, 27, 29, 31, 32, 34, 36, 37, 38, 44, 49, 52, 57, 59, 60, 64, 65, 66, 68, 69, 70, 72, 73], "whatev": [8, 15, 27, 30, 35, 65, 66, 72], "whatsoev": 66, "when": [2, 7, 8, 9, 10, 11, 12, 15, 16, 18, 22, 27, 28, 29, 30, 31, 35, 37, 40, 42, 43, 44, 45, 49, 50, 52, 57, 58, 59, 61, 63, 64, 65, 66, 67, 68, 69, 70, 72, 73, 74], "whenev": [15, 18, 42, 57, 59], "where": [2, 7, 8, 9, 10, 15, 16, 19, 24, 27, 30, 31, 32, 36, 44, 45, 47, 48, 52, 57, 59, 63, 64, 65, 66, 67, 68, 69, 70, 73], "where_values_miss": 63, "wherev": [5, 16], "whether": [16, 29, 57, 59, 63, 66, 67, 69, 72], "which": [2, 7, 8, 9, 10, 11, 12, 14, 15, 16, 18, 19, 24, 27, 28, 29, 30, 32, 33, 36, 38, 44, 45, 46, 49, 50, 52, 57, 59, 60, 63, 65, 66, 67, 68, 69, 70, 72, 73, 74], "whichev": 42, "while": [2, 5, 9, 10, 11, 15, 16, 29, 31, 38, 42, 44, 45, 58, 65, 67, 69, 70, 74], "who": [15, 24, 42, 46, 52, 66, 70, 74], "whole": [18, 42, 52, 67, 68], "whose": [8, 15, 18, 27, 49], "why": [7, 10, 16, 52, 69, 70], "wide": [10, 45], "widespread": 2, "width": 65, "wikipedia": [2, 52], "wild": 18, "window": 46, "winzip": 10, "wise": 59, "wish": [38, 49, 66], "witcombe2006sword": 57, "within": [2, 7, 8, 9, 11, 15, 16, 18, 19, 22, 28, 30, 31, 38, 43, 45, 47, 49, 50, 59, 60, 63, 69], "without": [2, 9, 10, 15, 16, 27, 29, 30, 57, 59, 65, 66, 67, 68, 74], "won": [15, 19, 37, 47, 52, 65, 66, 67, 68, 72], "wonder": 49, "wood": 0, "word": [2, 10, 15, 16, 27, 44, 67], "work": [2, 3, 4, 7, 8, 10, 11, 15, 16, 19, 24, 28, 29, 30, 31, 36, 37, 38, 42, 43, 44, 45, 46, 49, 50, 52, 58, 59, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74], "workaround": 67, "workflow": [27, 31, 52, 68, 69, 73, 74], "workflow_dispatch": 31, "working_set": 15, "workload": 19, "workspac": 16, "world": [16, 59, 74], "worri": [10, 16, 49], "wors": 29, "worst": 68, "worth": [44, 52, 67, 74], "would": [2, 9, 10, 12, 15, 16, 19, 24, 29, 30, 31, 35, 36, 38, 41, 44, 45, 49, 52, 57, 59, 60, 63, 65, 67, 69, 70, 73], "wouldn": [16, 52, 67, 68], "wrap": [15, 32, 33, 43, 73], "wrapper": [30, 60], "write": [2, 4, 7, 8, 11, 16, 18, 24, 29, 34, 35, 36, 41, 45, 51, 64, 66, 68, 69, 71, 72, 73, 74], "write_csv": 57, "written": [18, 30, 35, 37, 43, 45, 52, 63, 65, 66, 70], "wrong": [15, 29, 65, 66, 73], "wrote": [49, 64, 65, 66, 68, 69, 73], "wsl": 46, "wunsch": [0, 67, 69], "x": 59, "x86_64": 15, "xopen": 15, "y": [52, 59, 69], "yaml": [10, 18, 27, 31, 36, 37, 46], "year": [10, 44, 67], "yet": [9, 10, 16, 19, 30, 31, 49, 57, 66, 67, 68], "yield": 68, "yml": [27, 31, 37, 38, 46], "you": [4, 5, 7, 9, 10, 12, 15, 16, 19, 22, 24, 27, 28, 29, 30, 31, 32, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 52, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74], "your": [0, 4, 7, 16, 27, 29, 30, 32, 35, 40, 41, 43, 49, 50, 51, 52, 57, 59, 64, 66, 67, 68, 69, 71, 73], "yourself": [2, 24, 30, 45, 50, 52, 68, 73], "zero": [2, 16, 59, 63, 67], "zip": [10, 15, 16, 49], "zipfil": 9, "zipp": 15, "zuckerberg": 24}, "titles": ["List of works cited", "Index", "Glossary", "Back matter", "Distribution Development", "Developer documentation", "Docs Development", "User documentation", "QIIME 2 architecture overview", "Anatomy of an Archive", "How Data is Stored", "File Formats and Directory Formats", "Garbage Collection", "Explanations", "Metaprogramming", "Decentralized retrospective provenance tracking", "Semantic Types, Primitives, and Visualizations", "Framework Development", "Archive versions", "QIIME 2 Development and Release Cycle Structure", "References", "Interface Development", "Interface developer API reference", "References", "<em>Developing with QIIME 2</em>", "Types of QIIME 2 Actions", "Explanations", "The structure of QIIME 2 plugin packages", "Transformers", "Semantic types, data types, file formats, and artifact classes", "Use Artifact Collections as Action inputs or outputs", "Automate testing of your plugin", "Create and register a Method", "Create and register a pipeline", "Creating and registering a Transformer", "Create and register a visualizer", "Distribute plugins on GitHub", "Distribute plugins on QIIME 2 Library", "Facilitating installation of your plugin for users", "Defining different Format validation levels", "Handling exceptions in parallel Pipelines", "How-To Guides", "Maximize compatibility between your plugin(s) and existing QIIME 2 distribution(s)", "How to play nicely with other plugins", "Publicize your QIIME 2 plugins (or other QIIME 2-based tools)", "Register a QIIME 2 plugin", "Set up your development environment", "Provide technical support for your users", "How to test QIIME 2 plugins", "Writing Usage Examples", "How to use Metadata", "Plugin Development", "Plugin development anti-patterns", "Citations", "Pipeline Context Object", "Formats", "Plugin Development API", "Plugin &amp; Registration", "Testing", "Types", "Usage Examples", "Utilities", "References", "User Metadata API", "Add a second transformer", "Add a first Visualizer", "Add a new Artifact Class", "Add a first (real) Method", "Add a Pipeline with parallel computing support", "Add a first Pipeline", "Add a Usage Example", "Conclusion", "Create your plugin from a template", "Integrate metadata in Actions", "Tutorial: A step-by-step guide to building your first QIIME 2 plugin"], "titleterms": {"": 42, "0": 18, "1": 18, "2": [8, 10, 18, 19, 24, 25, 27, 37, 38, 42, 44, 45, 46, 48, 74], "3": [18, 67, 70], "4": 18, "5": 18, "6": 18, "7": 18, "A": [8, 50, 67, 74], "In": 9, "The": [9, 15, 22, 27, 30, 63, 73], "To": 41, "__init__": 27, "_method": 27, "_pipelin": 69, "_version": 27, "access": 10, "acknowledg": 24, "action": [15, 22, 25, 30, 31, 57, 60, 65, 67, 69, 73], "activ": 46, "add": [64, 65, 66, 67, 68, 69, 70, 73], "addit": [37, 56, 67], "advanc": 50, "agnost": 18, "align": [66, 67, 68, 70], "amplicon": 46, "an": [9, 16, 30, 38, 45, 65, 66, 67, 69, 73], "analogi": 16, "anatomi": 9, "ani": 38, "annot": 60, "anti": 52, "api": [22, 30, 50, 56, 63, 67, 70], "appli": 68, "ar": 28, "architectur": 8, "archiv": [9, 18], "artifact": [29, 30, 50, 66], "assert": 60, "associ": 11, "autom": [31, 70], "avoid": 69, "awai": 15, "back": 3, "base": 44, "basic": 59, "befor": 37, "best": 19, "between": 42, "bib": 27, "binari": 11, "block": 15, "build": [46, 74], "call": 67, "can": [49, 50], "captur": 15, "categor": 50, "cfg": 27, "check": 10, "choic": 16, "ci": [27, 31], "citat": [27, 53, 67], "cite": 0, "class": [29, 63, 66], "cli": 30, "collect": [12, 30, 59, 60], "column": [50, 63], "combin": 68, "command": [8, 30, 70], "comment": 49, "commun": 44, "compar": 68, "compat": 42, "compon": 8, "comput": 68, "conclus": 71, "conda": 46, "configur": 31, "content": [24, 74], "context": [49, 54], "continu": 31, "contribut": [7, 24, 44, 46], "cookiecutt": 72, "creat": [32, 33, 34, 35, 68, 69, 72], "current": 7, "custom": 38, "cycl": 19, "data": [9, 10, 15, 27, 29, 49, 70], "decentr": 15, "defin": [16, 39, 45, 49, 64, 66, 67, 68, 70], "depend": 59, "detail": 8, "develop": [4, 5, 6, 16, 17, 19, 21, 22, 24, 46, 51, 52, 56, 66], "development": 19, "diagram": 8, "differ": 39, "directori": [11, 66], "discov": 66, "displai": 70, "distribut": [4, 36, 37, 38, 42, 46], "dna": 64, "doc": 6, "docstr": 5, "document": [5, 7, 69], "dr": [64, 65, 66, 67, 68, 69, 70, 73], "drop": 50, "duplic": 69, "dure": 72, "dwq2": 27, "each": 68, "empti": 50, "entri": 45, "environ": [15, 24, 46], "exampl": [15, 48, 49, 60, 70, 73], "except": [22, 40, 63], "execut": 15, "exercis": [65, 66, 67, 69, 70], "exist": [38, 42, 46], "expand": 36, "explan": [13, 26], "extend": 16, "extens": 10, "facilit": 38, "factori": 49, "feedback": 42, "few": 67, "file": [9, 11, 15, 29, 50, 66], "filepath": 52, "filter": 50, "find": 5, "first": [46, 65, 67, 69, 74], "fix": 11, "flowchart": 68, "follow": 8, "format": [11, 18, 29, 39, 52, 55, 66], "forum": 44, "framework": 17, "free": 50, "from": [50, 64, 72], "function": [22, 32, 33, 35, 65, 67], "fund": 24, "garbag": 12, "gener": [50, 61], "get": [24, 42], "gha": 31, "git": [27, 72], "github": [27, 31, 36], "gitignor": 27, "glossari": 2, "goal": 10, "goe": 9, "guarante": 18, "guid": [41, 74], "handl": 40, "help": [24, 44, 50], "hint": 69, "how": [10, 28, 41, 43, 44, 48, 50], "i": [10, 15], "id": 15, "identifi": 9, "import": [9, 60, 66], "index": 1, "individu": 56, "inform": 69, "init": 30, "initi": [60, 72], "input": [10, 22, 30, 52, 68, 70, 73], "instal": [36, 38, 46, 72], "instanti": 45, "instruct": 36, "integr": [31, 73], "interfac": [16, 21, 22, 30, 70], "interoper": 10, "intersect": 16, "issu": 19, "latest": 46, "layout": 11, "level": 39, "librari": [37, 44], "licens": [24, 27], "line": [30, 70], "list": [0, 56], "load": 30, "local": 68, "make": [50, 66], "makefil": 27, "manifest": 27, "matter": 3, "maxim": 42, "md": 27, "me": 50, "merg": 50, "metadata": [9, 10, 50, 59, 60, 63, 73], "metagenom": 46, "metaprogram": 14, "method": [32, 67, 68], "misc": 19, "most": 9, "need": 72, "new": [64, 66, 67, 72], "next": 46, "nice": 43, "non": 19, "normal": 50, "note": 16, "number": 68, "numer": 50, "nw": [66, 70], "nw_align": 69, "object": [22, 29, 30, 45, 54, 56, 60], "option": [65, 66, 67, 69, 70, 72, 73], "other": [43, 44, 46], "our": [67, 68], "out": 49, "output": [22, 30, 50, 52], "overview": [8, 45], "packag": 27, "pairwis": 67, "parallel": [40, 68], "paramet": [52, 60], "pattern": 52, "pipelin": [15, 33, 40, 54, 68, 69], "plai": 43, "plan": 7, "plugin": [19, 27, 28, 31, 36, 37, 38, 42, 43, 44, 45, 46, 48, 51, 52, 56, 57, 61, 65, 67, 72, 74], "plugin_setup": [27, 67, 73], "pluginmanag": 22, "point": 45, "post": 44, "practic": 19, "pre": 44, "predic": 59, "prefix": 19, "prerequisit": 46, "primit": [16, 59], "print": 44, "properti": 16, "proven": [9, 10, 15], "provid": [47, 49, 52], "public": 44, "publicli": 66, "pull": 19, "put": 29, "py": [27, 67, 69, 73], "python": [30, 65, 67, 70], "q2": 27, "q2_dwq2": [27, 64], "q2cli": 67, "qiim": [8, 10, 19, 24, 25, 27, 37, 38, 42, 44, 45, 46, 48, 63, 74], "rang": 16, "readm": 27, "real": 67, "recommend": 38, "refactor": 7, "refer": [20, 22, 23, 62], "refin": 16, "regist": [30, 32, 33, 34, 35, 45, 49, 65, 66, 67, 68, 69, 70], "registr": 57, "releas": 19, "repositori": 72, "request": [19, 37], "requir": [37, 38], "result": 60, "resultcollect": 30, "resumpt": 68, "retrospect": 15, "return": 30, "rule": 9, "run": [68, 72], "save": 30, "search": [68, 73], "search_and_summar": 68, "second": [64, 67], "semant": [16, 29, 59, 66], "sequenc": [67, 68], "serial": 68, "set": [24, 46], "setup": 27, "share": 36, "should": 68, "singl": 11, "singlerecorddnafastaformat": 64, "size": 68, "skbio": 64, "skip": 52, "sourc": 5, "specif": 19, "split": 68, "split_sequ": 68, "splitter": 68, "sql": 50, "standard": 19, "statu": 24, "step": [46, 74], "storag": 10, "store": 10, "structur": [19, 27], "subtyp": 16, "summar": [68, 73], "summari": 8, "support": [47, 68], "tabl": 74, "tabulate_las_result": 73, "take": [15, 30, 68], "technic": 47, "templat": [36, 72], "test": [27, 31, 48, 49, 58, 64, 65, 66, 67, 68, 69, 70, 72, 73], "test_method": 27, "text": 11, "them": 44, "thi": [24, 67], "through": 8, "time": 68, "tini": [38, 46], "tl": [64, 65, 66, 67, 68, 69, 70, 73], "togeth": 29, "tool": [44, 72], "top": 38, "topic": 56, "track": 15, "transfer": 10, "transfom": 64, "transform": [28, 34, 64, 66], "try": [49, 67], "tsv": 50, "tutori": [70, 74], "type": [10, 11, 16, 25, 29, 59, 66], "understand": 44, "union": 16, "uniqu": 15, "unit": [64, 65, 66, 67, 73], "up": [24, 46, 67], "updat": [66, 68, 69, 73], "us": [28, 30, 31, 38, 50, 66, 68], "usag": [49, 60, 70, 73], "user": [7, 38, 47, 63], "util": [22, 61], "valid": [10, 11, 39, 52], "variabl": 11, "version": [18, 27, 46], "versu": 68, "viewabl": 50, "visual": [16, 35, 50, 59, 65], "weekli": 31, "what": [15, 67], "why": [9, 15], "work": 0, "wrap": 67, "wrapper": 67, "write": [49, 65, 67, 70], "yaml": [9, 15], "your": [24, 31, 36, 37, 38, 42, 44, 45, 46, 47, 65, 70, 72, 74], "zip": 9}})
\ No newline at end of file