diff --git a/_images/github-about-example.png b/_images/github-about-example.png new file mode 100644 index 00000000..d2b96b3f Binary files /dev/null and b/_images/github-about-example.png differ diff --git a/_sources/plugins/how-to-guides/distribute-on-library.md b/_sources/plugins/how-to-guides/distribute-on-library.md index befe1932..400f9d2f 100644 --- a/_sources/plugins/how-to-guides/distribute-on-library.md +++ b/_sources/plugins/how-to-guides/distribute-on-library.md @@ -1,51 +1,55 @@ (share-on-qiime2-library)= # Distribute plugins on QIIME 2 Library -Distributing your plugin on the QIIME 2 Library is a simple process that requires your plugin to conform to the following standards. +Distributing your plugin on the QIIME 2 Library is a great way to share your plugin with the QIIME 2 community, and we are regularly adding new functionality to make "the Library" more useful for both users and developers. -## A GitHub repo +Having your plugin listed on the Library requires a few specific things, but as long as these are in place it's a simple process. -Your plugin must exist as a GitHub repo. Please consult the [](share-on-github) documentation if you need help with this. +## Requirements before requesting the addition of your plugin to the Library -## A GitHub about section - -Your GitHub repo must have an about section. - -This will be used as the short description for your plugin in Library. It should be 300 or so characters max and should describe what your plugin is. - -## A top level README - -Your GitHub repo must contain a top level README. This README must be written in GitHub MarkDown. - -This will be rendered as MarkDown on Library and should give a detailed description of your plugin and what it does. - -NOTE: If your README references any resources using paths relative to the root of your repository (images for example) these resources WILL NOT LOAD on QIIME 2 Library. Only resources referenced with absolute URLs will load. This is because we are not cloning and rehosting your assets. We need a valid URL to a resource hosted somewhere online. - -## Conda environment files for Installation - -This is the highest bar to clear to get your plugin hosted on the QIIME 2 Library. - -More detailed instructions on how to do this are provided at [](facilitating-installation). - -In broad strokes, your repo must include environment.yml files installing your plugin for each QIIME 2 release you support using following naming scheme `-qiime2--.yml`. These files must be located in the `/environment-files` folder. - -### Additional requirements for environment files - -1. Your plugin must be fully installable via these environment files with no extra steps required. -2. Your environment files must NOT contain a `name` field. The end user is expected to provide the name of the environment on the command line when they install. - -# How to add a plugin to the QIIME 2 Library -Once you have met the above requirements, open a PR against the [library-plugins](https://github.com/qiime2/library-plugins) GitHub repo adding a `.yml` file to the `plugins` folder. This file must have the following `key: value` pairs: +````{sidebar} +```{figure} ../../_static/github-about-example.png +--- +name: github-about-example +--- +The *About* section of a GitHub repository. +``` +```` + +1. Your plugin's source code must be hosted in a GitHub repository. + See [](share-on-github) if you need help with this. +1. You must have a brief description of your plugin in the *About* field for the repository. + The *About* field will be on the top-right of your repository's front page (see {numref}`github-about-example`). + This will be used as the short description for your plugin in Library and should be about 300 characters long at the most. +1. You must have a top-level `README.md` in your repository, and this file must be written in [GitHub-flavored Markdown](https://docs.github.com/en/get-started/writing-on-github/getting-started-with-writing-and-formatting-on-github/basic-writing-and-formatting-syntax). + This will be rendered as Markdown on Library and should give a detailed description of your plugin and what it does. + If your `README.md` file references any resources (such as images) using paths relative to the root of your repository, these resources WILL NOT LOAD on the Library. + Only resources referenced with absolute URLs will load. +1. Conda environment files must be provided for installation, and they must meet a few formatting requirements. + This is the highest bar to clear to have your plugin be compatible with the QIIME 2 Library. + * Your repository must include environment YAML files for each QIIME 2 release you support using the naming scheme `-qiime2--.yml`. + These files must be located in your repository's `/environment-files` folder. + More detailed instructions on how to do this are provided in [](facilitating-installation). + One feature that we're working on adding to the Library is a system that can automatically submit PRs against your plugin repository to add new environment files when new QIIME 2 releases come out, to help you keep your plugin up-to-date with QIIME 2 - more on this soon! + * Your plugin must be fully installable via these environment files with no extra steps required. + If this isn't possible, you can still distribute your plugin in other ways (e.g., see [](share-on-github)), but it won't work with the QIIME 2 Library. + * Your environment files must *not* contain a `name` field. + The install instructions that are created by the Library will include a name for the environment. + +## Requesting addition of your plugin to the Library + +Once you have met the above requirements, open a pull request against the [library-plugins](https://github.com/qiime2/library-plugins) GitHub repository. +Your pull request should add a `.yml` file to the `plugins` directory in that repository containing the following key-value pairs: ``` -owner: -name: +owner: +name: branch: -docs: +docs: ``` -## Example PR +This [pull request](https://github.com/qiime2/library-plugins/pull/3/files) illustrates the addition of a plugin to the library in a single atomic commit, and can be used as an example for how to create your pull request. -An [example PR](https://github.com/qiime2/library-plugins/pull/3) showing the addition of a plugin to the library in a single atomic commit. - -NOTE: Your plugin must be compliant with the above specifications for us to merge your PR. +```{warning} +Your plugin must be compliant with the above specifications for us to merge your pull request. +``` diff --git a/_static/github-about-example.png b/_static/github-about-example.png new file mode 100644 index 00000000..d2b96b3f Binary files /dev/null and b/_static/github-about-example.png differ diff --git a/back-matter/bibliography.html b/back-matter/bibliography.html index e16db72e..97cd8297 100644 --- a/back-matter/bibliography.html +++ b/back-matter/bibliography.html @@ -182,7 +182,6 @@
  • Set up your development environment
  • Distribute plugins on GitHub
  • Distribute plugins on QIIME 2 Library
    • -
  • Provide technical support for your users
  • Maximize compatibility between your plugin(s) and existing QIIME 2 distribution(s)
  • Facilitating installation of your plugin for users
    • diff --git a/back-matter/genindex.html b/back-matter/genindex.html index 05ab1148..32e10f8b 100644 --- a/back-matter/genindex.html +++ b/back-matter/genindex.html @@ -181,7 +181,6 @@
  • Set up your development environment
  • Distribute plugins on GitHub
  • Distribute plugins on QIIME 2 Library
    • -
  • Provide technical support for your users
  • Maximize compatibility between your plugin(s) and existing QIIME 2 distribution(s)
  • Facilitating installation of your plugin for users
    • diff --git a/back-matter/glossary.html b/back-matter/glossary.html index 850bf7e0..5644e714 100644 --- a/back-matter/glossary.html +++ b/back-matter/glossary.html @@ -182,7 +182,6 @@
  • Set up your development environment
  • Distribute plugins on GitHub
  • Distribute plugins on QIIME 2 Library
    • -
  • Provide technical support for your users
  • Maximize compatibility between your plugin(s) and existing QIIME 2 distribution(s)
  • Facilitating installation of your plugin for users
    • diff --git a/back-matter/intro.html b/back-matter/intro.html index d671c9d7..ab0aa109 100644 --- a/back-matter/intro.html +++ b/back-matter/intro.html @@ -182,7 +182,6 @@
  • Set up your development environment
  • Distribute plugins on GitHub
  • Distribute plugins on QIIME 2 Library
    • -
  • Provide technical support for your users
  • Maximize compatibility between your plugin(s) and existing QIIME 2 distribution(s)
  • Facilitating installation of your plugin for users
    • diff --git a/ci/intro.html b/ci/intro.html index c04d97e9..364a81ea 100644 --- a/ci/intro.html +++ b/ci/intro.html @@ -182,7 +182,6 @@
  • Set up your development environment
  • Distribute plugins on GitHub
  • Distribute plugins on QIIME 2 Library
    • -
  • Provide technical support for your users
  • Maximize compatibility between your plugin(s) and existing QIIME 2 distribution(s)
  • Facilitating installation of your plugin for users
    • diff --git a/docs/developer-documentation.html b/docs/developer-documentation.html index fb27b98d..079830bb 100644 --- a/docs/developer-documentation.html +++ b/docs/developer-documentation.html @@ -182,7 +182,6 @@
  • Set up your development environment
  • Distribute plugins on GitHub
  • Distribute plugins on QIIME 2 Library
    • -
  • Provide technical support for your users
  • Maximize compatibility between your plugin(s) and existing QIIME 2 distribution(s)
  • Facilitating installation of your plugin for users
    • diff --git a/docs/intro.html b/docs/intro.html index 13ffe50b..6e1d0024 100644 --- a/docs/intro.html +++ b/docs/intro.html @@ -182,7 +182,6 @@
  • Set up your development environment
  • Distribute plugins on GitHub
  • Distribute plugins on QIIME 2 Library
    • -
  • Provide technical support for your users
  • Maximize compatibility between your plugin(s) and existing QIIME 2 distribution(s)
  • Facilitating installation of your plugin for users
    • diff --git a/docs/user-documentation.html b/docs/user-documentation.html index 34c870e9..19a398fa 100644 --- a/docs/user-documentation.html +++ b/docs/user-documentation.html @@ -182,7 +182,6 @@
  • Set up your development environment
  • Distribute plugins on GitHub
  • Distribute plugins on QIIME 2 Library
    • -
  • Provide technical support for your users
  • Maximize compatibility between your plugin(s) and existing QIIME 2 distribution(s)
  • Facilitating installation of your plugin for users
    • diff --git a/framework/explanations/architecture.html b/framework/explanations/architecture.html index c99f2ff0..211ef156 100644 --- a/framework/explanations/architecture.html +++ b/framework/explanations/architecture.html @@ -182,7 +182,6 @@
  • Set up your development environment
  • Distribute plugins on GitHub
  • Distribute plugins on QIIME 2 Library
    • -
  • Provide technical support for your users
  • Maximize compatibility between your plugin(s) and existing QIIME 2 distribution(s)
  • Facilitating installation of your plugin for users
    • @@ -445,7 +444,7 @@

    Contents

    ../../_images/simple_component_diagram.svg
    -

    Fig. 1 Box and Arrow diagram of QIIME 2 components. +

    Fig. 2 Box and Arrow diagram of QIIME 2 components. Interfaces only interact with plugins through the framework, which will invoke plugin behavior as needed. Solid arrows are direct dependency. Dash-dotted arrows are a deferred dependency (via entry-point).#

    @@ -467,7 +466,7 @@

    Detailed Component Diagram ../../_images/complex_component_diagram.svg
    -

    Fig. 2 Detailed Box and Arrow diagram of QIIME 2 components. +

    Fig. 3 Detailed Box and Arrow diagram of QIIME 2 components. Solid arrows are a direct dependency. Dash-dotted arrows are a deferred dependency (via entry-point). Dashed rounded boxes surrounding other components indicate a group of like-components. @@ -491,7 +490,7 @@

    Following A Command Through QIIME 2 ../../_images/action_call_sequence_diagram.svg
    -

    Fig. 3 UML Sequence Diagram of an action-call in QIIME 2 +

    Fig. 4 UML Sequence Diagram of an action-call in QIIME 2 This diagram is read from top to bottom, which indicates the passage of some non-specific amount of time. Components are vertical columns. An activated state of a component is indicated by a narrow box. diff --git a/framework/explanations/archives.html b/framework/explanations/archives.html index 6cc25253..4b5060e8 100644 --- a/framework/explanations/archives.html +++ b/framework/explanations/archives.html @@ -182,7 +182,6 @@

  • Set up your development environment
  • Distribute plugins on GitHub
  • Distribute plugins on QIIME 2 Library
    • -
  • Provide technical support for your users
  • Maximize compatibility between your plugin(s) and existing QIIME 2 distribution(s)
  • Facilitating installation of your plugin for users
    • @@ -466,11 +465,11 @@

    Contents

    In addition to storing data, QIIME 2 stores metadata including what actions were performed to generate the current Result, what versions of QIIME 2 and other dependencies were used, and what references to cite if the data is used in a publication (for example)

    As it relates to the archive structure, the /provenance/ directory is designed to be self-contained and self-referential. This means that it duplicates some of the information available in the root of the archive, but this simplifies the code responsible for tracking and reading provenance.

    -

    Fig. 4 illustrates this idea.

    +

    Fig. 5 illustrates this idea.

    ../../_images/archive-structure.svg
    -

    Fig. 4 Description of the QIIME 2 archive structure.#

    +

    Fig. 5 Description of the QIIME 2 archive structure.#

    Looking closely we see the previously described /data/ directory and metadata.yaml file, in addition to a VERSION file (described below), and the /provenance/ directory in question.

    diff --git a/framework/explanations/data-storage.html b/framework/explanations/data-storage.html index f12822f6..6f8269ea 100644 --- a/framework/explanations/data-storage.html +++ b/framework/explanations/data-storage.html @@ -182,7 +182,6 @@
  • Set up your development environment
  • Distribute plugins on GitHub
  • Distribute plugins on QIIME 2 Library
    • -
  • Provide technical support for your users
  • Maximize compatibility between your plugin(s) and existing QIIME 2 distribution(s)
  • Facilitating installation of your plugin for users
    • diff --git a/framework/explanations/formats.html b/framework/explanations/formats.html index 95a1ee24..51c919eb 100644 --- a/framework/explanations/formats.html +++ b/framework/explanations/formats.html @@ -182,7 +182,6 @@
  • Set up your development environment
  • Distribute plugins on GitHub
  • Distribute plugins on QIIME 2 Library
    • -
  • Provide technical support for your users
  • Maximize compatibility between your plugin(s) and existing QIIME 2 distribution(s)
  • Facilitating installation of your plugin for users
    • diff --git a/framework/explanations/garbage-collection.html b/framework/explanations/garbage-collection.html index 901d3398..6c29cb4b 100644 --- a/framework/explanations/garbage-collection.html +++ b/framework/explanations/garbage-collection.html @@ -182,7 +182,6 @@
  • Set up your development environment
  • Distribute plugins on GitHub
  • Distribute plugins on QIIME 2 Library
    • -
  • Provide technical support for your users
  • Maximize compatibility between your plugin(s) and existing QIIME 2 distribution(s)
  • Facilitating installation of your plugin for users
    • diff --git a/framework/explanations/intro.html b/framework/explanations/intro.html index 338e3496..f4504c79 100644 --- a/framework/explanations/intro.html +++ b/framework/explanations/intro.html @@ -182,7 +182,6 @@
  • Set up your development environment
  • Distribute plugins on GitHub
  • Distribute plugins on QIIME 2 Library
    • -
  • Provide technical support for your users
  • Maximize compatibility between your plugin(s) and existing QIIME 2 distribution(s)
  • Facilitating installation of your plugin for users
    • diff --git a/framework/explanations/metaprogramming.html b/framework/explanations/metaprogramming.html index 9f30a643..06801abf 100644 --- a/framework/explanations/metaprogramming.html +++ b/framework/explanations/metaprogramming.html @@ -182,7 +182,6 @@
  • Set up your development environment
  • Distribute plugins on GitHub
  • Distribute plugins on QIIME 2 Library
    • -
  • Provide technical support for your users
  • Maximize compatibility between your plugin(s) and existing QIIME 2 distribution(s)
  • Facilitating installation of your plugin for users
    • diff --git a/framework/explanations/provenance.html b/framework/explanations/provenance.html index 658ade9b..08d50cf0 100644 --- a/framework/explanations/provenance.html +++ b/framework/explanations/provenance.html @@ -182,7 +182,6 @@
  • Set up your development environment
  • Distribute plugins on GitHub
  • Distribute plugins on QIIME 2 Library
    • -
  • Provide technical support for your users
  • Maximize compatibility between your plugin(s) and existing QIIME 2 distribution(s)
  • Facilitating installation of your plugin for users
    • @@ -490,7 +489,7 @@

    Why Capture Provenance Data?

    What Provenance Data is Captured?#

    In order to focus on provenance data, we will consider a relatively simple example QIIME 2 Archive structure, with limited non-provenance content. -In Fig. 5 the outer UUID directory of this Artifact holds the data it produced in a data directory (see Data Goes In /data/), and a few “clerical” files (see Anatomy of an Archive). +In Fig. 6 the outer UUID directory of this Artifact holds the data it produced in a data directory (see Data Goes In /data/), and a few “clerical” files (see Anatomy of an Archive). Here we focus on the provenance/ directory.

    -

    In Fig. 5, we use a blue “multiple-files” icon to represent the collection of provenance data associated with one single QIIME 2 action. +

    In Fig. 6, we use a blue “multiple-files” icon to represent the collection of provenance data associated with one single QIIME 2 action. When this icon appears directly within provenance/ the files describe the “current” Result. All remaining icons appear within the artifacts/ subdirectory. These file collections describe all “parent” Results used in the creation of the current Result, and are housed in directories named with their respective UUIDs.

    A detail indicating how we abbreviate one action's provenance records with a single "multiple-files" icon.
    -

    Fig. 6 A detail indicating how we abbreviate one action’s provenance records in Fig. 5.#

    +

    Fig. 7 A detail indicating how we abbreviate one action’s provenance records in Fig. 6.#

    -

    With the exception of the current Result (whose provenance lives in provenance/, every Action is captured in a directory titled with the Action’s UUID Fig. 6.

    +

    With the exception of the current Result (whose provenance lives in provenance/, every Action is captured in a directory titled with the Action’s UUID Fig. 7.

    That directory contains:

    -

    Fig. 7 illustrates the Archive file system.

    +

    Fig. 8 illustrates the Archive file system.

    ../../_images/format-agnostic-archive-structure.svg
    -

    Fig. 7 Box and arrow diagram of the guaranteed components of an archive.#

    +

    Fig. 8 Box and arrow diagram of the guaranteed components of an archive.#

    The VERSION file format is described above.

    @@ -470,11 +469,11 @@

    Version-agnostic format guarantees/<UUID>/metadata.yaml.

  • The ArchiveFormat class in v0.py offers convenience methods for loading and parsing metadata.yaml files.

    • -

    Fig. 8 illustrates the format of a Version 0 Archive.

    +

    Fig. 9 illustrates the format of a Version 0 Archive.

    ../../_images/v0-archive-format.svg
    -

    Fig. 8 Box and arrow diagram of a v0 archive.#

    +

    Fig. 9 Box and arrow diagram of a v0 archive.#

    @@ -492,19 +491,19 @@

    Version-agnostic format guaranteesmetadata.yaml, action.yaml and VERSION files are captured for the current Result and each of its ancestors. Each Result’s action.yaml file and associated data artifacts (e.g. sample metadata) are stored in an action directory alongside that Result’s VERSION and metadata.yaml. Considered together, we can describe these as “provenance files”. -This structure is illustrated in Fig. 9.

    +This structure is illustrated in Fig. 10.

    ../../_images/v1-archive-provenance-format.svg
    -

    Fig. 9 Box and arrow diagram of the provenance files in a v1 archive. +

    Fig. 10 Box and arrow diagram of the provenance files in a v1 archive. The blue “multiple files” icon represents all provenance files associated with a single action (e.g. the current action, or one of its ancestors).#

    -

    The structure of V1 Archives as a whole is illustrated in Fig. 10.

    +

    The structure of V1 Archives as a whole is illustrated in Fig. 11.

    ../../_images/v1-v4-archive-format.svg
    -

    Fig. 10 Box and arrow diagram of a v1 archive.#

    +

    Fig. 11 Box and arrow diagram of a v1 archive.#

    Provenance files for the current Result are stored in /<UUID>/provenance/. Provenance files for each ancestor Result are stored in directory at /<root_UUID>/provenance/artifacts/<ancestor_UUID>/.

    @@ -539,10 +538,10 @@

    Version-agnostic format guarantees ../../_images/v4-archive-provenance-format.svg
    -

    Fig. 11 Box and arrow diagram of the provenance files in a v4 archive.#

    +

    Fig. 12 Box and arrow diagram of the provenance files in a v4 archive.#

    -

    The overall directory structure remains identical to a v1 archive (Fig. 9).

    +

    The overall directory structure remains identical to a v1 archive (Fig. 10).

    Result-specific citation tags are also written to the transformers and environment sections of the action.yaml files, for the current Result and for all ancestors with registered citations. A new custom !cite '<citation key>' tag is use to support this in YAML.

    A transformers section is added between the action and environment sections of action.yaml. @@ -591,11 +590,11 @@

    Version-agnostic format guaranteesae0d0e26da5b84a6c0722148789c51e0 provenance/artifacts/f6105891-2c00-4886-b733-6dada99d0c81/action/action.yaml -

    Fig. 12 illustrates the V5 Archive.

    +

    Fig. 13 illustrates the V5 Archive.

    ../../_images/v5-archive-format.svg
    -

    Fig. 12 Box and arrow diagram of a v5 archive.#

    +

    Fig. 13 Box and arrow diagram of a v5 archive.#

    diff --git a/framework/references/intro.html b/framework/references/intro.html index 3de06e14..1d7738da 100644 --- a/framework/references/intro.html +++ b/framework/references/intro.html @@ -182,7 +182,6 @@
  • Set up your development environment
  • Distribute plugins on GitHub
  • Distribute plugins on QIIME 2 Library
    • -
  • Provide technical support for your users
  • Maximize compatibility between your plugin(s) and existing QIIME 2 distribution(s)
  • Facilitating installation of your plugin for users
    • diff --git a/genindex.html b/genindex.html index df24b36f..7e0e7ba5 100644 --- a/genindex.html +++ b/genindex.html @@ -189,7 +189,6 @@
  • Set up your development environment
  • Distribute plugins on GitHub
  • Distribute plugins on QIIME 2 Library
    • -
  • Provide technical support for your users
  • Maximize compatibility between your plugin(s) and existing QIIME 2 distribution(s)
  • Facilitating installation of your plugin for users
    • diff --git a/interfaces/intro.html b/interfaces/intro.html index 80ac7446..f16974ec 100644 --- a/interfaces/intro.html +++ b/interfaces/intro.html @@ -182,7 +182,6 @@
  • Set up your development environment
  • Distribute plugins on GitHub
  • Distribute plugins on QIIME 2 Library
    • -
  • Provide technical support for your users
  • Maximize compatibility between your plugin(s) and existing QIIME 2 distribution(s)
  • Facilitating installation of your plugin for users
    • diff --git a/interfaces/references/api.html b/interfaces/references/api.html index 7c7b072b..c134cf19 100644 --- a/interfaces/references/api.html +++ b/interfaces/references/api.html @@ -182,7 +182,6 @@
  • Set up your development environment
  • Distribute plugins on GitHub
  • Distribute plugins on QIIME 2 Library
    • -
  • Provide technical support for your users
  • Maximize compatibility between your plugin(s) and existing QIIME 2 distribution(s)
  • Facilitating installation of your plugin for users
    • diff --git a/interfaces/references/intro.html b/interfaces/references/intro.html index db7f7976..cc34aed1 100644 --- a/interfaces/references/intro.html +++ b/interfaces/references/intro.html @@ -182,7 +182,6 @@
  • Set up your development environment
  • Distribute plugins on GitHub
  • Distribute plugins on QIIME 2 Library
    • -
  • Provide technical support for your users
  • Maximize compatibility between your plugin(s) and existing QIIME 2 distribution(s)
  • Facilitating installation of your plugin for users
    • diff --git a/intro.html b/intro.html index 40a8ab11..472f5b82 100644 --- a/intro.html +++ b/intro.html @@ -183,7 +183,6 @@
  • Set up your development environment
  • Distribute plugins on GitHub
  • Distribute plugins on QIIME 2 Library
    • -
  • Provide technical support for your users
  • Maximize compatibility between your plugin(s) and existing QIIME 2 distribution(s)
  • Facilitating installation of your plugin for users
    • diff --git a/objects.inv b/objects.inv index 625ecbe4..f7548283 100644 Binary files a/objects.inv and b/objects.inv differ diff --git a/plugins/explanations/actions.html b/plugins/explanations/actions.html index 2b4abc5a..2b6d3753 100644 --- a/plugins/explanations/actions.html +++ b/plugins/explanations/actions.html @@ -182,7 +182,6 @@
  • Set up your development environment
  • Distribute plugins on GitHub
  • Distribute plugins on QIIME 2 Library
    • -
  • Provide technical support for your users
  • Maximize compatibility between your plugin(s) and existing QIIME 2 distribution(s)
  • Facilitating installation of your plugin for users
    • diff --git a/plugins/explanations/intro.html b/plugins/explanations/intro.html index c96ffdb6..5886fbf6 100644 --- a/plugins/explanations/intro.html +++ b/plugins/explanations/intro.html @@ -182,7 +182,6 @@
  • Set up your development environment
  • Distribute plugins on GitHub
  • Distribute plugins on QIIME 2 Library
    • -
  • Provide technical support for your users
  • Maximize compatibility between your plugin(s) and existing QIIME 2 distribution(s)
  • Facilitating installation of your plugin for users
    • diff --git a/plugins/explanations/package-structure.html b/plugins/explanations/package-structure.html index a391e683..4257892e 100644 --- a/plugins/explanations/package-structure.html +++ b/plugins/explanations/package-structure.html @@ -182,7 +182,6 @@
  • Set up your development environment
  • Distribute plugins on GitHub
  • Distribute plugins on QIIME 2 Library
    • -
  • Provide technical support for your users
  • Maximize compatibility between your plugin(s) and existing QIIME 2 distribution(s)
  • Facilitating installation of your plugin for users
    • diff --git a/plugins/explanations/transformers.html b/plugins/explanations/transformers.html index c45f9146..9e32b41d 100644 --- a/plugins/explanations/transformers.html +++ b/plugins/explanations/transformers.html @@ -182,7 +182,6 @@
  • Set up your development environment
  • Distribute plugins on GitHub
  • Distribute plugins on QIIME 2 Library
    • -
  • Provide technical support for your users
  • Maximize compatibility between your plugin(s) and existing QIIME 2 distribution(s)
  • Facilitating installation of your plugin for users
    • diff --git a/plugins/explanations/types-of-types.html b/plugins/explanations/types-of-types.html index 0cc82b52..8a5ca386 100644 --- a/plugins/explanations/types-of-types.html +++ b/plugins/explanations/types-of-types.html @@ -182,7 +182,6 @@
  • Set up your development environment
  • Distribute plugins on GitHub
  • Distribute plugins on QIIME 2 Library
    • -
  • Provide technical support for your users
  • Maximize compatibility between your plugin(s) and existing QIIME 2 distribution(s)
  • Facilitating installation of your plugin for users
    • diff --git a/plugins/how-to-guides/artifact-collections-as-io.html b/plugins/how-to-guides/artifact-collections-as-io.html index cbbb6cad..2c57409d 100644 --- a/plugins/how-to-guides/artifact-collections-as-io.html +++ b/plugins/how-to-guides/artifact-collections-as-io.html @@ -182,7 +182,6 @@
  • Set up your development environment
  • Distribute plugins on GitHub
  • Distribute plugins on QIIME 2 Library
    • -
  • Provide technical support for your users
  • Maximize compatibility between your plugin(s) and existing QIIME 2 distribution(s)
  • Facilitating installation of your plugin for users
    • diff --git a/plugins/how-to-guides/automate-testing.html b/plugins/how-to-guides/automate-testing.html index e76e79f4..bf1aa9be 100644 --- a/plugins/how-to-guides/automate-testing.html +++ b/plugins/how-to-guides/automate-testing.html @@ -182,7 +182,6 @@
  • Set up your development environment
  • Distribute plugins on GitHub
  • Distribute plugins on QIIME 2 Library
    • -
  • Provide technical support for your users
  • Maximize compatibility between your plugin(s) and existing QIIME 2 distribution(s)
  • Facilitating installation of your plugin for users
    • diff --git a/plugins/how-to-guides/create-register-method.html b/plugins/how-to-guides/create-register-method.html index fa6ffc44..244372ee 100644 --- a/plugins/how-to-guides/create-register-method.html +++ b/plugins/how-to-guides/create-register-method.html @@ -182,7 +182,6 @@
  • Set up your development environment
  • Distribute plugins on GitHub
  • Distribute plugins on QIIME 2 Library
    • -
  • Provide technical support for your users
  • Maximize compatibility between your plugin(s) and existing QIIME 2 distribution(s)
  • Facilitating installation of your plugin for users
    • diff --git a/plugins/how-to-guides/create-register-pipeline.html b/plugins/how-to-guides/create-register-pipeline.html index 4f8467d4..c866790c 100644 --- a/plugins/how-to-guides/create-register-pipeline.html +++ b/plugins/how-to-guides/create-register-pipeline.html @@ -182,7 +182,6 @@
  • Set up your development environment
  • Distribute plugins on GitHub
  • Distribute plugins on QIIME 2 Library
    • -
  • Provide technical support for your users
  • Maximize compatibility between your plugin(s) and existing QIIME 2 distribution(s)
  • Facilitating installation of your plugin for users
    • diff --git a/plugins/how-to-guides/create-register-transformer.html b/plugins/how-to-guides/create-register-transformer.html index 138dd5e2..a6dd725b 100644 --- a/plugins/how-to-guides/create-register-transformer.html +++ b/plugins/how-to-guides/create-register-transformer.html @@ -182,7 +182,6 @@
  • Set up your development environment
  • Distribute plugins on GitHub
  • Distribute plugins on QIIME 2 Library
    • -
  • Provide technical support for your users
  • Maximize compatibility between your plugin(s) and existing QIIME 2 distribution(s)
  • Facilitating installation of your plugin for users
    • diff --git a/plugins/how-to-guides/create-register-visualizer.html b/plugins/how-to-guides/create-register-visualizer.html index 5a328172..e7f4a67d 100644 --- a/plugins/how-to-guides/create-register-visualizer.html +++ b/plugins/how-to-guides/create-register-visualizer.html @@ -182,7 +182,6 @@
  • Set up your development environment
  • Distribute plugins on GitHub
  • Distribute plugins on QIIME 2 Library
    • -
  • Provide technical support for your users
  • Maximize compatibility between your plugin(s) and existing QIIME 2 distribution(s)
  • Facilitating installation of your plugin for users
    • diff --git a/plugins/how-to-guides/distribute-on-gh.html b/plugins/how-to-guides/distribute-on-gh.html index fcdb538a..d4d4a228 100644 --- a/plugins/how-to-guides/distribute-on-gh.html +++ b/plugins/how-to-guides/distribute-on-gh.html @@ -182,7 +182,6 @@
  • Set up your development environment
  • Distribute plugins on GitHub
  • Distribute plugins on QIIME 2 Library
    • -
  • Provide technical support for your users
  • Maximize compatibility between your plugin(s) and existing QIIME 2 distribution(s)
  • Facilitating installation of your plugin for users
    • diff --git a/plugins/how-to-guides/distribute-on-library.html b/plugins/how-to-guides/distribute-on-library.html index 13a205e6..8001b818 100644 --- a/plugins/how-to-guides/distribute-on-library.html +++ b/plugins/how-to-guides/distribute-on-library.html @@ -182,7 +182,6 @@
  • Set up your development environment
  • Distribute plugins on GitHub
  • Distribute plugins on QIIME 2 Library
    • -
  • Provide technical support for your users
  • Maximize compatibility between your plugin(s) and existing QIIME 2 distribution(s)
  • Facilitating installation of your plugin for users
    • @@ -419,22 +418,9 @@

    Contents

    @@ -447,49 +433,58 @@

    Contents

    Distribute plugins on QIIME 2 Library#

    -

    Distributing your plugin on the QIIME 2 Library is a simple process that requires your plugin to conform to the following standards.

    -
    -

    A GitHub repo#

    -

    Your plugin must exist as a GitHub repo. Please consult the Distribute plugins on GitHub documentation if you need help with this.

    -
    -
    -

    A GitHub about section#

    -

    Your GitHub repo must have an about section.

    -

    This will be used as the short description for your plugin in Library. It should be 300 or so characters max and should describe what your plugin is.

    -
    -
    -

    A top level README#

    -

    Your GitHub repo must contain a top level README. This README must be written in GitHub MarkDown.

    -

    This will be rendered as MarkDown on Library and should give a detailed description of your plugin and what it does.

    -

    NOTE: If your README references any resources using paths relative to the root of your repository (images for example) these resources WILL NOT LOAD on QIIME 2 Library. Only resources referenced with absolute URLs will load. This is because we are not cloning and rehosting your assets. We need a valid URL to a resource hosted somewhere online.

    -
    -
    -

    Conda environment files for Installation#

    -

    This is the highest bar to clear to get your plugin hosted on the QIIME 2 Library.

    -

    More detailed instructions on how to do this are provided at Facilitating installation of your plugin for users.

    -

    In broad strokes, your repo must include environment.yml files installing your plugin for each QIIME 2 release you support using following naming scheme <plugin-name>-qiime2-<distro>-<epoch>.yml. These files must be located in the /environment-files folder.

    -
    -

    Additional requirements for environment files#

    +

    Distributing your plugin on the QIIME 2 Library is a great way to share your plugin with the QIIME 2 community, and we are regularly adding new functionality to make “the Library” more useful for both users and developers.

    +

    Having your plugin listed on the Library requires a few specific things, but as long as these are in place it’s a simple process.

    +
    +

    Requirements before requesting the addition of your plugin to the Library#

    +
      -

    1. Your plugin must be fully installable via these environment files with no extra steps required.

      2. -

    2. Your environment files must NOT contain a name field. The end user is expected to provide the name of the environment on the command line when they install.

      3. +

    3. Your plugin’s source code must be hosted in a GitHub repository. +See Distribute plugins on GitHub if you need help with this.

      4. +

    4. You must have a brief description of your plugin in the About field for the repository. +The About field will be on the top-right of your repository’s front page (see Fig. 1). +This will be used as the short description for your plugin in Library and should be about 300 characters long at the most.

      5. +

    5. You must have a top-level README.md in your repository, and this file must be written in GitHub-flavored Markdown. +This will be rendered as Markdown on Library and should give a detailed description of your plugin and what it does. +If your README.md file references any resources (such as images) using paths relative to the root of your repository, these resources WILL NOT LOAD on the Library. +Only resources referenced with absolute URLs will load.

      6. +

    6. Conda environment files must be provided for installation, and they must meet a few formatting requirements. +This is the highest bar to clear to have your plugin be compatible with the QIIME 2 Library.

      +
        +

      • Your repository must include environment YAML files for each QIIME 2 release you support using the naming scheme <plugin-name>-qiime2-<distro>-<epoch>.yml. +These files must be located in your repository’s /environment-files folder. +More detailed instructions on how to do this are provided in Facilitating installation of your plugin for users. +One feature that we’re working on adding to the Library is a system that can automatically submit PRs against your plugin repository to add new environment files when new QIIME 2 releases come out, to help you keep your plugin up-to-date with QIIME 2 - more on this soon!

        • +

      • Your plugin must be fully installable via these environment files with no extra steps required. +If this isn’t possible, you can still distribute your plugin in other ways (e.g., see Distribute plugins on GitHub), but it won’t work with the QIIME 2 Library.

        • +

      • Your environment files must not contain a name field. +The install instructions that are created by the Library will include a name for the environment.

        • +
      +
    -
    -
    -
    -

    How to add a plugin to the QIIME 2 Library#

    -

    Once you have met the above requirements, open a PR against the library-plugins GitHub repo adding a <my-plugin-name>.yml file to the plugins folder. This file must have the following key: value pairs:

    -
    owner: <repo-owner>
-name: <repo-name>
+
    
+
    Requesting addition of your plugin to the Library#
    
+
    Once you have met the above requirements, open a pull request against the library-plugins GitHub repository.
+Your pull request should add a <my-plugin-name>.yml file to the plugins directory in that repository containing the following key-value pairs:
    
+
    owner: <repository-owner>
+name: <repository-name>
 branch: <target-branch>
-docs: <latest-docs-url>
+docs: <latest-documentation-url>
 
    
 
    
-
    
-
    Example PR#
    
-
    An example PR showing the addition of a plugin to the library in a single atomic commit.
    
-
    NOTE: Your plugin must be compliant with the above specifications for us to merge your PR.
    
+
    This pull request illustrates the addition of a plugin to the library in a single atomic commit, and can be used as an example for how to create your pull request.
    
+
    
+
    Warning
    
+
    Your plugin must be compliant with the above specifications for us to merge your pull request.
    
+
    
 
    
 
    
 
@@ -558,22 +553,9 @@ 
    Example PR
     
-
    diff --git a/plugins/how-to-guides/facilitate-installation.html b/plugins/how-to-guides/facilitate-installation.html index 8904fd96..a487566f 100644 --- a/plugins/how-to-guides/facilitate-installation.html +++ b/plugins/how-to-guides/facilitate-installation.html @@ -182,7 +182,6 @@
  • Set up your development environment
  • Distribute plugins on GitHub
  • Distribute plugins on QIIME 2 Library
    • -
  • Provide technical support for your users
  • Maximize compatibility between your plugin(s) and existing QIIME 2 distribution(s)
  • Facilitating installation of your plugin for users
    • diff --git a/plugins/how-to-guides/format-validation-levels.html b/plugins/how-to-guides/format-validation-levels.html index eac8def9..42cc94e6 100644 --- a/plugins/how-to-guides/format-validation-levels.html +++ b/plugins/how-to-guides/format-validation-levels.html @@ -182,7 +182,6 @@
  • Set up your development environment
  • Distribute plugins on GitHub
  • Distribute plugins on QIIME 2 Library
    • -
  • Provide technical support for your users
  • Maximize compatibility between your plugin(s) and existing QIIME 2 distribution(s)
  • Facilitating installation of your plugin for users
    • diff --git a/plugins/how-to-guides/handle-exceptions-in-parallel-pipelines.html b/plugins/how-to-guides/handle-exceptions-in-parallel-pipelines.html index 43fd54c3..9aa97dda 100644 --- a/plugins/how-to-guides/handle-exceptions-in-parallel-pipelines.html +++ b/plugins/how-to-guides/handle-exceptions-in-parallel-pipelines.html @@ -182,7 +182,6 @@
  • Set up your development environment
  • Distribute plugins on GitHub
  • Distribute plugins on QIIME 2 Library
    • -
  • Provide technical support for your users
  • Maximize compatibility between your plugin(s) and existing QIIME 2 distribution(s)
  • Facilitating installation of your plugin for users
    • diff --git a/plugins/how-to-guides/intro.html b/plugins/how-to-guides/intro.html index de3d28f2..4c581d68 100644 --- a/plugins/how-to-guides/intro.html +++ b/plugins/how-to-guides/intro.html @@ -182,7 +182,6 @@
  • Set up your development environment
  • Distribute plugins on GitHub
  • Distribute plugins on QIIME 2 Library
    • -
  • Provide technical support for your users
  • Maximize compatibility between your plugin(s) and existing QIIME 2 distribution(s)
  • Facilitating installation of your plugin for users
    • @@ -434,7 +433,6 @@

    How-To Guides

  • Set up your development environment
  • Distribute plugins on GitHub
  • Distribute plugins on QIIME 2 Library
    • -
  • How to add a plugin to the QIIME 2 Library
  • Provide technical support for your users
  • Maximize compatibility between your plugin(s) and existing QIIME 2 distribution(s)
  • Facilitating installation of your plugin for users
    • diff --git a/plugins/how-to-guides/maximize-compatibility.html b/plugins/how-to-guides/maximize-compatibility.html index 3d8c6e93..186254df 100644 --- a/plugins/how-to-guides/maximize-compatibility.html +++ b/plugins/how-to-guides/maximize-compatibility.html @@ -182,7 +182,6 @@
  • Set up your development environment
  • Distribute plugins on GitHub
  • Distribute plugins on QIIME 2 Library
    • -
  • Provide technical support for your users
  • Maximize compatibility between your plugin(s) and existing QIIME 2 distribution(s)
  • Facilitating installation of your plugin for users
    • diff --git a/plugins/how-to-guides/play-nicely-with-others.html b/plugins/how-to-guides/play-nicely-with-others.html index 4e1be0f8..43535821 100644 --- a/plugins/how-to-guides/play-nicely-with-others.html +++ b/plugins/how-to-guides/play-nicely-with-others.html @@ -182,7 +182,6 @@
  • Set up your development environment
  • Distribute plugins on GitHub
  • Distribute plugins on QIIME 2 Library
    • -
  • Provide technical support for your users
  • Maximize compatibility between your plugin(s) and existing QIIME 2 distribution(s)
  • Facilitating installation of your plugin for users
    • diff --git a/plugins/how-to-guides/publicize.html b/plugins/how-to-guides/publicize.html index 375922ec..6e130377 100644 --- a/plugins/how-to-guides/publicize.html +++ b/plugins/how-to-guides/publicize.html @@ -182,7 +182,6 @@
  • Set up your development environment
  • Distribute plugins on GitHub
  • Distribute plugins on QIIME 2 Library
    • -
  • Provide technical support for your users
  • Maximize compatibility between your plugin(s) and existing QIIME 2 distribution(s)
  • Facilitating installation of your plugin for users
    • diff --git a/plugins/how-to-guides/register-a-plugin.html b/plugins/how-to-guides/register-a-plugin.html index 2732c971..f7d374a0 100644 --- a/plugins/how-to-guides/register-a-plugin.html +++ b/plugins/how-to-guides/register-a-plugin.html @@ -182,7 +182,6 @@
  • Set up your development environment
  • Distribute plugins on GitHub
  • Distribute plugins on QIIME 2 Library
    • -
  • Provide technical support for your users
  • Maximize compatibility between your plugin(s) and existing QIIME 2 distribution(s)
  • Facilitating installation of your plugin for users
    • diff --git a/plugins/how-to-guides/set-up-development-environment.html b/plugins/how-to-guides/set-up-development-environment.html index 67c2e73a..296a1cd0 100644 --- a/plugins/how-to-guides/set-up-development-environment.html +++ b/plugins/how-to-guides/set-up-development-environment.html @@ -182,7 +182,6 @@
  • Set up your development environment
  • Distribute plugins on GitHub
  • Distribute plugins on QIIME 2 Library
    • -
  • Provide technical support for your users
  • Maximize compatibility between your plugin(s) and existing QIIME 2 distribution(s)
  • Facilitating installation of your plugin for users
    • diff --git a/plugins/how-to-guides/support-your-users.html b/plugins/how-to-guides/support-your-users.html index 8263a507..04cf937a 100644 --- a/plugins/how-to-guides/support-your-users.html +++ b/plugins/how-to-guides/support-your-users.html @@ -182,7 +182,6 @@
  • Set up your development environment
  • Distribute plugins on GitHub
  • Distribute plugins on QIIME 2 Library
    • -
  • Provide technical support for your users
  • Maximize compatibility between your plugin(s) and existing QIIME 2 distribution(s)
  • Facilitating installation of your plugin for users
    • diff --git a/plugins/how-to-guides/test-plugins.html b/plugins/how-to-guides/test-plugins.html index ba9e0a4c..e0b98994 100644 --- a/plugins/how-to-guides/test-plugins.html +++ b/plugins/how-to-guides/test-plugins.html @@ -182,7 +182,6 @@
  • Set up your development environment
  • Distribute plugins on GitHub
  • Distribute plugins on QIIME 2 Library
    • -
  • Provide technical support for your users
  • Maximize compatibility between your plugin(s) and existing QIIME 2 distribution(s)
  • Facilitating installation of your plugin for users
    • diff --git a/plugins/how-to-guides/usage-examples.html b/plugins/how-to-guides/usage-examples.html index 0d860322..432c238e 100644 --- a/plugins/how-to-guides/usage-examples.html +++ b/plugins/how-to-guides/usage-examples.html @@ -182,7 +182,6 @@
  • Set up your development environment
  • Distribute plugins on GitHub
  • Distribute plugins on QIIME 2 Library
    • -
  • Provide technical support for your users
  • Maximize compatibility between your plugin(s) and existing QIIME 2 distribution(s)
  • Facilitating installation of your plugin for users
    • diff --git a/plugins/how-to-guides/use-metadata.html b/plugins/how-to-guides/use-metadata.html index 26a0473a..85922c54 100644 --- a/plugins/how-to-guides/use-metadata.html +++ b/plugins/how-to-guides/use-metadata.html @@ -182,7 +182,6 @@
  • Set up your development environment
  • Distribute plugins on GitHub
  • Distribute plugins on QIIME 2 Library
    • -
  • Provide technical support for your users
  • Maximize compatibility between your plugin(s) and existing QIIME 2 distribution(s)
  • Facilitating installation of your plugin for users
    • diff --git a/plugins/intro.html b/plugins/intro.html index eb5e4e08..54306ea1 100644 --- a/plugins/intro.html +++ b/plugins/intro.html @@ -182,7 +182,6 @@
  • Set up your development environment
  • Distribute plugins on GitHub
  • Distribute plugins on QIIME 2 Library
    • -
  • Provide technical support for your users
  • Maximize compatibility between your plugin(s) and existing QIIME 2 distribution(s)
  • Facilitating installation of your plugin for users
    • @@ -442,7 +441,6 @@

    Plugin Development

  • Set up your development environment
  • Distribute plugins on GitHub
  • Distribute plugins on QIIME 2 Library
    • -
  • How to add a plugin to the QIIME 2 Library
  • Provide technical support for your users
  • Maximize compatibility between your plugin(s) and existing QIIME 2 distribution(s)
  • Facilitating installation of your plugin for users
    • diff --git a/plugins/references/antipatterns.html b/plugins/references/antipatterns.html index ee6b9669..ebe45b59 100644 --- a/plugins/references/antipatterns.html +++ b/plugins/references/antipatterns.html @@ -182,7 +182,6 @@
  • Set up your development environment
  • Distribute plugins on GitHub
  • Distribute plugins on QIIME 2 Library
    • -
  • Provide technical support for your users
  • Maximize compatibility between your plugin(s) and existing QIIME 2 distribution(s)
  • Facilitating installation of your plugin for users
    • diff --git a/plugins/references/api/citations.html b/plugins/references/api/citations.html index f1cd1428..fdaf1825 100644 --- a/plugins/references/api/citations.html +++ b/plugins/references/api/citations.html @@ -182,7 +182,6 @@
  • Set up your development environment
  • Distribute plugins on GitHub
  • Distribute plugins on QIIME 2 Library
    • -
  • Provide technical support for your users
  • Maximize compatibility between your plugin(s) and existing QIIME 2 distribution(s)
  • Facilitating installation of your plugin for users
    • diff --git a/plugins/references/api/context.html b/plugins/references/api/context.html index 069ef860..df11eb0a 100644 --- a/plugins/references/api/context.html +++ b/plugins/references/api/context.html @@ -182,7 +182,6 @@
  • Set up your development environment
  • Distribute plugins on GitHub
  • Distribute plugins on QIIME 2 Library
    • -
  • Provide technical support for your users
  • Maximize compatibility between your plugin(s) and existing QIIME 2 distribution(s)
  • Facilitating installation of your plugin for users
    • diff --git a/plugins/references/api/formats.html b/plugins/references/api/formats.html index b8db82da..8e8b0126 100644 --- a/plugins/references/api/formats.html +++ b/plugins/references/api/formats.html @@ -182,7 +182,6 @@
  • Set up your development environment
  • Distribute plugins on GitHub
  • Distribute plugins on QIIME 2 Library
    • -
  • Provide technical support for your users
  • Maximize compatibility between your plugin(s) and existing QIIME 2 distribution(s)
  • Facilitating installation of your plugin for users
    • diff --git a/plugins/references/api/intro.html b/plugins/references/api/intro.html index 28d7b4b1..2db96e6e 100644 --- a/plugins/references/api/intro.html +++ b/plugins/references/api/intro.html @@ -182,7 +182,6 @@
  • Set up your development environment
  • Distribute plugins on GitHub
  • Distribute plugins on QIIME 2 Library
    • -
  • Provide technical support for your users
  • Maximize compatibility between your plugin(s) and existing QIIME 2 distribution(s)
  • Facilitating installation of your plugin for users
    • diff --git a/plugins/references/api/plugin.html b/plugins/references/api/plugin.html index a397fe1f..57291c5f 100644 --- a/plugins/references/api/plugin.html +++ b/plugins/references/api/plugin.html @@ -182,7 +182,6 @@
  • Set up your development environment
  • Distribute plugins on GitHub
  • Distribute plugins on QIIME 2 Library
    • -
  • Provide technical support for your users
  • Maximize compatibility between your plugin(s) and existing QIIME 2 distribution(s)
  • Facilitating installation of your plugin for users
    • diff --git a/plugins/references/api/testing.html b/plugins/references/api/testing.html index 6c5aa722..6c825345 100644 --- a/plugins/references/api/testing.html +++ b/plugins/references/api/testing.html @@ -182,7 +182,6 @@
  • Set up your development environment
  • Distribute plugins on GitHub
  • Distribute plugins on QIIME 2 Library
    • -
  • Provide technical support for your users
  • Maximize compatibility between your plugin(s) and existing QIIME 2 distribution(s)
  • Facilitating installation of your plugin for users
    • diff --git a/plugins/references/api/types.html b/plugins/references/api/types.html index 5ccc504e..ce722884 100644 --- a/plugins/references/api/types.html +++ b/plugins/references/api/types.html @@ -182,7 +182,6 @@
  • Set up your development environment
  • Distribute plugins on GitHub
  • Distribute plugins on QIIME 2 Library
    • -
  • Provide technical support for your users
  • Maximize compatibility between your plugin(s) and existing QIIME 2 distribution(s)
  • Facilitating installation of your plugin for users
    • diff --git a/plugins/references/api/usage.html b/plugins/references/api/usage.html index 97c40b94..9ff3ea7b 100644 --- a/plugins/references/api/usage.html +++ b/plugins/references/api/usage.html @@ -182,7 +182,6 @@
  • Set up your development environment
  • Distribute plugins on GitHub
  • Distribute plugins on QIIME 2 Library
    • -
  • Provide technical support for your users
  • Maximize compatibility between your plugin(s) and existing QIIME 2 distribution(s)
  • Facilitating installation of your plugin for users
    • diff --git a/plugins/references/api/utils.html b/plugins/references/api/utils.html index 2dff603a..33048e6e 100644 --- a/plugins/references/api/utils.html +++ b/plugins/references/api/utils.html @@ -182,7 +182,6 @@
  • Set up your development environment
  • Distribute plugins on GitHub
  • Distribute plugins on QIIME 2 Library
    • -
  • Provide technical support for your users
  • Maximize compatibility between your plugin(s) and existing QIIME 2 distribution(s)
  • Facilitating installation of your plugin for users
    • diff --git a/plugins/references/intro.html b/plugins/references/intro.html index 3039b5c6..bb0c029a 100644 --- a/plugins/references/intro.html +++ b/plugins/references/intro.html @@ -182,7 +182,6 @@
  • Set up your development environment
  • Distribute plugins on GitHub
  • Distribute plugins on QIIME 2 Library
    • -
  • Provide technical support for your users
  • Maximize compatibility between your plugin(s) and existing QIIME 2 distribution(s)
  • Facilitating installation of your plugin for users
    • diff --git a/plugins/references/metadata-api.html b/plugins/references/metadata-api.html index 588c3073..ee39ee22 100644 --- a/plugins/references/metadata-api.html +++ b/plugins/references/metadata-api.html @@ -182,7 +182,6 @@
  • Set up your development environment
  • Distribute plugins on GitHub
  • Distribute plugins on QIIME 2 Library
    • -
  • Provide technical support for your users
  • Maximize compatibility between your plugin(s) and existing QIIME 2 distribution(s)
  • Facilitating installation of your plugin for users
    • diff --git a/plugins/tutorials/add-2nd-transformer.html b/plugins/tutorials/add-2nd-transformer.html index 9f14f845..941d3991 100644 --- a/plugins/tutorials/add-2nd-transformer.html +++ b/plugins/tutorials/add-2nd-transformer.html @@ -182,7 +182,6 @@
  • Set up your development environment
  • Distribute plugins on GitHub
  • Distribute plugins on QIIME 2 Library
    • -
  • Provide technical support for your users
  • Maximize compatibility between your plugin(s) and existing QIIME 2 distribution(s)
  • Facilitating installation of your plugin for users
    • diff --git a/plugins/tutorials/add-alignment-visualizer.html b/plugins/tutorials/add-alignment-visualizer.html index 467e3fbc..41802eb9 100644 --- a/plugins/tutorials/add-alignment-visualizer.html +++ b/plugins/tutorials/add-alignment-visualizer.html @@ -182,7 +182,6 @@
  • Set up your development environment
  • Distribute plugins on GitHub
  • Distribute plugins on QIIME 2 Library
    • -
  • Provide technical support for your users
  • Maximize compatibility between your plugin(s) and existing QIIME 2 distribution(s)
  • Facilitating installation of your plugin for users
    • diff --git a/plugins/tutorials/add-artifact-class.html b/plugins/tutorials/add-artifact-class.html index 5ab9c55b..0bc45788 100644 --- a/plugins/tutorials/add-artifact-class.html +++ b/plugins/tutorials/add-artifact-class.html @@ -182,7 +182,6 @@
  • Set up your development environment
  • Distribute plugins on GitHub
  • Distribute plugins on QIIME 2 Library
    • -
  • Provide technical support for your users
  • Maximize compatibility between your plugin(s) and existing QIIME 2 distribution(s)
  • Facilitating installation of your plugin for users
    • diff --git a/plugins/tutorials/add-nw-align-method.html b/plugins/tutorials/add-nw-align-method.html index 7bd5047d..46ce8a8c 100644 --- a/plugins/tutorials/add-nw-align-method.html +++ b/plugins/tutorials/add-nw-align-method.html @@ -182,7 +182,6 @@
  • Set up your development environment
  • Distribute plugins on GitHub
  • Distribute plugins on QIIME 2 Library
    • -
  • Provide technical support for your users
  • Maximize compatibility between your plugin(s) and existing QIIME 2 distribution(s)
  • Facilitating installation of your plugin for users
    • diff --git a/plugins/tutorials/add-parallel-pipeline.html b/plugins/tutorials/add-parallel-pipeline.html index 64904a06..03fb9a2b 100644 --- a/plugins/tutorials/add-parallel-pipeline.html +++ b/plugins/tutorials/add-parallel-pipeline.html @@ -190,7 +190,6 @@
  • Set up your development environment
  • Distribute plugins on GitHub
  • Distribute plugins on QIIME 2 Library
    • -
  • Provide technical support for your users
  • Maximize compatibility between your plugin(s) and existing QIIME 2 distribution(s)
  • Facilitating installation of your plugin for users
    • diff --git a/plugins/tutorials/add-pipeline.html b/plugins/tutorials/add-pipeline.html index a57d0ca9..069d1ecc 100644 --- a/plugins/tutorials/add-pipeline.html +++ b/plugins/tutorials/add-pipeline.html @@ -182,7 +182,6 @@
  • Set up your development environment
  • Distribute plugins on GitHub
  • Distribute plugins on QIIME 2 Library
    • -
  • Provide technical support for your users
  • Maximize compatibility between your plugin(s) and existing QIIME 2 distribution(s)
  • Facilitating installation of your plugin for users
    • diff --git a/plugins/tutorials/add-usage-examples.html b/plugins/tutorials/add-usage-examples.html index 1f400f7e..58c3c267 100644 --- a/plugins/tutorials/add-usage-examples.html +++ b/plugins/tutorials/add-usage-examples.html @@ -182,7 +182,6 @@
  • Set up your development environment
  • Distribute plugins on GitHub
  • Distribute plugins on QIIME 2 Library
    • -
  • Provide technical support for your users
  • Maximize compatibility between your plugin(s) and existing QIIME 2 distribution(s)
  • Facilitating installation of your plugin for users
    • diff --git a/plugins/tutorials/conclusion.html b/plugins/tutorials/conclusion.html index a80a04b8..2bf1b3a2 100644 --- a/plugins/tutorials/conclusion.html +++ b/plugins/tutorials/conclusion.html @@ -182,7 +182,6 @@
  • Set up your development environment
  • Distribute plugins on GitHub
  • Distribute plugins on QIIME 2 Library
    • -
  • Provide technical support for your users
  • Maximize compatibility between your plugin(s) and existing QIIME 2 distribution(s)
  • Facilitating installation of your plugin for users
    • diff --git a/plugins/tutorials/create-from-template.html b/plugins/tutorials/create-from-template.html index 5d7c1fae..ddb72268 100644 --- a/plugins/tutorials/create-from-template.html +++ b/plugins/tutorials/create-from-template.html @@ -182,7 +182,6 @@
  • Set up your development environment
  • Distribute plugins on GitHub
  • Distribute plugins on QIIME 2 Library
    • -
  • Provide technical support for your users
  • Maximize compatibility between your plugin(s) and existing QIIME 2 distribution(s)
  • Facilitating installation of your plugin for users
    • diff --git a/plugins/tutorials/integrate-metadata.html b/plugins/tutorials/integrate-metadata.html index bffdbd75..73832365 100644 --- a/plugins/tutorials/integrate-metadata.html +++ b/plugins/tutorials/integrate-metadata.html @@ -182,7 +182,6 @@
  • Set up your development environment
  • Distribute plugins on GitHub
  • Distribute plugins on QIIME 2 Library
    • -
  • Provide technical support for your users
  • Maximize compatibility between your plugin(s) and existing QIIME 2 distribution(s)
  • Facilitating installation of your plugin for users
    • diff --git a/plugins/tutorials/intro.html b/plugins/tutorials/intro.html index 678a8379..3364a1d1 100644 --- a/plugins/tutorials/intro.html +++ b/plugins/tutorials/intro.html @@ -182,7 +182,6 @@
  • Set up your development environment
  • Distribute plugins on GitHub
  • Distribute plugins on QIIME 2 Library
    • -
  • Provide technical support for your users
  • Maximize compatibility between your plugin(s) and existing QIIME 2 distribution(s)
  • Facilitating installation of your plugin for users
    • diff --git a/search.html b/search.html index 7203df60..f160668f 100644 --- a/search.html +++ b/search.html @@ -191,7 +191,6 @@
  • Set up your development environment
  • Distribute plugins on GitHub
  • Distribute plugins on QIIME 2 Library
    • -
  • Provide technical support for your users
  • Maximize compatibility between your plugin(s) and existing QIIME 2 distribution(s)
  • Facilitating installation of your plugin for users
    • diff --git a/searchindex.js b/searchindex.js index e2147221..ba642e59 100644 --- a/searchindex.js +++ b/searchindex.js @@ -1 +1 @@ -Search.setIndex({"alltitles": {"": [[9, null], [10, null], [15, null], [26, null], [49, null], [66, null], [66, null], [66, null], [69, null]], "A GitHub about section": [[36, "a-github-about-section"]], "A GitHub repo": [[36, "a-github-repo"]], "A few additional tests": [[66, "a-few-additional-tests"]], "A first test of our plugin action": [[66, "a-first-test-of-our-plugin-action"]], "A second test of our action": [[66, "a-second-test-of-our-action"]], "A top level README": [[36, "a-top-level-readme"]], "A visualizer for free!": [[49, "a-visualizer-for-free"]], "Accessibility and Transferability": [[10, "accessibility-and-transferability"]], "Acknowledgements": [[23, "acknowledgements"]], "Action registration": [[56, "action-registration"]], "Actions": [[21, "actions"], [59, "actions"]], "Activate the conda environment": [[45, "activate-the-conda-environment"]], "Add a Pipeline with parallel computing support": [[67, null]], "Add a Usage Example": [[69, null]], "Add a first (real) Method": [[66, null]], "Add a first Pipeline": [[68, null]], "Add a first Visualizer": [[64, null]], "Add a local alignment search Pipeline": [[67, "add-a-local-alignment-search-pipeline"]], "Add a new Artifact Class": [[65, null]], "Add a second transformer": [[63, null]], "Add an optional input to tabulate_las_results": [[72, "add-an-optional-input-to-tabulate-las-results"]], "Add parallel computing support to search_and_summarize": [[67, "add-parallel-computing-support-to-search-and-summarize"]], "Add tests and documentation": [[68, "add-tests-and-documentation"]], "Add unit tests and update the search-and-summarize usage example": [[72, "add-unit-tests-and-update-the-search-and-summarize-usage-example"]], "Add unit tests of the new transfomer": [[63, "add-unit-tests-of-the-new-transfomer"]], "Additional Objects": [[55, "additional-objects"]], "Additional requirements for environment files": [[36, "additional-requirements-for-environment-files"]], "Advanced Filtering": [[49, "advanced-filtering"]], "Amplicon distribution": [[45, "amplicon-distribution"]], "An Analogy": [[16, "an-analogy"]], "An optional exercise": [[64, "an-optional-exercise"], [65, "an-optional-exercise"], [66, "an-optional-exercise"], [68, "an-optional-exercise"]], "Anatomy of an Archive": [[9, null]], "Annotations": [[59, "annotations"]], "Archive Version 0": [[18, "archive-version-0"]], "Archive Version 1": [[18, "archive-version-1"]], "Archive Version 2": [[18, "archive-version-2"]], "Archive Version 3": [[18, "archive-version-3"]], "Archive Version 4": [[18, "archive-version-4"]], "Archive Version 5": [[18, "archive-version-5"]], "Archive Version 6": [[18, "archive-version-6"]], "Archive Version 7": [[18, "archive-version-7"]], "Archive versions": [[18, null]], "Artifact classes": [[28, "artifact-classes"], [65, "artifact-classes"]], "Associating Formats with a Type": [[11, "associating-formats-with-a-type"]], "Automate testing of your plugin": [[30, null]], "Automated Testing using Continuous Integration (CI) and Github Actions (GHA)": [[30, "automated-testing-using-continuous-integration-ci-and-github-actions-gha"]], "Automated testing of usage examples": [[69, "automated-testing-of-usage-examples"]], "Back matter": [[3, null]], "Basic types": [[58, "basic-types"]], "Binary File Formats": [[11, "binary-file-formats"]], "Building your first plugin": [[45, "building-your-first-plugin"]], "Calling the action with q2cli and the Python 3 API": [[66, "calling-the-action-with-q2cli-and-the-python-3-api"]], "Categorical Metadata Columns": [[49, "categorical-metadata-columns"]], "Choices": [[16, "choices"]], "Citations": [[52, null]], "Collections": [[58, "collections"], [59, "collections"]], "Command line interface": [[69, "command-line-interface"]], "Comments can provide context": [[48, "comments-can-provide-context"]], "Community Contributions on the QIIME 2 Forum": [[43, "community-contributions-on-the-qiime-2-forum"]], "Compare the serial versus parallel run times of the search-and-summarize": [[67, "compare-the-serial-versus-parallel-run-times-of-the-search-and-summarize"]], "Conclusion": [[70, null]], "Conda environment files for Installation": [[36, "conda-environment-files-for-installation"]], "Configure Continuous Integration (CI) testing": [[30, "configure-continuous-integration-ci-testing"]], "Configure weekly automated testing": [[30, "configure-weekly-automated-testing"]], "Contributing": [[23, "contributing"]], "Contributing to existing plugins": [[45, "contributing-to-existing-plugins"]], "Contributing to the current user documentation": [[7, "contributing-to-the-current-user-documentation"]], "Create _pipelines.py and add a Pipeline": [[68, "create-pipelines-py-and-add-a-pipeline"]], "Create a function to register as a Method": [[31, "create-a-function-to-register-as-a-method"]], "Create a function to register as a Pipeline": [[32, "create-a-function-to-register-as-a-pipeline"]], "Create a function to register as a Visualizer": [[34, "create-a-function-to-register-as-a-visualizer"]], "Create and register a Method": [[31, null]], "Create and register a pipeline": [[32, null]], "Create and register a visualizer": [[34, null]], "Create your plugin from a template": [[71, null]], "Creating and registering a Transformer": [[33, null]], "Data Goes In /data/": [[9, "data-goes-in-data"]], "Data factories for usage examples": [[48, "data-factories-for-usage-examples"]], "Decentralized retrospective provenance tracking": [[15, null]], "Define a citation for this action": [[66, "define-a-citation-for-this-action"]], "Define a transformer from skbio.DNA to q2_dwq2.SingleRecordDNAFASTAFormat": [[63, "define-a-transformer-from-skbio-dna-to-q2-dwq2-singlerecorddnafastaformat"]], "Define input data for your usage example": [[69, "define-input-data-for-your-usage-example"]], "Defining a Type": [[16, "defining-a-type"]], "Defining a new directory format": [[65, "defining-a-new-directory-format"]], "Defining a new file format": [[65, "defining-a-new-file-format"]], "Defining a new semantic type": [[65, "defining-a-new-semantic-type"]], "Defining a split Method": [[67, "defining-a-split-method"]], "Defining a usage example for nw-align": [[69, "defining-a-usage-example-for-nw-align"]], "Defining and registering a combine method": [[67, "defining-and-registering-a-combine-method"]], "Defining and registering a transformer": [[65, "defining-and-registering-a-transformer"]], "Defining different Format validation levels": [[38, null]], "Defining the usage example": [[69, "defining-the-usage-example"]], "Defining usage examples": [[48, "defining-usage-examples"]], "Defining your plugin object as an entry point": [[44, "defining-your-plugin-object-as-an-entry-point"]], "Dependent Types": [[58, "dependent-types"]], "Detailed Component Diagram": [[8, "detailed-component-diagram"]], "Developer documentation": [[5, null]], "Developing a new artifact class": [[65, "developing-a-new-artifact-class"]], "Developing with QIIME 2": [[23, null]], "Development status of this content": [[23, null]], "Directory Formats": [[11, "directory-formats"]], "Discovering artifact classes": [[65, "discovering-artifact-classes"]], "Displaying usage examples": [[69, "displaying-usage-examples"]], "Distribute plugins on GitHub": [[35, null]], "Distribute plugins on QIIME 2 Library": [[36, null]], "Distribution Development": [[4, null]], "Docs Development": [[6, null]], "Dropping Empty Columns": [[49, "dropping-empty-columns"]], "Example PR": [[36, "example-pr"]], "Examples": [[47, "examples"]], "Exceptions": [[21, "exceptions"], [62, "exceptions"]], "Expanding on the install instructions": [[35, "expanding-on-the-install-instructions"]], "Explanations": [[13, null], [25, null]], "Extending a Type": [[16, "extending-a-type"]], "Facilitating installation of your plugin for users": [[37, null]], "File Formats": [[11, "file-formats"]], "File Formats and Directory Formats": [[11, null]], "File types (or formats) and data types (or objects)": [[28, "file-types-or-formats-and-data-types-or-objects"]], "Finding docstring sources": [[5, "finding-docstring-sources"]], "Fixed Layouts": [[11, "fixed-layouts"]], "Following A Command Through QIIME 2": [[8, "following-a-command-through-qiime-2"]], "Formats": [[54, null]], "Framework Development": [[17, null]], "Funding": [[23, "funding"]], "Garbage Collection": [[12, null]], "General Utils": [[60, "general-utils"]], "Generating metadata as output from visualizations": [[49, "generating-metadata-as-output-from-visualizations"]], "Getting Feedback on your Plugin": [[41, "getting-feedback-on-your-plugin"]], "Getting Help": [[23, "getting-help"]], "Glossary": [[2, null]], "Goals for data storage in QIIME 2": [[10, "goals-for-data-storage-in-qiime-2"]], "Handling exceptions in parallel Pipelines": [[39, null]], "Help others understand how your tool will help them": [[43, "help-others-understand-how-your-tool-will-help-them"]], "Hint": [[68, null]], "How Data is Stored": [[10, null]], "How are transformers used by a plugin?": [[27, "how-are-transformers-used-by-a-plugin"]], "How can the Metadata API Help Me?": [[49, "how-can-the-metadata-api-help-me"]], "How to add a plugin to the QIIME 2 Library": [[36, "how-to-add-a-plugin-to-the-qiime-2-library"]], "How to play nicely with other plugins": [[42, null]], "How to test QIIME 2 plugins": [[47, null]], "How to use Metadata": [[49, null]], "How-To Guides": [[40, null]], "Importing": [[59, "importing"]], "Index": [[1, null]], "Individual Topics": [[55, "individual-topics"]], "Initializers": [[59, "initializers"]], "Input Validation (Type Checking)": [[10, "input-validation-type-checking"]], "Inputs and outputs": [[21, "inputs-and-outputs"]], "Install Prerequisites": [[45, "install-prerequisites"]], "Install and test your new plugin": [[71, "install-and-test-your-new-plugin"]], "Install the latest development version of the QIIME 2 \u201cTiny Distribution\u201d": [[45, "install-the-latest-development-version-of-the-qiime-2-tiny-distribution"]], "Install the tools needed for templating your plugin": [[71, "install-the-tools-needed-for-templating-your-plugin"]], "Installing other QIIME 2 distributions": [[45, "installing-other-qiime-2-distributions"]], "Installing your plugin on top of an existing QIIME 2 Distribution (recommended)": [[37, "installing-your-plugin-on-top-of-an-existing-qiime-2-distribution-recommended"]], "Installing your plugin using the Tiny Distribution and any custom required plugins": [[37, "installing-your-plugin-using-the-tiny-distribution-and-any-custom-required-plugins"]], "Instantiating a plugin": [[44, "instantiating-a-plugin"]], "Integrate metadata in Actions": [[72, null]], "Interface Developer Note:": [[16, null]], "Interface Development": [[20, null]], "Interface developer API reference": [[21, null]], "Interface development API": [[21, "interface-development-api"]], "Interoperability and Extension": [[10, "interoperability-and-extension"]], "Intersections": [[16, "intersections"]], "License": [[23, "license"]], "List of works cited": [[0, null]], "Making Artifacts Viewable as Metadata": [[49, "making-artifacts-viewable-as-metadata"]], "Making the new type and formats publicly importable": [[65, "making-the-new-type-and-formats-publicly-importable"]], "Maximize compatibility between your plugin(s) and existing QIIME 2 distribution(s)": [[41, null]], "Merging Metadata": [[49, "merging-metadata"]], "Metadata": [[49, "metadata"], [58, "metadata"], [59, "metadata"]], "Metadata Columns": [[49, "metadata-columns"]], "Metadata columns": [[62, "metadata-columns"]], "Metagenome distribution": [[45, "metagenome-distribution"]], "Metaprogramming": [[14, null]], "Next steps": [[45, "next-steps"]], "Normalizing TSV Files": [[49, "normalizing-tsv-files"]], "Numeric Metadata Columns": [[49, "numeric-metadata-columns"]], "Optional exercise": [[69, "optional-exercise"]], "Optionally initialize a git repository during plugin templating": [[71, null]], "Overview": [[44, "overview"]], "Pairwise sequence alignment": [[66, "pairwise-sequence-alignment"]], "Parameter Objects for Usage.action": [[59, "parameter-objects-for"]], "Pipeline Context Object": [[53, null]], "Pipeline Provenance": [[15, "pipeline-provenance"]], "Pipeline provenance example": [[15, "pipeline-provenance-example"]], "Pipeline provenance take-aways": [[15, "pipeline-provenance-take-aways"]], "Pipeline resumption \u267b\ufe0f": [[67, null]], "Plans for refactoring of user documentation": [[7, "plans-for-refactoring-of-user-documentation"]], "Plugin & Registration": [[56, null]], "Plugin API List": [[55, "plugin-api-list"]], "Plugin Development": [[50, null]], "Plugin Development API": [[55, null]], "Plugin Utils": [[60, "plugin-utils"]], "Plugin development anti-patterns": [[51, null]], "Post a pre-print": [[43, "post-a-pre-print"]], "Predicates": [[58, "predicates"], [58, "id1"]], "Primitive Types": [[16, "primitive-types"]], "Primitive types": [[58, "primitive-types"]], "Properties": [[16, "properties"]], "Provenance Goes In /provenance/": [[9, "provenance-goes-in-provenance"]], "Provenance Metadata": [[10, "provenance-metadata"]], "Provide technical support for your users": [[46, null]], "Providing input or output filepaths as parameters": [[51, "providing-input-or-output-filepaths-as-parameters"]], "Publicize your QIIME 2 plugins (or other QIIME 2-based tools)": [[43, null]], "Putting it together": [[28, "putting-it-together"]], "Python 3 API": [[69, "python-3-api"]], "QIIME 2 Library": [[43, "qiime-2-library"]], "QIIME 2 architecture overview": [[8, null]], "Range": [[16, "range"]], "References": [[19, null], [22, null], [61, null]], "Refining a Type": [[16, "refining-a-type"]], "Register a QIIME 2 plugin": [[44, null]], "Register the Method": [[31, "register-the-method"]], "Register the Pipeline": [[68, "register-the-pipeline"]], "Register the Visualizer": [[34, "register-the-visualizer"]], "Register the action in plugin_setup.py": [[66, "register-the-action-in-plugin-setup-py"]], "Register the wrapper function as a plugin action": [[66, "register-the-wrapper-function-as-a-plugin-action"]], "Register your Python function as a plugin action": [[64, "register-your-python-function-as-a-plugin-action"]], "Registering an Action that Returns an Output Collection": [[29, "registering-an-action-that-returns-an-output-collection"]], "Registering an Action that Takes an Input Collection": [[29, "registering-an-action-that-takes-an-input-collection"]], "Registering an artifact class": [[65, "registering-an-artifact-class"]], "Registering split_sequences": [[67, "registering-split-sequences"]], "Registering the Pipeline": [[32, "registering-the-pipeline"]], "Registering the type, formats, and artifact class": [[65, "registering-the-type-formats-and-artifact-class"]], "Registering the usage example": [[69, "registering-the-usage-example"]], "Registering usage examples": [[48, "registering-usage-examples"]], "Results and Assertions": [[59, "results-and-assertions"]], "Rules for identifying an archive": [[9, "rules-for-identifying-an-archive"]], "Run cookiecutter to create your plugin": [[71, "run-cookiecutter-to-create-your-plugin"]], "SQL Filtering": [[49, "sql-filtering"]], "Semantic Properties": [[16, "semantic-properties"]], "Semantic Subtyping": [[16, "semantic-subtyping"]], "Semantic Type": [[58, "semantic-type"]], "Semantic Types, Primitives, and Visualizations": [[16, null]], "Semantic types": [[28, "semantic-types"]], "Semantic types, data types, file formats, and artifact classes": [[28, null]], "Set up your development environment": [[45, null]], "Setting up your development environment": [[23, null]], "Share your plugin on GitHub": [[35, "share-your-plugin-on-github"]], "Should our sequence splitter take the size of each split or the number of splits to create as input?": [[67, null]], "Single File Directory Formats": [[11, "single-file-directory-formats"]], "Skipping format validation": [[51, "skipping-format-validation"]], "Summary": [[8, "summary"]], "Template your plugin": [[35, "template-your-plugin"]], "Testing": [[57, null]], "Testing the parallel Pipeline": [[67, "testing-the-parallel-pipeline"]], "Testing the semantic type and formats": [[65, "testing-the-semantic-type-and-formats"]], "Testing the transformer": [[65, "testing-the-transformer"]], "Testing usage examples": [[48, "testing-usage-examples"]], "Text File Formats": [[11, "text-file-formats"]], "The Most Important File: metadata.yaml": [[9, "the-most-important-file-metadata-yaml"]], "The PluginManager Object": [[21, "the-pluginmanager-object"]], "The ResultCollection object": [[29, "the-resultcollection-object"]], "The action block": [[15, "the-action-block"]], "The action.yaml file": [[15, "the-action-yaml-file"]], "The environment block": [[15, "the-environment-block"]], "The execution block": [[15, "the-execution-block"]], "The input metadata": [[72, "the-input-metadata"]], "The qiime.Metadata class": [[62, "the-qiime-metadata-class"]], "The structure of QIIME 2 plugin packages": [[26, null]], "Transformers": [[27, null]], "Trying it out": [[48, "trying-it-out"]], "Trying the new action": [[66, "trying-the-new-action"]], "Tutorial table of contents": [[73, "tutorial-table-of-contents"]], "Tutorial: A step-by-step guide to building your first QIIME 2 plugin": [[73, null]], "Types": [[58, null]], "Types of QIIME 2 Actions": [[24, null]], "Unions": [[16, "unions"]], "Unique IDs": [[15, "unique-ids"]], "Unit testing": [[65, "unit-testing"]], "Unit testing the visualizer function": [[64, "unit-testing-the-visualizer-function"]], "Update plugin_setup.py": [[72, "update-plugin-setup-py"]], "Update search-and-summarize": [[72, "update-search-and-summarize"]], "Update search-and-summarize to use split and combine Methods": [[67, "update-search-and-summarize-to-use-split-and-combine-methods"]], "Update the nw_align action to avoid duplicating information": [[68, "update-the-nw-align-action-to-avoid-duplicating-information"]], "Updating nw-align to use the new artifact class": [[65, "updating-nw-align-to-use-the-new-artifact-class"]], "Usage Examples": [[59, null]], "Use Artifact Collections as Action inputs or outputs": [[29, null]], "User Metadata API": [[62, null]], "User documentation": [[7, null]], "Using Collections": [[29, "using-collections"]], "Using Collections with the Python API": [[29, "using-collections-with-the-python-api"]], "Using Collections with the command line interface (CLI)": [[29, "using-collections-with-the-command-line-interface-cli"]], "Utilities": [[60, null]], "Utility functions": [[21, "utility-functions"]], "Validation": [[11, "validation"]], "Variable Layouts": [[11, "variable-layouts"]], "Version-agnostic format guarantees": [[18, "version-agnostic-format-guarantees"]], "Visualization type": [[58, "visualization-type"]], "What Provenance Data is Captured?": [[15, "what-provenance-data-is-captured"]], "What to test and what not to test": [[66, "what-to-test-and-what-not-to-test"]], "Why Capture Provenance Data?": [[15, "why-capture-provenance-data"]], "Why a ZIP File?": [[9, "why-a-zip-file"]], "Wrapping up testing": [[66, "wrapping-up-testing"]], "Write a wrapper function": [[66, "write-a-wrapper-function"]], "Write the visualizer function": [[64, "write-the-visualizer-function"]], "Write unit tests": [[66, "write-unit-tests"]], "Writing Usage Examples": [[48, null]], "Writing tutorials": [[69, "writing-tutorials"]], "init": [[29, "init"]], "load": [[29, "load"]], "q2-dwq2": [[26, "q2-dwq2"]], "q2-dwq2/.git": [[26, "q2-dwq2-git"]], "q2-dwq2/.github": [[26, "q2-dwq2-github"]], "q2-dwq2/.gitignore": [[26, "q2-dwq2-gitignore"]], "q2-dwq2/LICENSE": [[26, "q2-dwq2-license"]], "q2-dwq2/MANIFEST.in": [[26, "q2-dwq2-manifest-in"]], "q2-dwq2/Makefile": [[26, "q2-dwq2-makefile"]], "q2-dwq2/README.md": [[26, "q2-dwq2-readme-md"]], "q2-dwq2/ci": [[26, "q2-dwq2-ci"]], "q2-dwq2/q2_dwq2": [[26, "q2-dwq2-q2-dwq2"]], "q2-dwq2/q2_dwq2/__init__.py": [[26, "q2-dwq2-q2-dwq2-init-py"]], "q2-dwq2/q2_dwq2/_methods.py": [[26, "q2-dwq2-q2-dwq2-methods-py"]], "q2-dwq2/q2_dwq2/_version.py": [[26, "q2-dwq2-q2-dwq2-version-py"]], "q2-dwq2/q2_dwq2/citations.bib": [[26, "q2-dwq2-q2-dwq2-citations-bib"]], "q2-dwq2/q2_dwq2/plugin_setup.py": [[26, "q2-dwq2-q2-dwq2-plugin-setup-py"]], "q2-dwq2/q2_dwq2/setup.cfg": [[26, "q2-dwq2-q2-dwq2-setup-cfg"]], "q2-dwq2/q2_dwq2/setup.py": [[26, "q2-dwq2-q2-dwq2-setup-py"]], "q2-dwq2/q2_dwq2/tests": [[26, "q2-dwq2-q2-dwq2-tests"]], "q2-dwq2/q2_dwq2/tests/__init__.py": [[26, "q2-dwq2-q2-dwq2-tests-init-py"]], "q2-dwq2/q2_dwq2/tests/data": [[26, "q2-dwq2-q2-dwq2-tests-data"]], "q2-dwq2/q2_dwq2/tests/test_methods.py": [[26, "q2-dwq2-q2-dwq2-tests-test-methods-py"]], "q2-dwq2/q2_dwq2/versioneer.py": [[26, "q2-dwq2-q2-dwq2-versioneer-py"]], "save": [[29, "save"]], "split-apply-combine flowchart for search and summarize": [[67, "split-apply-combine-flowchart"]], "tl;dr": [[63, null], [64, "add-alignment-visualizer-commit"], [65, "add-artifact-class-commit"], [66, "add-nw-align-method-commit"], [67, "add-parallel-pipeline-commits"], [68, "add-pipeline-commit"], [69, "add-usage-example-commit"], [72, "integrate-metadata-commits"]]}, "docnames": ["back-matter/bibliography", "back-matter/genindex", "back-matter/glossary", "back-matter/intro", "ci/intro", "docs/developer-documentation", "docs/intro", "docs/user-documentation", "framework/explanations/architecture", "framework/explanations/archives", "framework/explanations/data-storage", "framework/explanations/formats", "framework/explanations/garbage-collection", "framework/explanations/intro", "framework/explanations/metaprogramming", "framework/explanations/provenance", "framework/explanations/types", "framework/intro", "framework/references/archive-versions", "framework/references/intro", "interfaces/intro", "interfaces/references/api", "interfaces/references/intro", "intro", "plugins/explanations/actions", "plugins/explanations/intro", "plugins/explanations/package-structure", "plugins/explanations/transformers", "plugins/explanations/types-of-types", "plugins/how-to-guides/artifact-collections-as-io", "plugins/how-to-guides/automate-testing", "plugins/how-to-guides/create-register-method", "plugins/how-to-guides/create-register-pipeline", "plugins/how-to-guides/create-register-transformer", "plugins/how-to-guides/create-register-visualizer", "plugins/how-to-guides/distribute-on-gh", "plugins/how-to-guides/distribute-on-library", "plugins/how-to-guides/facilitate-installation", "plugins/how-to-guides/format-validation-levels", "plugins/how-to-guides/handle-exceptions-in-parallel-pipelines", "plugins/how-to-guides/intro", "plugins/how-to-guides/maximize-compatibility", "plugins/how-to-guides/play-nicely-with-others", "plugins/how-to-guides/publicize", "plugins/how-to-guides/register-a-plugin", "plugins/how-to-guides/set-up-development-environment", "plugins/how-to-guides/support-your-users", "plugins/how-to-guides/test-plugins", "plugins/how-to-guides/usage-examples", "plugins/how-to-guides/use-metadata", "plugins/intro", "plugins/references/antipatterns", "plugins/references/api/citations", "plugins/references/api/context", "plugins/references/api/formats", "plugins/references/api/intro", "plugins/references/api/plugin", "plugins/references/api/testing", "plugins/references/api/types", "plugins/references/api/usage", "plugins/references/api/utils", "plugins/references/intro", "plugins/references/metadata-api", "plugins/tutorials/add-2nd-transformer", "plugins/tutorials/add-alignment-visualizer", "plugins/tutorials/add-artifact-class", "plugins/tutorials/add-nw-align-method", "plugins/tutorials/add-parallel-pipeline", "plugins/tutorials/add-pipeline", "plugins/tutorials/add-usage-examples", "plugins/tutorials/conclusion", "plugins/tutorials/create-from-template", "plugins/tutorials/integrate-metadata", "plugins/tutorials/intro"], "envversion": {"sphinx": 62, "sphinx.domains.c": 3, "sphinx.domains.changeset": 1, "sphinx.domains.citation": 1, "sphinx.domains.cpp": 9, "sphinx.domains.index": 1, "sphinx.domains.javascript": 3, "sphinx.domains.math": 2, "sphinx.domains.python": 4, "sphinx.domains.rst": 2, "sphinx.domains.std": 2, "sphinx.ext.intersphinx": 1, "sphinxcontrib.bibtex": 9}, "filenames": ["back-matter/bibliography.md", "back-matter/genindex.md", "back-matter/glossary.md", "back-matter/intro.md", "ci/intro.md", "docs/developer-documentation.md", "docs/intro.md", "docs/user-documentation.md", "framework/explanations/architecture.md", "framework/explanations/archives.md", "framework/explanations/data-storage.md", "framework/explanations/formats.md", "framework/explanations/garbage-collection.md", "framework/explanations/intro.md", "framework/explanations/metaprogramming.md", "framework/explanations/provenance.md", "framework/explanations/types.md", "framework/intro.md", "framework/references/archive-versions.md", "framework/references/intro.md", "interfaces/intro.md", "interfaces/references/api.md", "interfaces/references/intro.md", "intro.md", "plugins/explanations/actions.md", "plugins/explanations/intro.md", "plugins/explanations/package-structure.md", "plugins/explanations/transformers.md", "plugins/explanations/types-of-types.md", "plugins/how-to-guides/artifact-collections-as-io.md", "plugins/how-to-guides/automate-testing.md", "plugins/how-to-guides/create-register-method.md", "plugins/how-to-guides/create-register-pipeline.md", "plugins/how-to-guides/create-register-transformer.md", "plugins/how-to-guides/create-register-visualizer.md", "plugins/how-to-guides/distribute-on-gh.md", "plugins/how-to-guides/distribute-on-library.md", "plugins/how-to-guides/facilitate-installation.md", "plugins/how-to-guides/format-validation-levels.md", "plugins/how-to-guides/handle-exceptions-in-parallel-pipelines.md", "plugins/how-to-guides/intro.md", "plugins/how-to-guides/maximize-compatibility.md", "plugins/how-to-guides/play-nicely-with-others.md", "plugins/how-to-guides/publicize.md", "plugins/how-to-guides/register-a-plugin.md", "plugins/how-to-guides/set-up-development-environment.md", "plugins/how-to-guides/support-your-users.md", "plugins/how-to-guides/test-plugins.md", "plugins/how-to-guides/usage-examples.md", "plugins/how-to-guides/use-metadata.md", "plugins/intro.md", "plugins/references/antipatterns.md", "plugins/references/api/citations.md", "plugins/references/api/context.md", "plugins/references/api/formats.md", "plugins/references/api/intro.md", "plugins/references/api/plugin.md", "plugins/references/api/testing.md", "plugins/references/api/types.md", "plugins/references/api/usage.md", "plugins/references/api/utils.md", "plugins/references/intro.md", "plugins/references/metadata-api.md", "plugins/tutorials/add-2nd-transformer.md", "plugins/tutorials/add-alignment-visualizer.md", "plugins/tutorials/add-artifact-class.md", "plugins/tutorials/add-nw-align-method.md", "plugins/tutorials/add-parallel-pipeline.md", "plugins/tutorials/add-pipeline.md", "plugins/tutorials/add-usage-examples.md", "plugins/tutorials/conclusion.md", "plugins/tutorials/create-from-template.md", "plugins/tutorials/integrate-metadata.md", "plugins/tutorials/intro.md"], "indexentries": {"__iter__() (qiime2.plugin.citations method)": [[52, "qiime2.plugin.Citations.__iter__", false]], "action": [[2, "term-Action", true]], "action() (in module qiime2.sdk)": [[21, "qiime2.sdk.Action", false]], "action() (qiime2.sdk.usage.usage method)": [[59, "qiime2.sdk.usage.Usage.action", false]], "archive": [[2, "term-Archive", true]], "artifact": [[2, "term-Artifact", true]], "artifact api": [[2, "term-Artifact-API", true]], "artifact class": [[2, "term-Artifact-class", true]], "artifact() (in module qiime2.sdk)": [[21, "qiime2.sdk.Artifact", false]], "assert_has_line_matching() (qiime2.sdk.usage.usagevariable method)": [[59, "qiime2.sdk.usage.UsageVariable.assert_has_line_matching", false]], "assert_no_nans_in_tables() (in module qiime2.plugin.testing)": [[57, "qiime2.plugin.testing.assert_no_nans_in_tables", false]], "assert_output_type() (qiime2.sdk.usage.usagevariable method)": [[59, "qiime2.sdk.usage.UsageVariable.assert_output_type", false]], "assertregisteredsemantictype() (qiime2.plugin.testing.testpluginbase method)": [[57, "qiime2.plugin.testing.TestPluginBase.assertRegisteredSemanticType", false]], "assertsemantictyperegisteredtoformat() (qiime2.plugin.testing.testpluginbase method)": [[57, "qiime2.plugin.testing.TestPluginBase.assertSemanticTypeRegisteredToFormat", false]], "binaryfileformat (class in qiime2.plugin)": [[54, "qiime2.plugin.BinaryFileFormat", false]], "bool (in module qiime2.plugin)": [[58, "qiime2.plugin.Bool", false]], "categorical (in module qiime2.plugin)": [[58, "qiime2.plugin.Categorical", false]], "categoricalmetadatacolumn (class in qiime2)": [[62, "qiime2.CategoricalMetadataColumn", false]], "choices (class in qiime2.plugin)": [[58, "qiime2.plugin.Choices", false]], "citationrecord (class in qiime2.plugin)": [[52, "qiime2.plugin.CitationRecord", false]], "citations (class in qiime2.plugin)": [[52, "qiime2.plugin.Citations", false]], "collection (in module qiime2.plugin)": [[58, "qiime2.plugin.Collection", false]], "column_count (qiime2.metadata property)": [[62, "qiime2.Metadata.column_count", false]], "columns (qiime2.metadata property)": [[62, "qiime2.Metadata.columns", false]], "comment() (qiime2.sdk.usage.usage method)": [[59, "qiime2.sdk.usage.Usage.comment", false]], "conda metapackage": [[2, "term-Conda-metapackage", true]], "construct_artifact_collection() (qiime2.sdk.usage.usage method)": [[59, "qiime2.sdk.usage.Usage.construct_artifact_collection", false]], "deployment": [[2, "term-Deployment", true]], "directory format": [[2, "term-Directory-Format", true]], "directoryformat (class in qiime2.plugin)": [[54, "qiime2.plugin.DirectoryFormat", false]], "distribution": [[2, "term-Distribution", true]], "dr": [[2, "term-tl-dr", true]], "drop_missing_values() (qiime2.metadatacolumn method)": [[62, "qiime2.MetadataColumn.drop_missing_values", false]], "dry": [[2, "term-DRY", true]], "duplicate() (in module qiime2.util)": [[60, "qiime2.util.duplicate", false]], "end() (in module qiime2.plugin)": [[58, "qiime2.plugin.End", false]], "execute_examples() (qiime2.plugin.testing.testpluginbase method)": [[57, "qiime2.plugin.testing.TestPluginBase.execute_examples", false]], "file format": [[2, "term-File-Format", true]], "filter_columns() (qiime2.metadata method)": [[62, "qiime2.Metadata.filter_columns", false]], "filter_ids() (qiime2.metadata method)": [[62, "qiime2.Metadata.filter_ids", false]], "filter_ids() (qiime2.metadatacolumn method)": [[62, "qiime2.MetadataColumn.filter_ids", false]], "float (in module qiime2.plugin)": [[58, "qiime2.plugin.Float", false]], "format": [[2, "term-Format", true]], "framework": [[2, "term-Framework", true]], "galaxy": [[2, "term-Galaxy", true]], "get_action() (qiime2.sdk.context method)": [[53, "qiime2.sdk.Context.get_action", false]], "get_artifact_collection_member() (qiime2.sdk.usage.usage method)": [[59, "qiime2.sdk.usage.Usage.get_artifact_collection_member", false]], "get_available_cores() (in module qiime2.plugin.util)": [[60, "qiime2.plugin.util.get_available_cores", false]], "get_column() (qiime2.metadata method)": [[62, "qiime2.Metadata.get_column", false]], "get_data_path() (qiime2.plugin.testing.testpluginbase method)": [[57, "qiime2.plugin.testing.TestPluginBase.get_data_path", false]], "get_ids() (qiime2.metadata method)": [[62, "qiime2.Metadata.get_ids", false]], "get_ids() (qiime2.metadatacolumn method)": [[62, "qiime2.MetadataColumn.get_ids", false]], "get_metadata_column() (qiime2.sdk.usage.usage method)": [[59, "qiime2.sdk.usage.Usage.get_metadata_column", false]], "get_missing() (qiime2.metadatacolumn method)": [[62, "qiime2.MetadataColumn.get_missing", false]], "get_transformer() (qiime2.plugin.testing.testpluginbase method)": [[57, "qiime2.plugin.testing.TestPluginBase.get_transformer", false]], "get_value() (qiime2.metadatacolumn method)": [[62, "qiime2.MetadataColumn.get_value", false]], "has_missing_values() (qiime2.metadatacolumn method)": [[62, "qiime2.MetadataColumn.has_missing_values", false]], "help() (qiime2.sdk.usage.usage method)": [[59, "qiime2.sdk.usage.Usage.help", false]], "identifier": [[2, "term-Identifier", true]], "identity": [[2, "term-Identity", true]], "implementationerror() (in module qiime2.sdk)": [[21, "qiime2.sdk.ImplementationError", false]], "import_from_format() (qiime2.sdk.usage.usage method)": [[59, "qiime2.sdk.usage.Usage.import_from_format", false]], "init_artifact() (qiime2.sdk.usage.usage method)": [[59, "qiime2.sdk.usage.Usage.init_artifact", false]], "init_artifact_collection() (qiime2.sdk.usage.usage method)": [[59, "qiime2.sdk.usage.Usage.init_artifact_collection", false]], "init_artifact_from_url() (qiime2.sdk.usage.usage method)": [[59, "qiime2.sdk.usage.Usage.init_artifact_from_url", false]], "init_format() (qiime2.sdk.usage.usage method)": [[59, "qiime2.sdk.usage.Usage.init_format", false]], "init_metadata() (qiime2.sdk.usage.usage method)": [[59, "qiime2.sdk.usage.Usage.init_metadata", false]], "init_metadata_from_url() (qiime2.sdk.usage.usage method)": [[59, "qiime2.sdk.usage.Usage.init_metadata_from_url", false]], "input": [[2, "term-Input", true]], "int (in module qiime2.plugin)": [[58, "qiime2.plugin.Int", false]], "interface": [[2, "term-Interface", true]], "jobs (in module qiime2.plugin)": [[58, "qiime2.plugin.Jobs", false]], "list (in module qiime2.plugin)": [[58, "qiime2.plugin.List", false]], "load() (qiime2.metadata class method)": [[62, "qiime2.Metadata.load", false]], "load() (qiime2.plugin.citations class method)": [[52, "qiime2.plugin.Citations.load", false]], "make_artifact() (qiime2.sdk.context method)": [[53, "qiime2.sdk.Context.make_artifact", false]], "merge() (qiime2.metadata method)": [[62, "qiime2.Metadata.merge", false]], "merge_metadata() (qiime2.sdk.usage.usage method)": [[59, "qiime2.sdk.usage.Usage.merge_metadata", false]], "metadata": [[2, "term-Metadata", true]], "metadata (class in qiime2)": [[62, "qiime2.Metadata", false]], "metadata (in module qiime2.plugin)": [[58, "qiime2.plugin.Metadata", false]], "metadatacolumn (class in qiime2)": [[62, "qiime2.MetadataColumn", false]], "metadatacolumn (in module qiime2.plugin)": [[58, "qiime2.plugin.MetadataColumn", false]], "metadatafileerror (class in qiime2.metadata)": [[62, "qiime2.metadata.MetadataFileError", false]], "method": [[2, "term-Method", true]], "method() (in module qiime2.sdk)": [[21, "qiime2.sdk.Method", false]], "missing_scheme (qiime2.metadatacolumn property)": [[62, "qiime2.MetadataColumn.missing_scheme", false]], "name (qiime2.metadatacolumn property)": [[62, "qiime2.MetadataColumn.name", false]], "numeric (in module qiime2.plugin)": [[58, "qiime2.plugin.Numeric", false]], "numericmetadatacolumn (class in qiime2)": [[62, "qiime2.NumericMetadataColumn", false]], "output": [[2, "term-Output", true]], "package (qiime2.plugin.testing.testpluginbase attribute)": [[57, "qiime2.plugin.testing.TestPluginBase.package", false]], "pairwise sequence alignment": [[2, "term-Pairwise-sequence-alignment", true]], "parameter": [[2, "term-Parameter", true]], "parse_format() (in module qiime2.sdk)": [[21, "qiime2.sdk.parse_format", false]], "parse_type() (in module qiime2.sdk)": [[21, "qiime2.sdk.parse_type", false]], "payload": [[2, "term-Payload", true]], "peek() (qiime2.sdk.usage.usage method)": [[59, "qiime2.sdk.usage.Usage.peek", false]], "pipeline": [[2, "term-Pipeline", true]], "pipeline() (in module qiime2.sdk)": [[21, "qiime2.sdk.Pipeline", false]], "plugin": [[2, "term-Plugin", true]], "plugin (class in qiime2.plugin)": [[56, "qiime2.plugin.Plugin", false]], "plugin manager": [[2, "term-Plugin-Manager", true]], "pluginmanager() (in module qiime2.sdk)": [[21, "qiime2.sdk.PluginManager", false]], "pluginmethods (class in qiime2.plugin.plugin)": [[56, "qiime2.plugin.plugin.PluginMethods", false]], "pluginpipelines (class in qiime2.plugin.plugin)": [[56, "qiime2.plugin.plugin.PluginPipelines", false]], "pluginvisualizers (class in qiime2.plugin.plugin)": [[56, "qiime2.plugin.plugin.PluginVisualizers", false]], "primitive type": [[2, "term-Primitive-Type", true]], "properties (class in qiime2.plugin)": [[58, "qiime2.plugin.Properties", false]], "provenance": [[2, "term-Provenance", true]], "provenance replay": [[2, "term-Provenance-Replay", true]], "python 3 api": [[2, "term-Python-3-API", true]], "q2cli": [[2, "term-q2cli", true]], "range (class in qiime2.plugin)": [[58, "qiime2.plugin.Range", false]], "redirected_stdio() (in module qiime2.util)": [[60, "qiime2.util.redirected_stdio", false]], "register_artifact_class() (qiime2.plugin.plugin method)": [[56, "qiime2.plugin.Plugin.register_artifact_class", false]], "register_formats() (qiime2.plugin.plugin method)": [[56, "qiime2.plugin.Plugin.register_formats", false]], "register_function() (qiime2.plugin.plugin.pluginmethods method)": [[56, "qiime2.plugin.plugin.PluginMethods.register_function", false]], "register_function() (qiime2.plugin.plugin.pluginpipelines method)": [[56, "qiime2.plugin.plugin.PluginPipelines.register_function", false]], "register_function() (qiime2.plugin.plugin.pluginvisualizers method)": [[56, "qiime2.plugin.plugin.PluginVisualizers.register_function", false]], "register_semantic_type_to_format() (qiime2.plugin.plugin method)": [[56, "qiime2.plugin.Plugin.register_semantic_type_to_format", false]], "register_semantic_types() (qiime2.plugin.plugin method)": [[56, "qiime2.plugin.Plugin.register_semantic_types", false]], "register_transformer() (qiime2.plugin.plugin method)": [[56, "qiime2.plugin.Plugin.register_transformer", false]], "register_validator() (qiime2.plugin.plugin method)": [[56, "qiime2.plugin.Plugin.register_validator", false]], "register_views() (qiime2.plugin.plugin method)": [[56, "qiime2.plugin.Plugin.register_views", false]], "result": [[2, "term-Result", true]], "result() (in module qiime2.sdk)": [[21, "qiime2.sdk.Result", false]], "resultcollection() (in module qiime2.sdk)": [[21, "qiime2.sdk.ResultCollection", false]], "results() (in module qiime2.sdk)": [[21, "qiime2.sdk.Results", false]], "save() (qiime2.plugin.citations method)": [[52, "qiime2.plugin.Citations.save", false]], "semantic type": [[2, "term-Semantic-Type", true]], "semantictype() (in module qiime2.plugin)": [[58, "qiime2.plugin.SemanticType", false]], "set (in module qiime2.plugin)": [[58, "qiime2.plugin.Set", false]], "setup() (qiime2.plugin.testing.testpluginbase method)": [[57, "qiime2.plugin.testing.TestPluginBase.setUp", false]], "single-use plugin (sup)": [[2, "term-Single-Use-Plugin-SUP", true]], "singlefiledirectoryformat() (in module qiime2.plugin)": [[54, "qiime2.plugin.SingleFileDirectoryFormat", false]], "start() (in module qiime2.plugin)": [[58, "qiime2.plugin.Start", false]], "str (in module qiime2.plugin)": [[58, "qiime2.plugin.Str", false]], "teardown() (qiime2.plugin.testing.testpluginbase method)": [[57, "qiime2.plugin.testing.TestPluginBase.tearDown", false]], "test_dir_prefix (qiime2.plugin.testing.testpluginbase attribute)": [[57, "qiime2.plugin.testing.TestPluginBase.test_dir_prefix", false]], "testpluginbase (class in qiime2.plugin.testing)": [[57, "qiime2.plugin.testing.TestPluginBase", false]], "textfileformat (class in qiime2.plugin)": [[54, "qiime2.plugin.TextFileFormat", false]], "threads (in module qiime2.plugin)": [[58, "qiime2.plugin.Threads", false]], "tl": [[2, "term-tl-dr", true]], "to_dataframe() (qiime2.metadata method)": [[62, "qiime2.Metadata.to_dataframe", false]], "to_dataframe() (qiime2.metadatacolumn method)": [[62, "qiime2.MetadataColumn.to_dataframe", false]], "to_series() (qiime2.metadatacolumn method)": [[62, "qiime2.MetadataColumn.to_series", false]], "transform() (in module qiime2.plugin.util)": [[60, "qiime2.plugin.util.transform", false]], "transform_format() (qiime2.plugin.testing.testpluginbase method)": [[57, "qiime2.plugin.testing.TestPluginBase.transform_format", false]], "transformer": [[2, "term-Transformer", true]], "type": [[2, "term-Type", true]], "type_from_ast() (in module qiime2.sdk)": [[21, "qiime2.sdk.type_from_ast", false]], "typemap (class in qiime2.plugin)": [[58, "qiime2.plugin.TypeMap", false]], "typematch (class in qiime2.plugin)": [[58, "qiime2.plugin.TypeMatch", false]], "uninitializedpluginmanagererror() (in module qiime2.sdk)": [[21, "qiime2.sdk.UninitializedPluginManagerError", false]], "usageaction (class in qiime2.sdk.usage)": [[59, "qiime2.sdk.usage.UsageAction", false]], "usageaction (qiime2.sdk.usage.usage attribute)": [[59, "qiime2.sdk.usage.Usage.UsageAction", false]], "usageinputs (class in qiime2.sdk.usage)": [[59, "qiime2.sdk.usage.UsageInputs", false]], "usageinputs (qiime2.sdk.usage.usage attribute)": [[59, "qiime2.sdk.usage.Usage.UsageInputs", false]], "usageoutputnames (class in qiime2.sdk.usage)": [[59, "qiime2.sdk.usage.UsageOutputNames", false]], "usageoutputnames (qiime2.sdk.usage.usage attribute)": [[59, "qiime2.sdk.usage.Usage.UsageOutputNames", false]], "usageoutputs (class in qiime2.sdk.usage)": [[59, "qiime2.sdk.usage.UsageOutputs", false]], "usagevariable (class in qiime2.sdk.usage)": [[59, "qiime2.sdk.usage.UsageVariable", false]], "uuid": [[2, "term-UUID", true]], "validationerror (class in qiime2.plugin)": [[54, "qiime2.plugin.ValidationError", false]], "validationerror() (in module qiime2.sdk)": [[21, "qiime2.sdk.ValidationError", false]], "view": [[2, "term-View", true]], "view_as_metadata() (qiime2.sdk.usage.usage method)": [[59, "qiime2.sdk.usage.Usage.view_as_metadata", false]], "visualization": [[2, "term-Visualization", true]], "visualization (in module qiime2.plugin)": [[58, "qiime2.plugin.Visualization", false]], "visualization (type)": [[2, "term-Visualization-Type", true]], "visualization() (in module qiime2.sdk)": [[21, "qiime2.sdk.Visualization", false]], "visualizer": [[2, "term-Visualizer", true]], "visualizer() (in module qiime2.sdk)": [[21, "qiime2.sdk.Visualizer", false]]}, "objects": {"qiime2": [[62, 0, 1, "", "CategoricalMetadataColumn"], [62, 0, 1, "", "Metadata"], [62, 0, 1, "", "MetadataColumn"], [62, 0, 1, "", "NumericMetadataColumn"]], "qiime2.Metadata": [[62, 1, 1, "", "column_count"], [62, 1, 1, "", "columns"], [62, 2, 1, "", "filter_columns"], [62, 2, 1, "", "filter_ids"], [62, 2, 1, "", "get_column"], [62, 2, 1, "", "get_ids"], [62, 2, 1, "", "load"], [62, 2, 1, "", "merge"], [62, 2, 1, "", "to_dataframe"]], "qiime2.MetadataColumn": [[62, 2, 1, "", "drop_missing_values"], [62, 2, 1, "", "filter_ids"], [62, 2, 1, "", "get_ids"], [62, 2, 1, "", "get_missing"], [62, 2, 1, "", "get_value"], [62, 2, 1, "", "has_missing_values"], [62, 1, 1, "", "missing_scheme"], [62, 1, 1, "", "name"], [62, 2, 1, "", "to_dataframe"], [62, 2, 1, "", "to_series"]], "qiime2.metadata": [[62, 0, 1, "", "MetadataFileError"]], "qiime2.plugin": [[54, 0, 1, "", "BinaryFileFormat"], [58, 3, 1, "", "Bool"], [58, 3, 1, "", "Categorical"], [58, 0, 1, "", "Choices"], [52, 0, 1, "", "CitationRecord"], [52, 0, 1, "", "Citations"], [58, 3, 1, "", "Collection"], [54, 0, 1, "", "DirectoryFormat"], [58, 4, 1, "", "End"], [58, 3, 1, "", "Float"], [58, 3, 1, "", "Int"], [58, 3, 1, "", "Jobs"], [58, 3, 1, "", "List"], [58, 3, 1, "", "Metadata"], [58, 3, 1, "", "MetadataColumn"], [58, 3, 1, "", "Numeric"], [56, 0, 1, "", "Plugin"], [58, 0, 1, "", "Properties"], [58, 0, 1, "", "Range"], [58, 4, 1, "", "SemanticType"], [58, 3, 1, "", "Set"], [54, 4, 1, "", "SingleFileDirectoryFormat"], [58, 4, 1, "", "Start"], [58, 3, 1, "", "Str"], [54, 0, 1, "", "TextFileFormat"], [58, 3, 1, "", "Threads"], [58, 0, 1, "", "TypeMap"], [58, 0, 1, "", "TypeMatch"], [54, 0, 1, "", "ValidationError"], [58, 3, 1, "", "Visualization"]], "qiime2.plugin.Citations": [[52, 2, 1, "", "__iter__"], [52, 2, 1, "", "load"], [52, 2, 1, "", "save"]], "qiime2.plugin.Plugin": [[56, 2, 1, "", "register_artifact_class"], [56, 2, 1, "", "register_formats"], [56, 2, 1, "", "register_semantic_type_to_format"], [56, 2, 1, "", "register_semantic_types"], [56, 2, 1, "", "register_transformer"], [56, 2, 1, "", "register_validator"], [56, 2, 1, "", "register_views"]], "qiime2.plugin.plugin": [[56, 0, 1, "", "PluginMethods"], [56, 0, 1, "", "PluginPipelines"], [56, 0, 1, "", "PluginVisualizers"]], "qiime2.plugin.plugin.PluginMethods": [[56, 2, 1, "", "register_function"]], "qiime2.plugin.plugin.PluginPipelines": [[56, 2, 1, "", "register_function"]], "qiime2.plugin.plugin.PluginVisualizers": [[56, 2, 1, "", "register_function"]], "qiime2.plugin.testing": [[57, 0, 1, "", "TestPluginBase"], [57, 4, 1, "", "assert_no_nans_in_tables"]], "qiime2.plugin.testing.TestPluginBase": [[57, 2, 1, "", "assertRegisteredSemanticType"], [57, 2, 1, "", "assertSemanticTypeRegisteredToFormat"], [57, 2, 1, "", "execute_examples"], [57, 2, 1, "", "get_data_path"], [57, 2, 1, "", "get_transformer"], [57, 5, 1, "", "package"], [57, 2, 1, "", "setUp"], [57, 2, 1, "", "tearDown"], [57, 5, 1, "", "test_dir_prefix"], [57, 2, 1, "", "transform_format"]], "qiime2.plugin.util": [[60, 4, 1, "", "get_available_cores"], [60, 4, 1, "", "transform"]], "qiime2.sdk": [[21, 4, 1, "", "Action"], [21, 4, 1, "", "Artifact"], [21, 4, 1, "", "ImplementationError"], [21, 4, 1, "", "Method"], [21, 4, 1, "", "Pipeline"], [21, 4, 1, "", "PluginManager"], [21, 4, 1, "", "Result"], [21, 4, 1, "", "ResultCollection"], [21, 4, 1, "", "Results"], [21, 4, 1, "", "UninitializedPluginManagerError"], [21, 4, 1, "", "ValidationError"], [21, 4, 1, "", "Visualization"], [21, 4, 1, "", "Visualizer"], [21, 4, 1, "", "parse_format"], [21, 4, 1, "", "parse_type"], [21, 4, 1, "", "type_from_ast"]], "qiime2.sdk.Context": [[53, 2, 1, "", "get_action"], [53, 2, 1, "", "make_artifact"]], "qiime2.sdk.usage": [[59, 0, 1, "", "UsageAction"], [59, 0, 1, "", "UsageInputs"], [59, 0, 1, "", "UsageOutputNames"], [59, 0, 1, "", "UsageOutputs"], [59, 0, 1, "", "UsageVariable"]], "qiime2.sdk.usage.Usage": [[59, 5, 1, "", "UsageAction"], [59, 5, 1, "", "UsageInputs"], [59, 5, 1, "", "UsageOutputNames"], [59, 2, 1, "", "action"], [59, 2, 1, "", "comment"], [59, 2, 1, "", "construct_artifact_collection"], [59, 2, 1, "", "get_artifact_collection_member"], [59, 2, 1, "", "get_metadata_column"], [59, 2, 1, "", "help"], [59, 2, 1, "", "import_from_format"], [59, 2, 1, "", "init_artifact"], [59, 2, 1, "", "init_artifact_collection"], [59, 2, 1, "", "init_artifact_from_url"], [59, 2, 1, "", "init_format"], [59, 2, 1, "", "init_metadata"], [59, 2, 1, "", "init_metadata_from_url"], [59, 2, 1, "", "merge_metadata"], [59, 2, 1, "", "peek"], [59, 2, 1, "", "view_as_metadata"]], "qiime2.sdk.usage.UsageVariable": [[59, 2, 1, "", "assert_has_line_matching"], [59, 2, 1, "", "assert_output_type"]], "qiime2.util": [[60, 4, 1, "", "duplicate"], [60, 4, 1, "", "redirected_stdio"]]}, "objnames": {"0": ["py", "class", "Python class"], "1": ["py", "property", "Python property"], "2": ["py", "method", "Python method"], "3": ["py", "data", "Python data"], "4": ["py", "function", "Python function"], "5": ["py", "attribute", "Python attribute"]}, "objtypes": {"0": "py:class", "1": "py:property", "2": "py:method", "3": "py:data", "4": "py:function", "5": "py:attribute"}, "terms": {"": [0, 2, 5, 8, 9, 10, 11, 15, 16, 18, 23, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 37, 40, 42, 43, 44, 46, 48, 49, 50, 51, 52, 56, 57, 58, 59, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73], "0": [9, 11, 15, 16, 23, 29, 30, 32, 45, 48, 58, 59, 60, 64, 65, 66, 68, 71, 72], "00": 15, "001": 66, "00a294c": 18, "01": [23, 66], "03d_r": 11, "04": 15, "06": 69, "07": 15, "080381": 15, "1": [0, 11, 15, 16, 23, 26, 29, 31, 32, 37, 48, 58, 59, 63, 64, 65, 66, 68, 69], "10": [11, 15, 18, 23, 30, 37, 58, 59, 60, 66], "100": [44, 58, 59, 67], "100014989": 23, "11": [0, 15, 18, 45, 51, 59], "1103": 15, "12": [7, 11, 15, 18, 45, 58], "13039": 23, "14": 65, "147": 0, "15": [41, 45, 67, 69], "16": [15, 30, 46, 67], "17": 66, "171": 65, "18": [45, 68], "184": 16, "19": 0, "195": 0, "197": 0, "1970": [0, 66], "1976": 26, "1981": 0, "1990": 0, "1u24ca248454": 23, "2": [0, 2, 4, 5, 7, 9, 11, 12, 13, 15, 16, 17, 21, 25, 27, 28, 29, 30, 31, 32, 34, 35, 38, 39, 40, 42, 46, 48, 49, 50, 51, 52, 55, 56, 57, 58, 59, 60, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72], "20": [10, 15, 28, 58, 67], "2016": 18, "2017": 18, "2018": 18, "2019": [0, 18], "2021": [0, 15], "2022": 59, "2023": [0, 7, 45, 51], "2024": [2, 4, 11, 30, 35, 37, 41, 43, 46, 51, 65, 66, 70, 71], "2025": 30, "207342": 23, "20px": 64, "20th": [0, 66], "21": 15, "215": 0, "21t14": 15, "22": 70, "23": [4, 43, 65, 66], "24": [18, 35], "25": [64, 67, 69], "27a5": 15, "29": 68, "2adb9": 15, "2adb9f00": 15, "2c00": 18, "2nd": 0, "3": [0, 2, 11, 15, 16, 23, 31, 44, 45, 48, 58, 59, 62, 67, 72, 73], "30": 67, "300": 36, "333fd63a2b4a102e58e364f37cd98b74": 18, "34b07e56": 15, "35": 67, "3611a0c1": 15, "37921": 23, "38": 15, "3rd": 42, "4": [0, 2, 9, 15, 23, 30, 58, 59, 65, 66, 68], "40": 67, "403": 0, "41": 66, "410": 0, "411d": 15, "414": 18, "42": [15, 59], "42b5": 15, "4308": 15, "4322": 15, "4373b96f26689f78889caeb1fbb94090": 18, "4389a0b": 18, "44": 71, "443": [0, 66], "453": [0, 66], "45c12936": 9, "469998": 15, "48": [0, 66], "484d": 9, "4886": 18, "4b60": 9, "4e2f": 15, "4f03": 15, "5": [0, 11, 15, 16, 37, 51, 58, 59, 65, 66, 67, 68], "50": 65, "5000": 11, "51": 65, "587": 15, "5a7118c14fd1bacc957ddf01e61491b7": 18, "6": [0, 15, 59, 66, 67], "610383": 15, "62c7": 15, "64": [45, 58], "66": 68, "68": 16, "684b8b7": 18, "6dada99d0c81": 18, "7": [0, 2, 15], "7a40cff7855daffa28d4082194bdf60": 18, "7zip": 10, "8": [11, 15, 18, 45, 60, 64, 66], "80": 64, "8000": 7, "81b130d538c3": 15, "85": 67, "8601": 15, "862772dbrrej": 23, "87058ae3": 15, "8dd3": 15, "9": [11, 15, 18], "90": 67, "93224813": 15, "95": 67, "98ff96bad145": 9, "999": 58, "A": [0, 2, 9, 10, 11, 15, 16, 18, 21, 23, 24, 26, 29, 31, 32, 34, 41, 44, 45, 48, 50, 52, 56, 57, 58, 59, 60, 62, 63, 65, 67, 68, 70], "And": [16, 49, 65, 67, 69, 73], "As": [4, 7, 9, 11, 15, 16, 18, 26, 29, 31, 32, 35, 37, 43, 48, 51, 56, 58, 63, 64, 65, 66, 67, 68, 69, 70], "At": [5, 8, 45, 49, 56, 63, 65, 66, 67, 72], "BY": 23, "Be": 35, "But": [51, 58, 65, 66, 72], "By": [15, 26, 31, 37, 48, 49, 66, 72], "For": [2, 5, 10, 11, 12, 15, 16, 18, 23, 24, 26, 27, 28, 29, 30, 31, 35, 42, 43, 44, 45, 48, 49, 51, 60, 62, 64, 65, 66, 67, 68, 69, 71, 72], "If": [5, 9, 10, 12, 15, 16, 23, 26, 28, 29, 30, 31, 34, 35, 36, 37, 39, 40, 41, 42, 43, 44, 45, 46, 48, 49, 51, 56, 57, 58, 59, 62, 63, 64, 65, 66, 67, 68, 69, 71, 72, 73], "In": [2, 5, 8, 10, 11, 15, 16, 18, 24, 26, 29, 30, 31, 34, 36, 37, 39, 44, 48, 49, 51, 56, 58, 62, 63, 64, 65, 66, 67, 68, 69, 71, 72], "It": [8, 9, 11, 12, 15, 16, 18, 21, 23, 24, 28, 29, 30, 32, 35, 36, 43, 44, 48, 51, 56, 58, 63, 64, 65, 66, 68, 69, 73], "NOT": [29, 36], "No": [58, 65], "Not": [8, 16, 58], "Of": [16, 59], "On": [29, 65, 72], "One": [11, 16, 28, 59, 62, 65, 66, 67, 68, 73], "Or": [58, 66, 71], "That": [15, 16, 28, 43, 51, 64, 65, 66, 67, 68, 69, 70, 72], "Thats": 16, "The": [0, 2, 7, 8, 10, 11, 12, 14, 16, 18, 23, 25, 27, 28, 30, 31, 32, 33, 34, 35, 36, 37, 39, 41, 42, 43, 44, 45, 48, 49, 50, 51, 52, 53, 56, 57, 58, 59, 60, 63, 64, 65, 66, 67, 68, 69, 70, 71, 73], "Then": [7, 8, 9, 26, 64, 65, 66, 67, 69, 72], "There": [2, 9, 10, 15, 16, 26, 28, 30, 39, 42, 44, 48, 51, 58, 59, 65, 66, 67], "These": [2, 7, 8, 9, 10, 11, 15, 16, 18, 24, 27, 29, 30, 31, 33, 36, 44, 48, 51, 55, 58, 59, 62, 66, 67, 68, 69], "To": [7, 8, 10, 11, 16, 23, 26, 28, 30, 35, 41, 45, 48, 50, 51, 57, 62, 64, 65, 66, 67, 68, 69, 71, 72, 73], "WILL": 36, "Will": [21, 58], "With": [15, 18, 30, 37, 41, 63, 65], "_": [11, 26, 31, 44, 56, 65, 66, 68], "_0": 56, "_001": 11, "_1": [33, 49, 56, 65], "_2": [33, 63, 65], "_3": 65, "_4": 65, "__all__": 65, "__getitem__": 16, "__init__": [5, 18, 65], "__iter__": 52, "__release__": 59, "__repr__": 64, "__super__": 57, "__version__": [44, 56, 66], "_action": 68, "_align_and_summarize_output": 68, "_align_and_summarize_output_descript": 68, "_archiv": [9, 18], "_batch": 67, "_confirm_acgt_onli": 65, "_confirm_single_record": 65, "_create_seq_artifact": [63, 69], "_exampl": [63, 69], "_exit": 12, "_fn": 56, "_html_templat": [64, 72], "_l": 11, "_method": [65, 66, 67, 68], "_nw_align_default": 68, "_nw_align_input": 68, "_nw_align_input_descript": 68, "_nw_align_paramet": 68, "_nw_align_parameter_descript": 68, "_pipelin": [67, 72], "_r": 11, "_result": 39, "_split_seqs_default": 67, "_tabulate_las_default": 72, "_tabulate_las_paramet": 72, "_tabulate_las_parameter_descript": 72, "_test_simple1_help": 67, "_transform": [18, 63, 65], "_transform_singlerecorddnafastaformat_to_dna": 65, "_types_and_format": 65, "_validate_": [11, 38, 51, 65], "_validate_field_": 16, "_validate_n_int": 11, "_visual": [64, 72], "_ziparch": 9, "a10d5d44": 15, "a416": 15, "a692": 15, "a6d07fc80a01": 15, "a983": 15, "a_boo": 59, "a_div_vector": 48, "aaa": 66, "aaaa": 66, "aaaaaaaagg": [64, 66], "aaaaaaaaggggcctttttttt": 66, "aaaaaaaaggtggcctttttttt": [64, 66], "aaaag": 66, "aaaaggttt": 66, "aaaattt": 66, "aaccgctggcgaa": [63, 69], "aaccggttaacacccac": [64, 66], "aaccggttggccaa": [63, 69], "abbrevi": [15, 67], "abil": [38, 65], "abl": [9, 10, 11, 15, 16, 18, 26, 35, 42, 45, 46, 59, 64, 65, 66, 68, 69, 73], "about": [2, 7, 8, 10, 11, 15, 16, 26, 28, 35, 43, 44, 47, 48, 49, 51, 56, 58, 62, 63, 66, 67, 69, 71, 72, 73], "abov": [7, 8, 15, 16, 18, 26, 30, 31, 36, 37, 41, 44, 45, 48, 58, 64, 65, 66, 67, 68, 69], "absenc": 58, "absolut": 36, "abstract": [10, 15, 16, 21, 62, 69], "abstractli": 69, "ac92": 15, "acactcaccacccaattgct": 67, "acactctccacccatttgct": 67, "acactctccagccatttgct": 67, "accept": [2, 5, 16, 24, 31, 32, 34, 43, 48, 56, 66, 67], "access": [2, 9, 15, 21, 23, 31, 41, 44, 51, 56, 57, 58, 59, 62, 63, 64, 65, 66, 67, 68, 73], "accggt": [64, 66], "accggtaaccggttaacacccac": [63, 65, 66], "accggtggaaccgg": [64, 66], "accggtggaaccggtaacacccac": [63, 65, 66], "accident": [10, 15, 28, 58], "accomplish": [10, 23, 32], "accord": [16, 35, 48], "accordingli": 66, "account": 37, "accur": [11, 15], "accuraci": 31, "acgt": 65, "achiev": [10, 14, 28, 40, 51, 66, 67, 68, 73], "acid": [0, 66], "acknowledg": 5, "acronym": 2, "across": [15, 18, 26, 31, 51, 62, 66, 67, 68], "act": [21, 69], "actinomycetota": 72, "action": [2, 7, 8, 9, 10, 11, 14, 16, 18, 25, 26, 27, 28, 32, 40, 42, 44, 48, 49, 50, 51, 53, 58, 62, 65, 67, 69, 71, 73], "action_id": [48, 59, 69], "activ": [4, 8, 15, 23, 28, 30, 43, 46, 66], "actor": 8, "actual": [15, 16, 28, 29, 39, 48, 49, 59, 64, 65, 66, 67, 69, 72], "ad": [9, 11, 16, 18, 26, 28, 31, 32, 34, 36, 42, 48, 58, 63, 64, 65, 66, 67, 68, 69, 70, 72], "adapt": [8, 23, 63, 65, 67, 68, 69], "add": [7, 16, 18, 35, 39, 40, 41, 50, 56, 58, 71, 73], "add_plugin": 21, "addion": 69, "addison": 0, "addit": [2, 9, 10, 12, 15, 16, 26, 30, 34, 35, 37, 43, 45, 48, 49, 56, 58, 62, 64, 65, 67, 69, 72, 73], "addition": [10, 12, 16, 28, 49, 69], "additon": 9, "address": [10, 28, 30, 41, 64, 65, 66, 68], "adequ": 10, "adher": [31, 68], "adjust": [30, 66], "adopt": [16, 26, 51, 65, 66], "advanc": [10, 29, 30, 43], "advantag": 10, "advis": 23, "ae0d0e26da5b84a6c0722148789c51e0": 18, "ae57": 15, "afb": 15, "afford": 58, "after": [26, 28, 30, 35, 39, 45, 62, 65, 66, 67, 68, 69, 71, 72, 73], "ag": [43, 49, 59], "again": [8, 26, 29, 30, 37, 42, 62, 63, 64, 66, 67, 68, 72], "against": [30, 35, 36, 59, 65, 67], "agnost": [4, 15], "ahead": [8, 48], "aid": 23, "aim": [11, 15], "airplan": 58, "alabast": 15, "alert": 30, "alfr": 23, "algorithm": [15, 28, 31, 66, 67, 73], "alia": [15, 18, 58], "alias": 15, "align": [0, 2, 15, 18, 64, 68, 72], "align_and_summar": 68, "aligned_sequ": [66, 69], "aligned_sequence1": [64, 66], "aligned_sequence2": [64, 66], "alignedproteinsequ": 65, "alignedrnasequ": 65, "alignedsequ": [64, 66, 68], "all": [2, 7, 8, 9, 10, 11, 15, 16, 18, 21, 23, 26, 27, 28, 29, 30, 31, 35, 37, 43, 44, 47, 48, 49, 51, 56, 57, 58, 59, 62, 64, 65, 66, 67, 68, 69, 71, 72, 73], "alloc": 12, "allot": 67, "allow": [2, 8, 9, 10, 11, 15, 16, 18, 21, 23, 26, 28, 30, 41, 44, 48, 49, 51, 56, 58, 62, 65, 66, 67, 68, 69, 72], "almost": [2, 16, 35, 72], "alon": 18, "along": [2, 26, 27, 29, 41, 67, 71, 72], "alongsid": [10, 18], "alpha": [18, 24, 32, 34, 44, 48], "alpha_divers": 34, "alpha_group_signific": 34, "alphadivers": [32, 34, 48], "alreadi": [15, 16, 28, 35, 40, 41, 46, 48, 51, 65, 66, 67, 71, 72, 73], "also": [4, 8, 9, 11, 15, 16, 18, 21, 23, 28, 29, 30, 35, 37, 43, 46, 48, 49, 51, 56, 57, 58, 62, 63, 64, 65, 66, 67, 68, 69, 71, 72, 73], "alter": 2, "altern": [10, 41, 60, 66, 67, 68], "although": [11, 49], "altschul": 0, "alwai": [8, 9, 11, 12, 15, 16, 30, 49, 58, 59, 62, 63, 64, 65, 66, 67, 68], "am": [26, 69], "ambigu": [2, 58, 65], "amino": [0, 66], "among": [15, 65], "amongst": 49, "amount": [8, 14, 67], "ampl": 30, "amplicon": [2, 7, 30, 35, 37, 41, 49], "an": [0, 2, 4, 8, 10, 11, 12, 13, 15, 17, 18, 21, 23, 26, 27, 28, 30, 31, 32, 33, 34, 35, 36, 40, 41, 42, 47, 48, 49, 51, 52, 53, 56, 57, 58, 59, 62, 63, 67, 69, 71], "an_input_filepath": 51, "an_output_filepath": 51, "anaconda": 44, "analys": [15, 69], "analysi": [2, 10, 15, 24, 31, 34, 52, 66], "analyt": [34, 65], "analyz": [43, 67], "anatomi": [10, 13, 15, 17], "ancestor": [9, 18], "ancestor_uuid": 18, "ancestr": [2, 9, 66], "andrew": 0, "angl": 8, "angri": 66, "ani": [2, 7, 8, 9, 10, 11, 12, 15, 16, 23, 24, 26, 27, 29, 30, 31, 35, 36, 41, 44, 45, 48, 49, 56, 57, 58, 62, 63, 64, 65, 66, 67, 68, 69, 71, 72], "anniversari": [0, 66], "annot": [2, 16, 27, 29, 31, 32, 33, 34, 48, 49, 56, 66, 67], "announc": 43, "anoth": [2, 9, 10, 11, 12, 16, 24, 26, 33, 43, 46, 49, 58, 64, 65, 67, 68, 69, 72], "answer": [12, 35, 41, 46, 71], "anti": [11, 50, 61, 65], "antipattern": 66, "anyon": [4, 16, 65], "anyth": [10, 12, 16, 23, 26, 28, 29, 30, 31, 34, 39, 48, 58, 59, 64, 65, 66, 67, 69, 72], "anytim": 30, "anywai": 16, "anywher": [16, 44, 49, 68], "api": [2, 5, 8, 14, 15, 16, 20, 22, 23, 30, 31, 32, 44, 48, 50, 51, 53, 57, 59, 61, 63, 64, 65, 68, 73], "app": 51, "appar": 67, "appear": [15, 16, 51, 66, 67], "append": [32, 67], "appl": [16, 45, 58], "appli": [0, 2, 26, 28, 31, 32, 51, 56, 62, 63, 66, 68, 72, 73], "applic": [0, 31, 45, 62, 66, 68, 69, 72, 73], "approach": [4, 7, 10, 15, 23, 37, 41, 42, 43, 51, 65, 67, 73], "appropri": [9, 12, 18, 27, 28, 32, 44, 48, 53, 66], "approv": 4, "april": [4, 30, 35, 43, 65], "apt": 26, "aptli": 9, "ar": [2, 4, 5, 7, 8, 9, 10, 11, 12, 14, 15, 16, 18, 21, 23, 24, 26, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 51, 55, 56, 58, 59, 60, 62, 63, 64, 65, 66, 67, 68, 69, 71, 72, 73], "arbitrari": [15, 51, 56, 58, 65, 67, 72], "arbitrarili": 2, "arbitrary_kei": 58, "architectur": [4, 13, 17], "archiv": [2, 8, 10, 11, 13, 15, 17, 19, 23, 28], "archiveformat": 18, "area": 4, "aren": [11, 16, 18, 51, 66], "arg": [16, 39, 65, 66], "argument": [8, 16, 18, 29, 48, 51, 53, 56, 58, 59, 65, 68], "argumentless": 56, "aris": [16, 28, 30, 65], "aritfact": 63, "around": [10, 26, 29, 30, 46, 59, 66, 67], "arrai": [10, 48], "arrow": [8, 18], "art": 10, "articl": [26, 28, 43, 52, 65, 66, 69], "artifact": [2, 8, 9, 10, 11, 12, 14, 15, 16, 18, 21, 24, 25, 26, 27, 31, 32, 33, 34, 40, 41, 42, 48, 50, 51, 53, 56, 58, 59, 62, 63, 64, 66, 67, 68, 69, 71, 72, 73], "artifact_collect": 59, "artifact_for_md": 59, "artifact_format": 56, "artifactapiusag": [48, 69], "artifactclass": 65, "arvum": 72, "arxiv": 43, "ask": [16, 35, 41, 43], "aspect": [10, 14, 15, 17, 47, 65, 66], "assembl": 66, "assert": [16, 48, 57], "assert_frame_equ": 67, "assert_has_line_match": [48, 59], "assert_no_nans_in_t": 57, "assert_output_typ": [48, 59], "assertequ": [63, 65, 66], "assertin": [64, 67], "assertionerror": 59, "assertnotequ": 66, "assertraisesregex": 65, "assertregisteredsemantictyp": [57, 65], "assertsemantictyperegisteredtoformat": 57, "assess": 69, "asset": [9, 36, 44, 45, 57], "assign": [15, 16, 18, 28, 48, 49, 58, 66, 68, 69], "assist": [26, 37, 41, 45], "associ": [2, 7, 15, 16, 18, 26, 27, 28, 37, 44, 51, 56, 58, 59, 62, 63, 65, 66, 67, 68, 69, 71, 72], "assum": [10, 30, 35, 37, 51, 62, 66], "assur": 58, "ast": 21, "astut": 11, "asynchron": 8, "atom": 36, "attach": 16, "attempt": [48, 49, 65, 66], "attent": 35, "attribut": [21, 29, 57, 67], "attt": 66, "audienc": 8, "august": [30, 41, 46, 70], "auth": 35, "authent": 35, "author": [5, 23, 43, 59, 66, 68], "authorit": 68, "auto": 58, "autodoc": 5, "autom": [7, 26, 40, 46, 48, 50, 65, 73], "automat": [12, 15, 16, 31, 32, 34, 52, 53, 56, 65, 68, 69], "avail": [2, 8, 9, 11, 23, 28, 37, 41, 42, 48, 49, 53, 55, 59, 60, 65, 66, 67, 68, 69, 72], "avoid": [7, 16, 28, 41, 42, 44, 48, 51, 65, 66, 69, 73], "awai": [16, 51, 56, 65], "awar": [16, 28, 37, 46, 51, 53, 65, 67, 72], "ax": 58, "b": [0, 16, 58, 59, 66], "b733": 18, "bacillota": 72, "bacillus_a": 72, "back": [10, 15, 16, 30, 51, 60, 62, 63, 64, 65, 66, 68, 69, 70, 71, 73], "backfir": 43, "background": [65, 66], "backward": [9, 29, 42, 73], "bacteri": 28, "bacteria": 72, "bad": [51, 65], "baerheim1994effect": 56, "bag": 16, "bail": 11, "banana": [16, 58], "bar": [29, 36, 56, 58, 59], "bar1": 59, "bar2": 59, "bar3": 59, "bar4": 59, "bar5": 59, "bar6": 59, "bar7": 59, "barcod": [11, 49], "barcode_id": 11, "base": [2, 4, 10, 11, 14, 21, 26, 27, 28, 30, 40, 41, 46, 49, 50, 51, 56, 58, 62, 64, 65, 66, 67, 69], "basetyp": 56, "basi": [28, 30, 66], "basic": [0, 11, 15, 16, 29, 30, 37, 48, 65, 66], "baz": 58, "bbe1": 9, "bdc8a": 18, "beauti": 4, "becaus": [2, 8, 9, 10, 11, 12, 15, 16, 18, 26, 28, 30, 36, 37, 39, 48, 51, 62, 63, 64, 65, 66, 67, 68, 69, 72], "becom": [8, 11, 12, 16, 27, 30, 56, 58, 65, 67, 69], "been": [9, 16, 18, 23, 26, 27, 29, 35, 41, 51, 62, 65, 66, 67, 68, 71, 73], "befor": [7, 8, 16, 28, 30, 39, 40, 41, 42, 44, 48, 49, 63, 64, 65, 66, 67, 68, 69, 72, 73], "begin": [27, 43, 46, 62, 65, 66, 68, 73], "behav": 72, "behavior": [2, 8, 32, 48, 49, 56, 58, 66, 67, 68], "behind": [15, 16, 63, 68], "being": [5, 10, 12, 15, 16, 18, 28, 31, 37, 39, 42, 49, 51, 62, 65, 66], "believ": 10, "belong": 16, "below": [8, 9, 15, 18, 29, 30, 37, 44, 59, 62, 65], "benchmark": 46, "benefici": 30, "benefit": [15, 51, 65, 67, 69], "best": [16, 51, 58, 65, 66, 67], "beta": [27, 31, 32, 44], "beta_phylogenet": [27, 31], "beta_result": 32, "better": [8, 10, 12, 15, 16, 28, 45, 56, 63, 65], "between": [2, 4, 7, 8, 9, 10, 11, 15, 16, 18, 21, 27, 28, 30, 31, 32, 40, 50, 51, 58, 63, 65, 67, 72], "beyond": 48, "bib": [15, 18, 31, 44, 66], "bibtex": [15, 26, 31, 44, 52, 66], "bibtext": 66, "big": [51, 67, 69], "bigger": [44, 64], "binaryfileformat": [2, 11, 54, 56], "bio": [64, 65, 66], "bioconda": [30, 37], "bioinformat": [0, 2, 65, 66, 67, 72, 73], "biol": 0, "biolog": [2, 11], "biologi": [43, 66], "biom": [11, 26, 27, 28, 48, 66], "biomv210dirfmt": 9, "biopython": 65, "birthdai": 16, "bit": [11, 16, 30, 44, 58, 64, 65, 66, 67, 68], "blame": 51, "blank": [16, 58, 62], "blast": [66, 67], "blith": 16, "blob": 45, "block": [39, 48, 65, 67, 68, 72], "blue": [15, 18], "blur": 7, "bodi": [49, 64, 65], "bolyen": [0, 5, 23], "book": [23, 26, 32, 66, 69], "bool": [16, 29, 56, 57, 58, 62], "bool_dict": 29, "bool_list": 29, "boolean": [16, 58, 59, 66], "bore": 65, "both": [8, 11, 15, 16, 28, 42, 44, 48, 58, 65, 66, 67, 68, 69], "bother": 69, "bottleneck": 4, "bottom": [8, 15, 65, 66, 69], "bound": [16, 58], "boundari": 66, "bowtie2index": 65, "box": [8, 15, 18, 51, 68], "brackendb": 65, "bracket": [8, 30, 37], "brai": 32, "branch": [7, 30, 36, 37, 58], "bray_curtis_distance_matrix": 32, "bray_curtis_emperor": 32, "bray_curtis_pcoa_result": 32, "braycurti": 32, "break": [9, 11, 16, 26, 69], "breviti": 8, "brief": [43, 44, 65, 66, 72], "briefli": [47, 65, 66, 67], "bring": [15, 16, 66], "broad": [16, 36, 58], "broadli": [51, 55, 69], "broken": [15, 23, 69], "browser": [2, 7, 35, 51], "bsd": [23, 66], "bug": [15, 51, 68], "buggi": 51, "bui": 43, "build": [4, 7, 16, 23, 26, 30, 40, 41, 50, 51, 55, 65, 66, 67, 68, 71], "built": [7, 8, 10, 16, 23, 26, 40, 43, 51, 62, 64, 65, 66, 68, 72], "bunch": [41, 64, 66], "bundl": 16, "burn": 51, "busi": [11, 43, 51], "bytesio": 60, "c": [0, 16, 51, 58, 59, 66], "c1": 58, "c9811bcaa3e6": 15, "cach": [7, 48, 64, 65, 66, 68, 72], "cake": 16, "calcul": [24, 44], "call": [8, 9, 10, 11, 12, 16, 21, 26, 27, 28, 29, 31, 32, 33, 34, 39, 44, 48, 49, 51, 56, 57, 59, 60, 64, 65, 67, 68, 69, 71, 72], "callabl": [53, 56, 59], "came": 48, "can": [2, 4, 5, 7, 8, 9, 10, 11, 12, 15, 16, 18, 23, 24, 26, 27, 28, 29, 30, 31, 32, 34, 35, 37, 38, 41, 43, 44, 45, 46, 47, 51, 52, 56, 57, 58, 59, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73], "cancer": [7, 23], "cannot": [2, 8, 16, 24, 34, 60, 62], "canon": [23, 59], "capabl": [2, 11], "capit": 16, "caporaso": [0, 5, 23, 37, 41, 63, 64, 65, 66, 67, 68, 69, 71, 72], "captur": [9, 18, 41, 48, 73], "care": [8, 15, 27, 28, 48, 67], "carri": [10, 16, 28, 56], "casava": 11, "casavaoneeightsinglelanepersampledirfmt": 11, "case": [2, 5, 8, 9, 11, 12, 15, 16, 26, 28, 29, 31, 37, 41, 45, 48, 49, 51, 58, 59, 62, 64, 65, 66, 67, 68, 69, 71, 72], "cast": [49, 62, 69], "cat": [58, 66], "cat1": 18, "catch": 30, "categor": [16, 58, 62], "categori": [16, 43, 46], "categorical_md_col": 49, "categoricalmetadatacolumn": [49, 62], "caught": 39, "caus": [8, 58], "caveat": [41, 73], "cc": 23, "cd": [7, 45], "cd4015db31da": 15, "cell": 49, "central": [2, 15, 46, 49, 63], "certain": [5, 10, 62, 68], "certainli": [2, 35], "chain": [15, 63, 65, 68], "chalk": 16, "challeng": [10, 65], "chan": 23, "chang": [2, 4, 7, 8, 18, 23, 26, 29, 30, 35, 42, 43, 45, 48, 51, 56, 59, 64, 65, 66, 67, 68, 69, 71, 73], "changelog": 18, "channel": [30, 37], "chapter": [2, 23, 29, 40, 66, 67, 68, 72], "charact": [36, 44, 58, 62, 64, 65, 66], "characterist": [15, 18], "charset": 64, "chart": 67, "check": [8, 9, 11, 18, 28, 43, 45, 48, 49, 57, 59, 63, 64, 65, 66, 67, 69, 71], "checkbox": [16, 66], "checksum": 18, "chef": 16, "child": 12, "chloe": 0, "choic": [27, 28, 31, 35, 43, 58, 68], "choos": [10, 12, 15, 28, 42, 46, 49, 67], "chose": [15, 66, 72], "christian": 66, "christoph": 0, "ci": 45, "circl": [15, 16, 63], "circular": 42, "circumst": 51, "circumv": 51, "citabl": 43, "citat": [10, 15, 18, 31, 32, 34, 44, 50, 51, 55, 56, 61, 64, 68, 69, 71], "citation_text": 56, "citationrecord": [52, 56], "citatonrecord": 56, "cite": [2, 3, 9, 15, 18, 43, 66], "clang": 15, "clarifi": [10, 16], "class": [2, 10, 11, 15, 16, 18, 21, 25, 27, 29, 31, 33, 41, 42, 47, 48, 49, 50, 51, 52, 54, 56, 57, 58, 59, 63, 64, 66, 67, 68, 69, 72, 73], "classmethod": [52, 62], "claus": [23, 62], "clean": [12, 26, 53], "cleaner": 48, "cleanup": [12, 53], "clear": [36, 43, 66], "cleric": 15, "clever": [48, 56], "cli": 15, "click": [15, 66], "client": [15, 26], "clinic": [51, 66], "clone": [7, 36, 45], "close": [9, 10, 16, 41, 62, 65], "closest": 72, "clunki": [48, 64, 65, 66], "cluster": [28, 67], "co": 43, "code": [2, 5, 7, 8, 9, 11, 15, 18, 21, 26, 27, 30, 39, 41, 44, 48, 49, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73], "coerc": [27, 58], "cogniz": 41, "cohes": 2, "colin": 0, "colleagu": 15, "collect": [2, 13, 15, 16, 17, 18, 21, 32, 40, 48, 50, 52, 56, 62, 65, 66, 67], "collection_1": 59, "collection_2": 59, "collector": 12, "collis": 42, "color": 64, "column": [8, 16, 58, 59, 67, 72], "column_a": 59, "column_count": 62, "column_missing_schem": 62, "column_nam": 59, "column_ord": 72, "column_typ": [49, 62], "columnar": 2, "columnproperti": [58, 62], "com": [7, 15, 18, 30, 37, 44, 45], "combin": [2, 10, 11, 15, 16, 24, 31, 32, 34, 39, 48, 57], "combinator": 16, "combine_act": 67, "combine_las_report": 67, "come": [16, 24, 27, 28, 46, 51, 58, 63, 65, 66, 69, 70, 71, 72, 73], "comfort": [40, 45, 67, 71, 73], "comma": 68, "command": [2, 7, 15, 16, 24, 26, 28, 31, 35, 36, 37, 41, 44, 45, 48, 51, 65, 66, 68, 71, 72, 73], "comment": [59, 62], "commentari": 59, "commerci": 23, "commit": [18, 26, 30, 35, 36, 42, 65, 67, 69, 71], "common": [0, 2, 9, 10, 11, 15, 16, 18, 21, 27, 48, 51, 56, 65, 66, 68, 72], "commonli": [28, 49, 55, 66], "commun": [2, 8, 23, 30, 44, 46, 59, 68, 69], "compabl": 42, "compar": [8, 34, 56, 64, 65, 66, 68], "comparison": 34, "compat": [8, 9, 10, 21, 30, 37, 40, 44, 50, 51, 58], "complet": [7, 8, 10, 15, 16, 23, 28, 33, 35, 39, 41, 44, 56, 64, 65, 66, 67, 68, 69, 71, 73], "complex": [9, 15, 16, 44, 48, 64, 67], "compliant": 36, "complic": 72, "compon": [11, 18, 23, 26], "compos": [10, 11, 41, 58, 62, 68], "composit": [10, 15, 16, 37, 58], "compound": 16, "comprehens": 16, "compromis": [15, 16], "comput": [0, 2, 7, 10, 15, 16, 28, 31, 32, 35, 39, 48, 49, 50, 51, 65, 68, 69, 71, 73], "computation": 68, "concat": 67, "concaten": 67, "concept": [28, 66], "conceptu": [58, 65], "concern": [8, 15, 23, 28, 31, 65, 66], "concis": 16, "conclud": 28, "conclus": [50, 73], "concret": [16, 49, 56, 60, 62], "concurr": 42, "conda": [2, 15, 30, 35, 37, 41, 48], "conda_subdir": 45, "condit": [57, 66], "confid": 51, "config": 45, "configur": [9, 11, 26, 46, 67, 68], "confirm": [7, 35, 43, 48, 63, 65, 66, 67, 69, 72], "conflict": [10, 30, 41], "conform": 36, "confound": 12, "confus": [10, 28, 30], "congratul": 71, "connect": [44, 56], "consensu": 16, "consequ": [16, 58], "consid": [2, 10, 11, 15, 16, 18, 26, 41, 51, 58, 62, 65, 66, 67, 68], "consider": [16, 42, 62, 67], "consist": [9, 18, 49, 58, 62], "constrain": [16, 58], "constraint": [8, 10, 35], "construct": [8, 11, 14, 16, 21, 41, 58, 62], "construct_artifact_collect": 59, "constructor": 59, "consult": 36, "consum": [49, 51], "consumm": [15, 66], "consumpt": [2, 66], "contain": [2, 8, 9, 10, 11, 15, 16, 23, 26, 28, 29, 31, 32, 34, 36, 44, 49, 51, 52, 56, 59, 62, 65, 66, 69, 71, 72, 73], "content": [2, 4, 7, 9, 15, 28, 29, 37, 48, 62, 64, 65, 66, 70], "context": [2, 12, 15, 16, 26, 37, 44, 45, 50, 55, 56, 60, 61, 65, 67, 68, 69], "contigu": 58, "continu": [26, 35, 51, 65, 67, 71], "contract": 31, "contraint": 10, "contrast": [2, 9, 15, 24], "contribut": [5, 15], "contributor": 5, "control": [26, 65, 67, 68, 71], "convei": 66, "conveni": [9, 10, 16, 18, 26, 49, 51, 56, 57, 63, 64, 65], "convent": [26, 33, 44, 48, 58, 65, 66, 68, 69, 72], "convers": 27, "converst": 63, "convert": [2, 8, 10, 21, 27, 33, 56, 59, 60, 62, 63, 65, 72], "convinc": [66, 69], "cook": 16, "cookiecutt": [23, 26, 70], "cool": [26, 35, 43, 49, 51, 56, 63, 66, 67], "cool_project": 49, "coordin": [2, 8, 31], "copi": [63, 66, 71], "copyfil": 60, "copyright": 66, "core": [9, 12, 14, 15, 16, 18, 32, 49, 58, 59, 60, 66, 67], "core_metr": 32, "core_metrics_phylogenet": 15, "correct": [15, 48, 51], "correctli": [51, 64], "correspond": [29, 31, 37, 58, 62, 65, 66, 72], "corrupt": 11, "cost": [16, 51], "costli": 51, "could": [10, 15, 16, 24, 28, 29, 31, 37, 43, 44, 48, 51, 56, 58, 64, 65, 66, 67, 69, 72], "couldn": [15, 51], "count": [28, 31, 64], "counter": 66, "counterpart": 16, "counterproduct": 51, "coupl": [8, 30, 51, 63, 65, 66], "courier": 64, "cours": [16, 30, 46, 66, 68], "cover": [7, 23, 44, 48], "cpu": 58, "crash": [39, 51], "creat": [4, 7, 9, 11, 12, 15, 16, 23, 26, 28, 29, 30, 35, 37, 40, 41, 42, 43, 44, 45, 48, 49, 50, 51, 53, 56, 57, 58, 59, 62, 63, 64, 65, 66, 69, 70, 72, 73], "creation": [10, 15, 67], "creator": 65, "credit": 69, "criteria": [46, 62], "critic": [2, 68], "cron": 30, "cross": [7, 15, 51], "crude": 64, "cryptosporangium": 72, "csvdirformat": 56, "csvformat": 56, "ctx": [32, 53, 55, 56, 67, 68], "curiou": 48, "current": [4, 9, 11, 12, 15, 16, 18, 23, 29, 30, 35, 37, 41, 43, 45, 48, 60, 62], "curti": 32, "custom": [4, 15, 18, 30, 71], "custom_ax": 15, "cut": 16, "cutadapt": [42, 49], "cutleri": 16, "cycl": 37, "czi": 23, "d": [0, 5, 23, 26, 30, 31, 41, 44, 64, 65, 66, 68, 69, 71], "d_001": 11, "dada2": [15, 42], "daf": 23, "daf2019": 23, "dag": 15, "dai": 23, "daniel": [0, 73], "darn": 35, "dash": [8, 44], "data": [2, 7, 8, 11, 12, 13, 16, 17, 18, 25, 27, 31, 33, 43, 49, 50, 51, 56, 57, 58, 59, 60, 62, 64, 65, 66, 67, 71, 73], "databas": 67, "datafram": [28, 49, 51, 56, 58, 59, 62, 67, 68, 72], "dataset": [7, 31], "date": [23, 30], "datetim": 15, "david": 0, "de": 29, "deal": [7, 16, 63], "debug": 30, "decemb": 51, "decentr": [10, 13, 17, 18], "decid": [8, 51, 58, 66, 68], "decis": [10, 16, 28, 67], "declar": [11, 28], "decor": [14, 16, 33, 56, 65], "decoupl": 8, "decreas": 67, "dedic": 48, "deep": [12, 15, 16], "def": [11, 27, 29, 31, 32, 33, 34, 48, 49, 51, 56, 59, 63, 64, 65, 66, 67, 68, 69, 72], "default": [15, 26, 30, 31, 35, 37, 49, 52, 56, 57, 59, 62, 65, 66, 67, 68, 69, 71], "default_missing_schem": 62, "defer": [8, 59], "defin": [2, 5, 8, 10, 11, 15, 18, 21, 24, 26, 27, 28, 29, 30, 31, 32, 33, 34, 37, 40, 41, 45, 49, 50, 51, 56, 57, 58, 59, 62, 64, 68, 72, 73], "definit": [11, 16, 24, 29, 34, 48, 57, 65, 66, 67, 69], "defunct": 56, "degre": 31, "delai": 28, "delet": [63, 66, 71], "deliber": 57, "deliv": 10, "demonstr": [10, 56, 59, 66, 71], "demultiplex": [11, 28], "demultiplexed_seq": 18, "demutiplex": 65, "demux": 49, "denot": [2, 8], "depend": [2, 8, 9, 15, 18, 28, 30, 35, 37, 41, 44, 45, 48, 49, 65, 67, 68], "deploi": [42, 69], "deploy": [2, 28, 41, 42, 63, 68, 71], "deprec": [23, 56, 58], "depth": 24, "deriv": [2, 23, 66], "descend": 67, "describ": [2, 4, 8, 9, 10, 11, 15, 16, 18, 26, 28, 30, 31, 32, 34, 36, 44, 45, 48, 51, 59, 62, 63, 64, 65, 66, 67, 68, 69], "descript": [8, 9, 10, 15, 29, 31, 32, 34, 36, 44, 51, 56, 62, 63, 64, 65, 66, 68, 72], "descriptor": [14, 16, 42, 60], "design": [9, 10, 27, 30, 62, 63, 67, 68], "desir": 59, "destin": [10, 27, 29, 60], "destroi": 12, "destruct": 12, "destructor": 12, "detail": [2, 4, 9, 10, 15, 16, 18, 29, 31, 33, 36, 38, 44, 48, 49, 55, 62, 65, 66, 67], "detect": [28, 65], "determin": [9, 10, 15, 16, 26, 27, 31, 49, 62, 64, 66, 67], "dev": [23, 26, 30, 45, 48, 64, 65, 66, 68, 72], "dev0": 45, "develop": [2, 7, 8, 10, 11, 15, 18, 22, 26, 28, 30, 33, 35, 37, 38, 39, 40, 41, 42, 43, 44, 46, 48, 49, 56, 57, 61, 62, 63, 64, 66, 67, 68, 69, 70, 71, 72, 73], "devic": 64, "df": [49, 59, 65], "diagram": 18, "dialog": [16, 51], "diataxi": [0, 69], "dict": [21, 29, 52, 56, 58, 59, 62, 66, 67, 68], "dict_of_int": 59, "dictat": [58, 59], "dictionari": [21, 29, 31, 44, 48, 56, 58, 67, 68, 69, 72], "did": [63, 65, 66, 67, 68, 72], "didn": [2, 16, 39, 64, 66], "diff": 65, "differ": [2, 7, 9, 10, 11, 15, 16, 18, 21, 23, 28, 30, 31, 34, 37, 40, 44, 45, 50, 51, 59, 62, 63, 64, 65, 66, 67, 68, 69, 71], "differec": 51, "differenti": [11, 16, 18, 67, 72], "difficult": [10, 12, 28, 37], "digress": 65, "dillon": 0, "dimens": 31, "dine": 16, "dir": [57, 66, 71], "direct": [8, 15, 16, 30, 46, 73], "directli": [8, 10, 12, 15, 18, 21, 26, 27, 28, 29, 31, 33, 48, 49, 58, 63, 65, 66, 68, 72], "directori": [2, 9, 10, 12, 13, 15, 17, 18, 26, 28, 29, 30, 35, 37, 45, 48, 56, 59, 64, 66, 68, 69, 71], "directory_format": [14, 56], "directoryformat": [2, 11, 54, 56, 65], "disabl": 65, "disambigu": 28, "disassoci": 15, "discontinu": 58, "discourag": 9, "discours": 46, "discov": [15, 28, 30, 35, 43, 66, 69], "discoveri": [28, 51], "discret": 2, "discuss": [4, 7, 10, 15, 16, 23, 26, 28, 30, 38, 41, 51, 65, 66, 69, 70], "disk": [2, 10, 11, 28, 29, 59, 62, 65], "dispatch": [9, 16, 18], "displai": [15, 26, 44, 48, 59, 64, 66, 71], "disregard": 48, "dissemin": 69, "distanc": [31, 32, 49, 65], "distance_matrix": [27, 31, 32], "distancematrix": [27, 31, 32, 33, 65], "distinct": [15, 16, 32, 56, 58, 66, 72], "distinguish": [2, 10, 16, 58], "distribut": [2, 7, 15, 23, 30, 40, 44, 49, 50, 51, 66, 67, 71], "distro": 36, "dive": [15, 16], "divers": [15, 24, 31, 32, 34, 42, 44, 48, 68], "diversity_lib": 48, "divid": 67, "di\u00e1taxi": [0, 23, 73], "dm": 32, "dna": [2, 11, 64, 65, 66, 67, 68, 69], "dnafastaformat": [11, 66], "dnaiter": [18, 65, 66, 67], "dnasequencesdirectoryformat": [11, 18], "do": [7, 10, 15, 16, 18, 23, 26, 27, 29, 31, 32, 33, 34, 35, 36, 39, 41, 44, 46, 48, 49, 51, 56, 58, 59, 63, 64, 65, 66, 67, 68, 69, 70, 72, 73], "doc": [7, 23, 36, 59, 62, 69], "docstr": [62, 66], "doctyp": 64, "document": [0, 6, 8, 10, 15, 16, 17, 18, 23, 26, 28, 29, 35, 36, 40, 41, 44, 46, 47, 48, 51, 56, 59, 60, 62, 66, 69, 71, 73], "documentat": 69, "docx": 10, "doe": [2, 8, 9, 10, 12, 15, 16, 23, 24, 26, 29, 31, 34, 36, 43, 48, 56, 57, 58, 60, 62, 65, 66, 67, 68, 69], "doen": 9, "doesn": [11, 15, 16, 26, 28, 31, 41, 43, 45, 47, 62, 64, 65, 66, 67, 68, 69], "doi": [23, 43], "domain": [8, 16, 42, 56, 58], "don": [2, 4, 7, 10, 16, 26, 30, 33, 35, 37, 43, 48, 51, 63, 64, 65, 66, 68, 69, 70, 71, 72], "done": [7, 8, 15, 28, 30, 31, 35, 41, 44, 52, 59, 65, 66, 67, 68, 69, 72], "dot": 8, "doubl": 58, "doubt": 43, "down": [15, 16, 65], "download": [15, 45, 51, 59, 71], "downstream": [30, 51, 72], "dozen": 16, "dr": 2, "draft": 41, "drill": 15, "driven": [2, 66], "driver": [7, 48, 56, 59, 69], "drop": 62, "drop_all_miss": 62, "drop_all_uniqu": 62, "drop_missing_valu": [49, 62], "drop_zero_vari": 62, "dropdown": 16, "dry": [2, 68, 72], "dst": 60, "dtype": 62, "due": [10, 29, 30, 67], "dull": 16, "dull_par": 16, "dummi": 51, "dummy_output": 51, "dummy_plugin": [29, 59], "dump": 16, "duplic": [9, 15, 60, 69, 71, 72], "duplicate_t": [28, 66], "durat": 15, "dure": [7, 15, 35, 44, 48, 51, 56, 59, 65, 66, 68], "dwq2": [4, 23, 28, 37, 44, 63, 64, 65, 66, 67, 68, 69, 71, 72], "dwq2_action": 69, "dynam": [8, 12], "e": [0, 2, 7, 9, 10, 11, 12, 15, 18, 21, 23, 26, 28, 29, 30, 31, 32, 34, 35, 37, 41, 42, 43, 44, 48, 49, 51, 52, 56, 58, 59, 60, 62, 64, 65, 66, 67, 68, 69, 71, 73], "e072706": 18, "e1011676": 0, "e168": 15, "e5c5": 15, "each": [8, 9, 10, 15, 16, 18, 23, 26, 28, 30, 31, 32, 36, 37, 41, 48, 49, 56, 58, 59, 62, 64, 65, 66, 68, 69, 73], "earli": [4, 73], "earlier": [16, 29, 65, 66, 68], "eas": [10, 15], "easi": [9, 16, 48, 65, 66, 68], "easier": [15, 16, 18, 35, 37, 41, 63, 65, 66], "easiest": [37, 48, 70, 71], "easili": [15, 26, 28, 69], "eat": 16, "ebb5968ebafb": 15, "ecosystem": [30, 46, 65], "ed": 58, "ed5d": 15, "edg": 66, "edit": [0, 7, 26, 39, 51, 65, 66], "editor": 26, "effect": [8, 15, 58, 67], "effici": [28, 65], "effort": [8, 15, 51], "eigendecomposit": 31, "eigenvalu": 31, "eigenvector": 31, "eigh": 31, "either": [2, 8, 16, 28, 30, 35, 41, 51, 58, 62, 65, 66, 67, 68, 71], "element": [15, 16, 44, 49, 58, 59], "elev": 49, "elig": [46, 49], "elizabeth": 0, "els": [10, 26, 28, 29, 48, 65, 68], "elsevi": 66, "elsewher": [51, 68], "email": [15, 46], "emp": 49, "emperor": [15, 32, 44], "emperor_plot": 32, "emploi": [42, 64], "emppairedenddirfmt": 11, "empti": [26, 29, 51, 56, 58], "en": 64, "enabl": [2, 9, 10, 15, 26, 35, 39, 43, 48, 49, 63, 64, 65, 66, 67, 68, 69, 72], "enclos": 37, "encod": [9, 10, 62], "encode_miss": 62, "encount": [41, 65, 67], "encourag": [46, 56, 72], "end": [8, 15, 29, 36, 43, 44, 58, 64, 65, 66, 68, 70, 71, 73], "endnot": 66, "energi": 67, "enforc": [16, 58, 62], "engin": [2, 51, 66, 68], "enough": [9, 16, 48, 67], "ensur": [9, 11, 12, 30, 45, 48, 49, 51, 57, 64, 65, 66, 67, 69], "entir": [8, 9, 11, 12, 16, 37, 49, 56, 64, 68], "entireti": [65, 67], "entiti": [5, 10, 65], "entri": [2, 8, 26, 51, 52, 56, 58], "entry_point": [26, 44], "enumer": [8, 11, 29, 58, 67], "env": [30, 37, 45, 66], "environ": [2, 7, 10, 18, 30, 35, 37, 40, 41, 48, 50, 65, 66, 69, 71, 72], "environment": 66, "epeat": 68, "epoch": [30, 36, 37, 59], "epub": 10, "equal": [11, 16, 67], "equenc": 66, "equival": [7, 21, 58, 68], "erron": 68, "error": [10, 11, 28, 51, 59, 62, 65, 66, 72], "especi": [28, 71], "essenti": [16, 29, 44, 51, 56, 58, 65], "establish": 42, "etc": [11, 15, 16, 18, 31, 44, 49], "euclidean": 49, "eval": 14, "evalu": [16, 59], "evan": [0, 5, 16, 23], "evelop": 23, "even": [10, 15, 16, 26, 28, 32, 41, 48, 51, 64, 65, 66, 67], "evenness_vector": 32, "event": [15, 30, 58, 59, 66], "eventu": 39, "ever": [15, 16, 26, 34, 58, 63, 72], "everi": [9, 10, 11, 15, 34, 56, 58, 62, 66, 68, 69, 73], "everyon": [16, 43, 51], "everyth": [28, 45, 48, 51, 55, 63, 64, 65, 66, 67, 71], "everywher": 14, "evid": 67, "evil": 11, "evolut": 66, "evolv": [9, 18], "exact": 31, "exactli": [2, 10, 15, 24, 34, 48, 62, 63, 65, 66, 72], "examin": 27, "exampl": [2, 4, 7, 8, 9, 11, 12, 16, 18, 23, 24, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 37, 39, 40, 42, 43, 44, 45, 49, 50, 51, 55, 56, 57, 58, 60, 61, 62, 63, 64, 65, 66, 67, 68, 70, 71, 73], "example1": 56, "example2": 56, "example_funct": 29, "example_function_variant1": 56, "example_function_variant2": 56, "excacerb": 12, "except": [11, 12, 15, 16, 32, 34, 40, 43, 50, 58, 64, 65, 66, 68], "excit": [49, 69], "exclud": [16, 26, 44, 58], "exclus": [42, 48, 57, 58, 68], "execut": [2, 8, 31, 48, 56, 57, 59, 66, 67, 68, 69, 71, 73], "execute_exampl": [48, 57, 69], "executionusag": 48, "executionusagevari": 59, "exemplifi": 28, "exercis": 67, "exist": [2, 4, 10, 11, 15, 16, 26, 28, 29, 31, 35, 36, 39, 40, 42, 46, 49, 50, 51, 56, 58, 59, 60, 65, 66, 67, 71], "exit": [12, 21, 28, 39, 66, 71], "exp": 48, "exp_format": 57, "expand": [4, 7, 15, 56, 64, 73], "expect": [7, 10, 11, 16, 21, 23, 28, 29, 31, 34, 36, 41, 43, 45, 48, 51, 57, 63, 64, 65, 66, 67, 69, 71], "expected_hit": 67, "expens": 68, "experi": [15, 43, 45, 67, 69], "experienc": [26, 41], "expert": 46, "expertis": [51, 69], "explain": 16, "explan": [17, 23, 26, 28, 38, 50, 65], "explanatori": 65, "explicit": 72, "explicitli": [16, 26, 29, 39, 51, 58], "explor": [23, 34, 44, 64, 68, 69], "export": [7, 49, 64, 66, 69], "expos": [11, 48, 49, 68], "express": [15, 16, 21, 48, 56, 58, 59, 69], "ext": 59, "extend": [2, 10, 29, 57, 66], "extens": [5, 30, 34, 38, 59, 65], "extension": 16, "extent": 43, "extern": [51, 56, 68], "extol": 16, "extra": [11, 16, 36, 51, 57, 66, 72], "extract": [9, 10, 15], "extrem": 65, "f": [0, 11, 37, 48, 52, 59, 65, 72], "f1000": 43, "f6105891": 18, "f95f324": 18, "face": [48, 65, 69], "facet": 10, "facilit": [0, 7, 10, 30, 36, 40, 41, 50, 66, 71, 72], "fact": [29, 41, 66], "facto": 29, "factori": [11, 16, 21, 58, 59, 63, 69], "factory1": 59, "factory2": 59, "fail": [8, 28, 30, 51, 57, 64, 65], "failur": [28, 30, 51, 65, 66], "fair": [10, 66], "fairli": [37, 67], "faith_pd": 18, "fall": 66, "fallen": 30, "fals": [15, 33, 56, 57, 58, 62, 65, 66, 67], "familar": 72, "famili": 64, "familiar": [28, 37, 44, 48, 49, 65], "fanci": 16, "far": [16, 31, 72], "fast": 31, "fasta": [10, 11, 28, 65, 66], "faster": [7, 8], "fastq": [10, 11, 28, 65], "fastqgzformat": 11, "favorit": 66, "featur": [2, 10, 24, 28, 32, 37, 48, 49, 51, 56, 58, 62, 65, 67, 69, 71, 72], "feature_data": [18, 66], "feature_t": [32, 48, 51], "feature_table1": 48, "feature_table2": 48, "feature_table3": 48, "feature_table_merge_exampl": 48, "feature_table_merge_three_tables_exampl": 48, "featuredata": [51, 64, 65, 66, 67, 68, 72], "featuret": [9, 27, 28, 31, 32, 48, 51, 71], "feb": 15, "feedback": [4, 5, 26, 70], "feel": [15, 30, 41, 43, 51, 65, 67, 69, 71], "few": [15, 16, 27, 28, 30, 32, 34, 42, 46, 47, 57, 64, 65, 68, 72, 73], "fewer": 67, "ff": [33, 56, 59, 63, 65, 69], "ff427b50aaa1": 15, "fh": [11, 33, 56, 57, 64, 65, 67, 72], "field": [15, 16, 21, 36, 51, 52, 58, 59, 65, 66], "field_memb": [16, 58], "field_nam": [16, 58], "fifteen": 15, "fig": [9, 15, 18], "figur": [2, 8, 34, 51, 64, 65, 67], "file": [2, 8, 10, 13, 16, 17, 18, 24, 25, 26, 29, 30, 31, 33, 34, 35, 37, 44, 45, 48, 50, 51, 52, 56, 57, 59, 60, 62, 63, 64, 66, 67, 68, 69, 71, 72], "file1": 59, "file2": 59, "filecollect": 11, "fileformat": 11, "filehandl": 52, "filenam": [10, 11, 15, 18, 26, 30, 57, 65], "filepath": [26, 52, 57, 58, 62, 65], "filesystem": [12, 58], "fill": 37, "fillet": 16, "filter": [7, 62, 67, 72], "filter_column": [49, 62], "filter_id": 62, "final": [8, 15, 16, 34, 41, 44, 48, 49, 58, 65, 66, 67, 68, 69, 72, 73], "find": [15, 16, 23, 26, 28, 32, 34, 37, 40, 43, 44, 51, 56, 58, 60, 63, 66, 67, 68, 69, 71, 72, 73], "fine": [15, 35, 41, 45, 51], "finish": 8, "first": [7, 8, 11, 16, 23, 26, 27, 30, 32, 34, 35, 37, 40, 41, 48, 50, 51, 53, 56, 58, 63, 65, 67, 69, 70, 71, 72], "first_memb": 59, "fish": 16, "fit": 58, "five": 15, "fix": [10, 16, 30, 51, 58, 65], "flake8": 45, "flavor": 24, "flexibl": [41, 64, 65, 69, 72], "flexilib": 48, "float": [16, 58, 62, 65, 66, 68], "flow": 67, "flower": 16, "fly": 11, "fn": 65, "focu": [11, 15, 23, 41, 45, 48, 65], "focus": [46, 62, 66], "fold": 72, "folder": 36, "folk": 69, "follow": [2, 9, 10, 16, 18, 26, 29, 30, 31, 32, 34, 35, 36, 37, 39, 41, 44, 45, 48, 56, 62, 63, 64, 65, 66, 67, 68, 69, 71, 72], "font": 64, "foo": [29, 56, 58, 59], "forg": [15, 30, 37], "forget": [15, 16, 66, 70], "fork": [7, 16], "form": [2, 8, 15, 16, 29, 51, 65, 66], "formal": [16, 67, 68], "format": [2, 8, 9, 10, 13, 15, 16, 17, 25, 26, 27, 30, 31, 33, 40, 41, 42, 44, 47, 48, 49, 50, 55, 56, 57, 59, 61, 62, 63, 64, 66, 67, 69, 72, 73], "format_inst": 11, "format_str": 21, "former": 41, "formerli": 2, "fortun": [12, 29], "forum": [29, 41, 44, 46, 51, 56, 65, 66, 69, 70], "forward": [11, 30, 35, 66, 68, 69, 73], "found": [5, 8, 15, 18, 30, 57, 58, 63, 64, 65, 66, 67, 71, 72], "foundat": [23, 41], "four": [8, 66], "fp": 65, "fr": 0, "fraction": 67, "fragil": 64, "fragment": [18, 56, 58, 67], "framework": [0, 2, 8, 9, 11, 14, 15, 16, 18, 23, 27, 38, 42, 44, 45, 48, 49, 51, 57, 59, 66, 69], "free": [2, 15, 26, 43, 44, 46, 51, 65, 66, 67, 71], "freedom": [16, 65], "frequenc": [9, 27, 28, 30, 31, 32, 48, 51, 71], "frequent": [28, 69], "fridai": 28, "friendli": [16, 44, 66, 67], "from": [2, 4, 5, 7, 8, 9, 10, 11, 12, 15, 16, 18, 21, 23, 26, 27, 28, 29, 30, 31, 32, 33, 35, 37, 39, 41, 42, 43, 44, 45, 46, 48, 50, 51, 52, 53, 56, 57, 58, 59, 62, 64, 65, 66, 67, 68, 69, 70, 72, 73], "from_typ": [57, 60, 66], "front": 26, "frost": 16, "fruit": 16, "frustrat": [28, 51, 67], "fsvd": 31, "ft": 48, "ft1_factori": 48, "ft2_factori": 48, "full": [15, 18, 23, 47, 64, 66, 67, 68, 69], "fulli": [7, 15, 36, 51, 68], "fun": 69, "function": [2, 4, 8, 9, 11, 15, 16, 26, 27, 28, 29, 30, 33, 38, 41, 44, 45, 48, 49, 51, 53, 56, 57, 59, 63, 65, 67, 68, 69, 72, 73], "fundament": [16, 66, 73], "funder": 23, "further": [8, 12, 15, 16, 58, 62], "futur": [7, 10, 11, 23, 29, 39, 51, 58, 68, 69], "fuzzi": 16, "g": [9, 10, 11, 12, 15, 18, 21, 23, 26, 28, 30, 32, 34, 35, 37, 41, 42, 43, 44, 48, 49, 51, 52, 59, 62, 65, 67, 68, 69, 71, 73], "g1827eab": 45, "g7cf7a7a": 45, "g8ac7e3": 45, "gain": 62, "galaxi": [2, 51, 66, 69, 73], "game": 66, "gap": [64, 66], "gap_extend_penalti": [65, 66, 67, 68], "gap_open_penalti": [65, 66, 67, 68], "garbag": [13, 17, 51], "gatekeep": 4, "gave": 29, "gehret": 0, "gene": 67, "gener": [0, 2, 4, 7, 8, 9, 10, 11, 15, 16, 21, 23, 24, 26, 27, 28, 30, 31, 34, 35, 37, 42, 43, 46, 48, 51, 56, 58, 59, 63, 64, 65, 66, 67, 68, 69, 70, 72, 73], "genera": 28, "genom": 66, "genu": 72, "get": [8, 10, 15, 16, 26, 29, 33, 35, 36, 43, 44, 45, 48, 51, 57, 64, 65, 66, 67, 68, 69, 71, 72, 73], "get_act": [32, 53, 67, 68], "get_artifact_collection_memb": 59, "get_available_cor": 60, "get_column": [58, 62], "get_data_path": [57, 65, 66], "get_id": [49, 62], "get_index_path": 67, "get_metadata_column": 59, "get_miss": 62, "get_sequence_id": 65, "get_transform": [57, 63], "get_valu": 62, "ggcctttttttt": [64, 66], "gh": [35, 71], "gish": 0, "git": [7, 30, 35, 37, 45, 66], "github": [4, 5, 7, 15, 18, 23, 37, 40, 41, 44, 45, 46, 50, 65, 69, 71], "githubusercont": [37, 45], "give": [8, 15, 16, 36, 44, 48, 65, 68, 69], "given": [2, 10, 15, 16, 21, 28, 48, 53, 56, 58, 59, 64, 65, 66, 67], "glanc": [8, 10], "global": [15, 42, 56, 66, 68], "global_pairwise_align_nucleotid": [65, 66, 68], "glossari": 3, "go": [7, 16, 26, 30, 35, 43, 48, 51, 64, 65, 66, 67, 68, 69, 70, 71], "goal": [8, 16, 23, 28, 40, 43, 51, 63, 64, 66, 67, 68, 69, 72], "goe": [11, 15], "golden": [66, 71], "gone": 51, "good": [16, 26, 30, 44, 49, 59, 64, 65, 66, 67, 69, 70, 71], "googl": 66, "gotcha": 11, "grab": 45, "grai": 8, "grain": 15, "grammar": 16, "grant": 23, "granular": 16, "grape": 16, "graph": 15, "graphic": [2, 10, 16, 34, 51, 66], "grasp": 16, "great": [16, 48, 65, 69], "greater": [18, 58, 66], "greg": [5, 23, 43, 66], "gregcaporaso": 45, "gregori": 0, "gross": 16, "groundwork": 5, "group": [2, 8, 16, 34, 67, 69], "grow": 26, "grumpi": 35, "gttt": 66, "guarante": 51, "guid": [23, 26, 30, 37, 38, 45, 48, 50, 69], "guidanc": [41, 73], "guidelin": [37, 69], "gz": 11, "gzip": 11, "ha": [8, 9, 10, 11, 15, 16, 18, 23, 26, 28, 30, 32, 35, 39, 41, 44, 48, 49, 51, 58, 62, 64, 65, 66, 67, 68, 71, 72, 73], "habit": 44, "hack": [45, 48], "had": [9, 16, 28, 43, 56, 64, 65, 68], "hadn": 9, "halfwai": 8, "halko2011": 31, "hand": [8, 15, 16, 28, 49, 51, 65, 72], "handl": [12, 15, 27, 29, 40, 49, 50, 51, 62, 63, 67], "happen": [15, 16, 26, 28, 31, 59, 65, 67], "happi": [16, 69, 70], "har": [47, 57], "hard": [15, 16, 28, 42, 65], "harder": 16, "hardwar": 15, "has_missing_valu": [49, 62], "hash": 16, "hassl": 30, "have": [2, 5, 8, 9, 10, 11, 12, 15, 16, 18, 23, 27, 28, 29, 30, 31, 32, 35, 36, 37, 39, 41, 42, 43, 45, 46, 48, 49, 51, 57, 58, 59, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73], "haven": [10, 16, 30, 51, 65, 66, 67], "head": [16, 57, 64], "header": 62, "hear": [5, 12, 28], "hello": [58, 59], "help": [4, 7, 10, 15, 16, 26, 28, 30, 34, 35, 36, 37, 41, 44, 45, 46, 48, 51, 56, 59, 65, 66, 68, 69, 70, 71, 72], "helper": [57, 63, 65, 67, 69], "here": [2, 4, 7, 8, 11, 15, 16, 18, 23, 26, 27, 28, 30, 31, 32, 33, 34, 35, 37, 43, 44, 45, 47, 48, 49, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72], "herman": 0, "heurist": 31, "hide": 15, "hierarchi": 16, "high": [8, 15, 44, 65, 66, 67, 68], "highest": [8, 36, 67], "highli": [11, 51, 66, 69], "highlight": 10, "hint": [64, 65, 66, 69], "histor": [9, 18, 26], "histori": [2, 10, 15, 18], "hit": [67, 72], "hoc": [11, 58], "hold": [15, 16], "home": 16, "homebrew": 26, "homologi": [67, 72], "honor": 69, "hood": [63, 67, 69], "hook": [14, 57, 64], "hope": [28, 43, 67], "hopefulli": [30, 65], "host": [2, 7, 15, 23, 36, 37, 71], "hour": 28, "hous": [15, 37, 72], "how": [2, 4, 7, 8, 9, 11, 13, 15, 16, 17, 23, 26, 28, 30, 31, 33, 35, 38, 41, 44, 45, 48, 50, 51, 58, 59, 62, 64, 65, 66, 67, 68, 69, 71, 72, 73], "howev": [2, 5, 8, 10, 16, 37, 41, 49, 51, 65, 72], "html": [7, 9, 34, 64, 67, 72], "http": [0, 7, 15, 18, 23, 30, 37, 44, 45, 59, 62, 66], "huge": [9, 28, 66], "human": [18, 31, 56, 58, 64, 65, 66, 67], "hunt": [0, 2], "hurt": 43, "hyphen": 56, "hypothes": 66, "hypothesi": [2, 66], "i": [2, 4, 5, 7, 8, 9, 11, 12, 13, 14, 16, 17, 18, 21, 23, 24, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 41, 42, 43, 44, 45, 47, 48, 49, 51, 52, 53, 55, 56, 57, 58, 59, 60, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73], "i_tabl": 48, "icon": [15, 18], "id": [2, 48, 49, 56, 58, 59, 62, 63, 65, 67, 69, 72], "id_count": 62, "id_head": 62, "idea": [2, 4, 7, 8, 9, 10, 16, 26, 28, 30, 43, 65, 66, 69, 72], "ideal": [7, 16, 41, 43, 56, 65, 66, 69], "ident": [2, 9, 18, 65, 66, 68], "identfii": 65, "identif": 0, "identifi": [2, 8, 15, 27, 30, 48, 49, 51, 56, 58, 59, 62, 65, 66, 67, 72], "identity_with_metadata_column_get_mdc": 48, "ids_to_keep": 62, "idx": 11, "ignor": [9, 10, 26, 51, 56, 58, 62, 66], "ignore_missing_sampl": 15, "ignore_pcoa_featur": 15, "iim": 23, "illumina": 11, "illustr": [8, 9, 16, 18, 27, 35, 41, 66, 68], "imag": 36, "imagin": [16, 29, 48], "immedi": [43, 73], "immutablemetadata": 49, "impact": [10, 15, 28, 31, 58, 66, 67], "imped": 16, "implement": [9, 16, 29, 30, 37, 48, 51, 59, 62, 65, 66, 67, 68, 72, 73], "implementationerror": 21, "impli": [9, 65, 66, 68], "implic": 66, "implicit": 58, "import": [7, 8, 10, 14, 15, 16, 18, 26, 28, 30, 31, 33, 42, 43, 44, 48, 51, 56, 58, 63, 64, 66, 67, 68, 69, 72], "import_data": [32, 48, 59, 63, 67, 69], "import_from_format": 59, "import_modul": 65, "importantli": [8, 15, 66, 69, 72], "importlib": 65, "imposs": [15, 28], "improv": [4, 43], "in_": 63, "inaccur": [15, 23], "inact": 8, "inadvertantli": 15, "inappropri": 28, "incident": 69, "includ": [2, 7, 9, 10, 11, 15, 16, 23, 26, 30, 31, 32, 34, 36, 37, 43, 44, 48, 49, 51, 56, 58, 59, 62, 65, 66, 67, 68, 69, 71, 72, 73], "include_suffix": 62, "inclus": 58, "inclusive_end": [16, 58, 66], "inclusive_start": [58, 66], "incompat": [29, 73], "incomplet": [15, 51, 68], "incomprehens": 15, "inconveni": 10, "incorpor": 24, "incorrect": 28, "increas": [66, 67], "incredibli": 10, "increment": [43, 58], "incur": 66, "indent": 16, "independ": [28, 58, 65], "index": [3, 9, 34, 58, 59, 62, 64, 67, 72], "index_fp": 67, "indic": [5, 8, 15, 28, 29, 31, 35, 41, 44, 45, 48, 57, 58, 62, 64, 65, 66, 67, 68, 72], "indistinct": 16, "individu": [2, 15, 26, 44, 48, 52, 62, 66, 67], "ineffect": 51, "inequ": 16, "inf": 51, "infer": [48, 49, 62, 66, 72], "infin": 58, "influenc": 31, "info": 45, "inforamt": 26, "inform": [2, 8, 9, 10, 11, 12, 14, 15, 16, 18, 23, 26, 28, 30, 31, 33, 41, 43, 44, 46, 49, 56, 64, 65, 66, 67, 71, 72], "informat": 23, "infrastructur": 67, "infrequ": 63, "inher": 65, "inherit": [18, 66], "ini": 9, "init_artifact": [48, 59, 69], "init_artifact_collect": 59, "init_artifact_from_url": 59, "init_format": 59, "init_metadata": 59, "init_metadata_from_url": 59, "initi": [11, 23, 26, 28, 30, 35, 48, 64, 65, 66, 73], "inject": 48, "inner": [15, 62, 72], "inplac": [67, 72], "input": [2, 8, 9, 11, 12, 15, 16, 18, 24, 27, 28, 31, 32, 33, 34, 40, 48, 49, 50, 56, 57, 58, 59, 64, 65, 66, 68, 71], "input_descript": [31, 32, 34, 51, 56, 64, 66, 68], "inputtypea": 58, "inputtypeb": 58, "insdc": 62, "insert": [18, 64, 66], "insid": [10, 16, 18, 31, 48, 65, 67, 72], "insight": 43, "inspect": 16, "inspir": 59, "instal": [2, 7, 10, 26, 30, 40, 41, 42, 43, 44, 48, 50, 63, 65, 69, 72], "instanc": [2, 16, 29, 31, 44, 48, 49, 56, 57, 65, 66, 68], "instanti": [21, 26, 29, 31, 49, 56, 59, 65, 66, 69], "instead": [8, 12, 16, 21, 28, 32, 44, 51, 52, 56, 58, 62, 64, 66, 67, 68], "institut": 23, "instruct": [7, 10, 23, 26, 30, 31, 36, 37, 40, 41, 45, 69, 71, 73], "int": [11, 16, 29, 31, 32, 56, 58, 59, 60, 62, 67], "int_collect": 59, "int_collection6": 59, "int_collection7": 59, "int_dict": 29, "int_list": 29, "int_seq_collect": 59, "integ": [9, 11, 16, 29, 56, 58, 62], "integr": [15, 26, 39, 41, 48, 50, 67, 73], "intellig": 16, "intend": [2, 8, 21, 23, 28, 35, 45, 48, 49, 65, 66, 67, 69, 73], "intent": [2, 8, 28, 58], "intention": [9, 64], "inter": [8, 16, 66], "interact": [2, 8, 9, 16, 21, 29, 44, 49, 51, 66, 68], "interest": [11, 15, 16, 23, 26, 37, 43, 49, 56, 58, 67, 70], "interestingdataformat": 49, "interfac": [2, 4, 7, 8, 10, 11, 15, 18, 22, 23, 24, 26, 31, 35, 44, 45, 48, 49, 51, 56, 58, 59, 65, 66, 73], "intermedi": [15, 24, 65], "intern": [10, 28, 29, 49, 56, 59, 65, 68, 69], "interoper": 41, "interpret": [2, 9, 15, 18, 24, 43, 51, 58, 62, 67, 69], "interrupt": 67, "intersect": 58, "intervent": 7, "intial": 59, "introduc": [4, 18, 28, 35], "introduct": [0, 2, 48, 66, 67, 72], "introspect": 8, "intsequence1": [56, 59], "intsequence2": 56, "intsequenceformat": [11, 59], "intuit": [16, 66], "invalid": [11, 28, 51, 62, 65, 66], "invent": 10, "invers": 58, "invert": 16, "invest": 43, "investig": 15, "invoc": 16, "invok": [8, 12, 48, 53, 57, 59], "involv": [10, 16], "io": [52, 65], "ipython": [66, 69], "iq": 28, "is_semantic_typ": 58, "isn": [7, 11, 16, 26, 43, 57, 59, 65, 66, 67, 69, 72], "iso": 15, "issu": [12, 15, 28, 30, 41, 44, 46, 48, 65, 70], "itcr": 30, "item": [29, 66], "iter": [7, 29, 43, 52, 58, 59, 62, 66, 67], "ith": 23, "its": [2, 7, 8, 10, 11, 15, 16, 18, 26, 27, 28, 29, 31, 34, 38, 44, 48, 49, 53, 56, 59, 62, 64, 65, 66, 67, 68, 69, 71, 72], "itself": [8, 9, 10, 15, 29, 58, 65, 66], "iupac": 65, "j": 0, "jaccard": 32, "jaccard_distance_matrix": 32, "jaccard_emperor": 32, "jaccard_pcoa_result": 32, "januari": [7, 51], "jargon": 65, "jewel": 0, "job": [28, 30, 58, 67], "join": [62, 64, 67, 70, 72], "journal": [43, 66], "journei": [0, 66], "json": [16, 21], "jsonp": 18, "juggl": 12, "jupyt": [2, 23, 69], "just": [8, 14, 15, 16, 23, 26, 28, 29, 41, 43, 45, 48, 49, 51, 58, 63, 64, 65, 66, 67, 69, 71, 72], "k": 56, "keef": 0, "keep": [11, 15, 16, 26, 30, 32, 42, 64, 67], "kei": [8, 15, 18, 29, 31, 36, 44, 48, 51, 52, 56, 58, 59, 66, 69], "kept": 72, "key1": 58, "key2": 58, "keyerror": 72, "keyword": 48, "kind": [2, 8, 11, 16, 28, 49, 65], "kishitanii": 72, "kit": 8, "kitchen": 16, "knife": 16, "knive": 16, "know": [9, 11, 16, 23, 26, 28, 35, 43, 48, 51, 64, 65, 66, 67, 69, 71, 72], "knowledg": [8, 46, 66, 68], "known": [10, 12, 16, 28, 31, 58], "kruskal1952us": 34, "kwarg": 59, "la": [67, 72], "lab": [23, 37, 41, 63, 64, 65, 66, 67, 68, 69, 71, 72], "label": [8, 16, 48], "lack": 16, "lai": 5, "lane_numb": 11, "lang": 64, "languag": [10, 14, 15, 16, 28], "laptop": [67, 69], "larg": [9, 15, 28, 31, 43, 56, 65, 66, 73], "larger": [8, 58, 67], "las_act": 67, "las_result": 67, "last": [14, 16, 35, 51, 64, 65, 67, 71], "latebindingattribut": 14, "later": [8, 10, 65, 66, 71], "latest": [30, 36, 48, 71], "latter": 41, "launch": 7, "layer": 8, "layout": [2, 10], "lead": [26, 28, 39, 51, 65], "learn": [10, 23, 26, 27, 43, 47, 66, 68, 69, 71, 73], "least": [2, 11, 28, 29, 34, 51, 62, 65], "leav": [16, 26, 28, 30, 37, 64], "left": [28, 62, 72], "left_on": 72, "legal": 58, "legendrelegendr": 31, "len": [65, 72], "length": [67, 72], "lengthi": 16, "less": [8, 23, 28, 60, 65], "lesson": [64, 66], "let": [15, 16, 23, 26, 32, 35, 48, 51, 58, 63, 64, 65, 66, 67, 68, 69, 71, 72, 73], "level": [8, 11, 15, 26, 30, 35, 37, 40, 44, 49, 50, 51, 56, 62, 64, 65, 66, 68, 69, 71], "lib": [30, 66], "librari": [30, 31, 40, 41, 44, 48, 50, 65, 66], "licens": 66, "life": 27, "lifetim": 12, "lift": 10, "lightli": 26, "lignment": 66, "like": [2, 7, 8, 9, 10, 11, 15, 16, 18, 23, 26, 28, 29, 30, 31, 32, 34, 35, 37, 39, 40, 41, 42, 44, 45, 46, 48, 49, 51, 56, 58, 59, 60, 63, 64, 65, 66, 67, 68, 69, 71, 72], "limit": [11, 15, 16, 37, 41, 42, 58], "line": [2, 7, 11, 15, 16, 18, 27, 28, 31, 35, 36, 44, 45, 51, 56, 59, 64, 65, 66, 72], "linear": 9, "link": [5, 15, 34, 48, 60, 62, 65, 66, 67, 68], "linkcod": 5, "linux": [35, 45], "lipman": 0, "list": [3, 7, 11, 14, 15, 16, 18, 28, 29, 31, 32, 34, 37, 41, 44, 45, 48, 52, 56, 57, 58, 59, 65, 66, 67, 68, 70, 72], "liter": [48, 56, 59], "littl": [7, 16, 44, 64, 65, 66, 71], "live": [15, 26, 41, 44, 65], "ll": [15, 16, 23, 26, 28, 30, 35, 37, 40, 45, 48, 51, 63, 64, 65, 66, 67, 68, 69, 71, 72, 73], "llm": 15, "load": [8, 11, 18, 26, 28, 31, 36, 44, 48, 49, 51, 52, 56, 57, 62, 64, 65, 66, 69, 71], "local": [0, 7, 35, 45, 48, 57, 66, 68, 71, 72], "local_alignment_search": 67, "local_pairwise_align_nucleotid": [66, 68], "localalignmentsearchresult": [67, 72], "localalignmentsearchresultsformat": 72, "localhost": 7, "locat": [8, 12, 36, 37, 51], "log": [15, 32, 35], "logic": [9, 11, 58, 60], "login": 35, "long": [2, 8, 10, 11, 27, 28, 31, 37, 41, 56, 58, 64, 65, 66, 67], "longer": [56, 64, 65, 66, 67], "longitudin": 49, "look": [8, 9, 11, 16, 18, 26, 28, 29, 30, 32, 34, 37, 39, 40, 44, 48, 49, 57, 58, 63, 64, 65, 66, 67, 68, 69, 71, 72, 73], "lookup": [59, 66], "loop": 67, "loss": 31, "lot": [16, 26, 28, 30, 43, 44, 46, 48, 51, 63, 64, 65, 67, 69, 72], "loudli": 28, "love": [5, 12, 41, 43], "lower": 62, "lsmat": 33, "lsmatformat": 33, "luck": 43, "luckili": 64, "m": [0, 7, 26, 48, 64, 65, 66, 67, 68, 69, 71], "m3": 67, "macbook": 67, "machin": [15, 16, 51, 65], "machineri": [35, 57, 65], "maco": 45, "macosx": 15, "made": [10, 18, 23, 28, 39, 48, 49, 59, 65, 66, 71], "magic": [26, 67], "magnitud": 31, "mai": [2, 4, 7, 8, 10, 15, 16, 18, 23, 26, 28, 29, 30, 31, 40, 41, 48, 49, 51, 53, 56, 58, 59, 62, 65, 66, 67, 68, 69, 71, 73], "mail": 44, "main": [16, 30, 37, 39, 62, 64, 65], "maintain": [10, 26, 30, 37, 41, 46, 48, 68, 72], "mainten": [15, 30], "major": [51, 64, 65], "make": [4, 7, 9, 10, 11, 15, 16, 18, 26, 28, 29, 30, 31, 34, 35, 37, 41, 42, 43, 45, 48, 51, 56, 58, 62, 63, 64, 66, 67, 68, 69, 71, 72, 73], "make_artifact": [32, 53, 68], "makefil": 35, "manag": [2, 9, 12, 15, 26, 45, 51, 53, 57, 59, 60, 65, 66, 67, 68, 71], "mani": [5, 9, 10, 11, 15, 16, 18, 26, 28, 31, 34, 42, 43, 48, 49, 65, 66, 67, 68, 72], "manipul": [8, 9, 10, 58, 59, 62], "manner": [31, 49], "manual": [15, 29, 30, 48, 65], "manuscript": [2, 15, 43], "map": [21, 31, 58, 59, 62, 66, 67, 69], "mapping_1": 59, "mapping_2": 59, "mappingproxytyp": 62, "march": [0, 2, 11], "mari": 0, "markdown": [23, 36], "market": 43, "massiv": 15, "masteri": [0, 66], "match": [16, 18, 42, 44, 45, 53, 56, 58, 59, 62, 64, 66, 67, 72], "match_scor": [65, 66, 67, 68], "materi": [7, 49, 57, 59, 69], "matric": 31, "matrix": [31, 32, 65], "matter": [16, 31, 58], "matthew": 0, "max": [11, 36, 56, 65], "maxim": [40, 50, 65], "mayb": [64, 68], "md": [18, 35, 41, 49, 58, 59, 71], "md1": 59, "md2": 59, "md3": 59, "md5": 18, "md5sum": 18, "md_for_column": 59, "me": [16, 26, 51, 64, 65, 66, 68, 69, 71], "mean": [5, 8, 9, 10, 12, 15, 16, 23, 28, 37, 42, 44, 58, 65, 66, 67, 71], "meaning": [48, 51], "meaningless": 51, "meant": [2, 58], "meantim": 65, "mechan": [16, 35, 41, 51, 56], "medic": 66, "meet": [48, 62, 69], "member": [11, 16, 21, 58, 59], "memori": [2, 10, 12, 28, 62, 67], "mention": [35, 64, 65, 66, 68, 69], "menu": 16, "merg": [9, 36, 48, 59, 62, 72], "merge_metadata": 59, "merged_t": 48, "messag": [28, 51, 56, 62, 66, 71, 72], "met": 36, "meta": [26, 45, 64], "metaclass": 14, "metadata": [2, 15, 16, 18, 24, 26, 32, 34, 40, 44, 48, 50, 55, 61, 63, 64, 65, 67, 69, 73], "metadata_column": 72, "metadata_index": 72, "metadatacolumn": [16, 49, 58, 62], "metadatafileerror": 62, "metagenom": [2, 30, 37, 41], "metapackag": [2, 30, 41], "metaprogram": [13, 17], "method": [0, 2, 11, 14, 15, 16, 18, 21, 24, 26, 27, 29, 32, 34, 37, 40, 42, 48, 49, 50, 51, 53, 56, 57, 59, 62, 64, 65, 68, 69, 70, 71, 72, 73], "methodnam": 57, "metric": [15, 27, 31, 32, 44], "mi": 15, "microbiom": [2, 7], "microsecond": 15, "mid": 67, "might": [10, 11, 16, 28, 29, 37, 44, 45, 48, 49, 57, 59, 65, 66, 67], "migrat": 56, "miller": 0, "min": [11, 56, 65], "mind": [15, 16, 41, 42, 65, 69], "mine": [16, 65, 67, 69], "mini": 46, "miniconda": 45, "miniconda3": [45, 66], "minim": [11, 38, 39, 45, 51, 65], "minimum": 64, "minor": [39, 66], "minut": [14, 28, 63, 64, 65, 66, 67], "mirror": 15, "miscellan": [66, 71], "misdiagnos": 51, "misialq": 23, "misinform": 51, "misinterpret": 28, "mismatch": [16, 64, 66], "mismatch_scor": [65, 66, 67, 68], "miss": [28, 41, 49, 51, 62, 67, 72], "missing_id": 72, "missing_schem": [58, 62], "mission": 16, "mistak": 65, "misus": 10, "mix": [16, 73], "mode": [7, 8, 11, 45, 54, 65], "model": [11, 14, 15, 16, 51, 65], "moder": 46, "modestli": 69, "modif": [39, 65], "modifi": [18, 66, 67], "modul": [2, 5, 16, 26, 55, 56, 58, 64, 65, 66, 68, 69], "modulo": 16, "mol": 0, "molecular": [0, 66], "moment": [5, 7, 47, 66], "mondai": 28, "monitor": [44, 46, 67], "monospac": 64, "month": 46, "more": [2, 4, 8, 9, 10, 11, 12, 15, 16, 18, 23, 24, 26, 28, 30, 31, 32, 35, 36, 37, 38, 40, 41, 43, 44, 46, 47, 48, 49, 51, 56, 58, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73], "morn": 28, "most": [7, 8, 10, 15, 16, 23, 28, 30, 39, 42, 43, 49, 51, 56, 58, 64, 65, 66, 67, 68, 69, 73], "mostli": 65, "motiv": [10, 28], "mouth": [16, 43], "move": [7, 8, 9, 10, 29, 30, 45, 59, 63, 65, 66, 67, 68, 73], "mroe": 26, "msa": [64, 65, 66, 68, 69], "msa_summari": 68, "much": [8, 10, 11, 16, 28, 29, 45, 48, 59, 65, 66], "multi": [7, 67, 68], "multiindex": 72, "multipl": [7, 8, 10, 11, 15, 16, 18, 21, 23, 28, 29, 37, 51, 56, 57, 58, 59, 64, 65, 66, 67, 73], "multiprocess": 12, "must": [2, 8, 11, 15, 16, 18, 27, 29, 31, 32, 34, 36, 39, 44, 48, 56, 57, 58, 59, 60, 62, 65, 66, 67, 68], "mutual": 57, "mv": 2, "my": [26, 28, 36, 43, 48, 51, 56, 63, 64, 65, 66, 67, 68, 69, 71, 72, 73], "my_act": [51, 59], "my_artifact": 59, "my_column": 59, "my_int": 59, "my_metadata": 59, "my_method": 56, "my_pipelin": 56, "my_plugin": 59, "my_visu": 56, "my_viz": 49, "myer": 0, "mynewformat": 51, "mypi": 31, "myself": 69, "myst": 23, "n": [11, 37, 45, 67], "n_char": 65, "n_job": 32, "n_jobs_or_thread": 15, "n_less": 60, "name": [2, 8, 9, 10, 11, 15, 16, 18, 21, 26, 29, 30, 31, 32, 33, 34, 36, 37, 42, 44, 45, 48, 51, 54, 56, 57, 58, 59, 62, 64, 65, 66, 67, 68, 69, 72], "namedtupl": [21, 52], "namespac": [21, 42], "nan": [57, 62], "narrow": [8, 58], "nation": 23, "nativ": 2, "natur": [58, 62, 69, 73], "navig": [35, 58], "nc": 23, "nd": 23, "nearli": 66, "neat": 26, "necessari": [10, 11, 16, 49, 55, 67], "necessarili": [8, 16, 28, 46, 56], "necessit": [30, 73], "need": [4, 7, 8, 9, 10, 11, 16, 21, 23, 26, 28, 29, 30, 32, 35, 36, 37, 41, 43, 44, 45, 48, 49, 51, 56, 58, 59, 60, 63, 64, 65, 66, 67, 68, 69, 70, 72], "needleman": [0, 66, 68], "needleman1970": [66, 69], "needleman1970gener": 66, "neg": [51, 58, 66], "neither": [15, 16], "nest": [2, 8, 15, 16, 26], "network": 30, "never": [8, 16, 30, 33, 40, 51, 65, 66, 68], "new": [2, 4, 7, 9, 10, 11, 12, 15, 16, 18, 23, 28, 29, 30, 31, 35, 37, 38, 41, 42, 43, 44, 45, 50, 51, 53, 58, 60, 62, 64, 67, 68, 69, 70, 72, 73], "newick": [10, 28, 65], "next": [15, 30, 34, 35, 43, 44, 46, 51, 65, 66, 67, 68, 69, 70, 71, 72, 73], "nexu": 65, "nice": [16, 40, 50, 69], "nicer": 64, "nih": 23, "node": [15, 65, 67], "nois": 56, "nomenclatur": 16, "non": [8, 10, 15, 21, 31, 32, 48, 49, 58, 59, 65, 66], "non_definite_chars_count": 65, "none": [8, 11, 21, 31, 32, 34, 48, 49, 52, 53, 54, 56, 57, 58, 59, 60, 62, 64, 65, 66, 72], "nonetheless": 16, "nonsens": 58, "nor": 15, "normal": [12, 15, 16, 32, 58, 62, 65, 66], "notabl": [10, 15], "note": [8, 15, 29, 30, 35, 36, 37, 47, 48, 56, 58, 60, 62, 63, 65, 66, 67], "notebook": [2, 15], "noth": [15, 26, 56, 58, 59, 60, 62], "notic": [11, 28, 31, 46, 65, 67, 68], "notif": [28, 46, 73], "notion": 15, "noun": 2, "novemb": 0, "now": [8, 10, 11, 16, 18, 23, 30, 35, 39, 41, 43, 45, 48, 58, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72], "np": [48, 62], "nucleotid": [64, 66], "null": [9, 15], "num": 58, "num1": 56, "num2": 56, "num_split": 67, "number": [8, 11, 15, 16, 26, 27, 31, 44, 45, 49, 56, 58, 59, 60, 62, 66, 71, 72], "number_of_dimens": 31, "numer": [16, 58, 62], "numeric_md_col": 49, "numericmetadatacolumn": [49, 62], "numpi": 48, "nw": [64, 66, 68], "nw_align": [64, 65, 66, 69], "nw_align_act": 68, "nw_align_example_1": 69, "nwaligntest": 66, "o": [15, 29, 48, 52, 58, 60, 64, 66, 69, 71, 72], "o1": 48, "o2": 48, "ob": 57, "object": [2, 8, 12, 14, 15, 16, 26, 27, 31, 32, 33, 34, 49, 50, 52, 56, 57, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 72], "obs_feat_vector": 48, "obscur": [51, 63, 65], "observ": [8, 11, 16, 32, 41, 51, 63, 64, 65, 66, 67], "observed_featur": 48, "observed_features_exampl": 48, "observed_hit": 67, "observed_index": 67, "observed_otu": 32, "observed_otus_vector": 32, "observed_viz": 67, "obtain": [49, 59, 62, 67], "obviou": 16, "obvious": [16, 43], "occur": [8, 11, 12, 15, 48, 66], "occurr": 30, "octob": [0, 18, 30], "odd": 66, "off": [12, 16, 30, 37, 43, 51, 65, 68], "offend": 42, "offens": 65, "offer": [12, 18, 46, 49], "offici": [30, 37], "often": [10, 15, 16, 26, 28, 33, 37, 51, 64, 66, 67, 69, 73], "ok": [28, 51, 64, 65], "okai": 45, "old": [7, 16, 23], "older": [9, 15, 28, 56, 71], "omiss": 58, "omit": 62, "onc": [8, 10, 11, 16, 30, 31, 36, 43, 48, 58, 63, 65, 67], "one": [2, 8, 9, 10, 11, 15, 16, 18, 24, 26, 28, 29, 30, 31, 32, 33, 34, 35, 37, 39, 41, 42, 44, 47, 48, 49, 51, 56, 58, 62, 64, 65, 66, 67, 68, 69, 71, 72], "oner": 8, "ones": [41, 65, 66], "onion": 8, "onli": [2, 5, 8, 9, 11, 15, 16, 18, 23, 24, 28, 31, 32, 34, 35, 36, 41, 43, 44, 45, 49, 51, 56, 58, 59, 60, 62, 63, 64, 65, 66, 67, 68, 71, 72, 73], "onlin": [30, 36, 43], "opaqu": 65, "open": [4, 7, 10, 11, 15, 33, 36, 45, 49, 51, 56, 64, 65, 66, 67, 69, 72], "oper": [2, 10, 15, 16, 24, 26, 28, 49, 51, 56, 67, 72], "opinion": 11, "opportun": [49, 51, 67, 68], "oppos": [2, 45, 65, 67], "opposit": [58, 67], "opt": [67, 71], "option": [11, 15, 21, 30, 35, 37, 43, 44, 46, 48, 57, 58, 62, 67], "optional1": 56, "optional2": 56, "orang": 58, "orchestr": 2, "order": [10, 11, 15, 16, 29, 30, 48, 56, 58, 59, 62, 66, 67, 72], "ordereddict": 52, "ordinationresult": 31, "org": [0, 7, 15, 18, 23, 30, 37, 45, 59, 62, 66], "organ": [16, 23, 37, 41, 45, 65], "orient": 56, "origin": [2, 9, 10, 18, 29, 31, 32, 34, 57, 62, 67, 72], "osx": 45, "other": [2, 4, 5, 8, 9, 10, 11, 15, 16, 23, 24, 26, 28, 29, 31, 34, 35, 37, 40, 41, 44, 50, 51, 53, 56, 57, 59, 62, 64, 65, 66, 67, 68, 69, 71, 72, 73], "other_plugin": 16, "otherwis": [11, 29, 49, 56, 57, 58, 62, 71, 72], "otu": 32, "our": [4, 7, 10, 15, 16, 23, 28, 37, 41, 43, 48, 51, 63, 64, 65, 68, 69, 70, 71, 72], "ourself": 68, "ourselv": [16, 66], "out": [9, 11, 14, 16, 26, 28, 30, 41, 43, 49, 51, 56, 59, 62, 64, 65, 66, 67, 68, 69, 71, 72], "outcom": [15, 28, 48, 49, 51, 66], "outdat": [15, 23, 28], "outer": 15, "outf": 51, "outlin": [30, 37, 59], "output": [2, 11, 15, 16, 18, 24, 27, 28, 31, 32, 33, 34, 40, 48, 50, 56, 58, 59, 64, 65, 66, 67, 68, 69, 71, 72], "output_descript": [31, 32, 34, 51, 56, 66, 68], "output_dir": [34, 49, 56, 64, 72], "outsid": [26, 39, 58, 66], "outweigh": 67, "over": [7, 8, 9, 11, 15, 16, 18, 28, 32, 43, 44, 52, 59, 65, 66, 67, 68], "overal": [8, 18], "overhead": 67, "overlap": [48, 58, 62], "overlap_method": 48, "overload": 28, "overrid": [57, 59, 62], "overridden": 57, "overriden": 59, "oversel": 43, "oversight": 65, "overview": [13, 17], "overwrit": 60, "own": [2, 4, 7, 11, 15, 16, 27, 30, 40, 41, 46, 48, 51, 53, 63, 66, 69, 70, 71, 72, 73], "owner": [30, 36, 37], "p": [23, 48, 64, 66], "pacakg": 26, "packag": [2, 8, 14, 15, 25, 30, 31, 37, 44, 45, 50, 52, 56, 57, 64, 65, 66, 67, 69, 71], "pad": 64, "page": [5, 7, 12, 26, 35, 43, 44, 51, 59, 64, 66], "pai": [35, 51], "pain": 66, "pair": [2, 10, 27, 32, 36, 49, 52, 58, 66], "pairedendsequenceswithqu": 11, "pairwis": [2, 49, 64, 67, 68], "panda": [28, 34, 49, 58, 59, 62, 67, 68], "paper": [16, 43, 66], "paperpil": 66, "paragraph": 15, "parallel": [7, 8, 26, 40, 50, 68, 73], "parallel_config": 67, "parallelconfig": 67, "paramet": [2, 8, 10, 15, 16, 21, 24, 27, 29, 31, 32, 34, 44, 45, 48, 49, 52, 56, 57, 58, 60, 62, 64, 65, 66, 67, 68, 69, 71, 72], "parameter_descript": [31, 32, 34, 49, 51, 56, 64, 66, 68], "params_only_method": 59, "paranthraci": 72, "pare": 16, "parent": 15, "parenthesi": 8, "pars": [9, 18, 28], "parse_format": 21, "parse_typ": [14, 21], "parser": [9, 18], "parsl": 67, "part": [4, 11, 12, 17, 23, 29, 30, 37, 38, 41, 47, 51, 55, 58, 59, 64, 65, 66, 69, 70, 72], "parti": 42, "particular": [2, 8, 9, 10, 37, 49, 58, 59], "particularli": 12, "partit": 49, "pass": [2, 10, 11, 15, 18, 28, 29, 30, 35, 37, 44, 45, 48, 49, 51, 58, 64, 65, 66, 67, 68, 69, 72], "passag": 8, "passthrough": 15, "past": [37, 63, 66], "pastri": 16, "pastrybag": 16, "path": [5, 12, 28, 29, 34, 36, 44, 48, 51, 52, 54, 57, 58, 59, 62, 63, 64, 66, 69, 71, 72], "pathlib": 57, "pathlik": 52, "pathspec": 54, "pattern": [11, 26, 37, 50, 61, 65], "payload": [2, 9, 10, 11], "pcoa": [15, 31, 32], "pcoa_result": 32, "pcoaresult": [31, 32], "pd": [28, 34, 49, 51, 56, 58, 59, 62, 67, 72], "pdt": 67, "pear": 16, "peek": [59, 66, 69], "peer": 43, "pen": 16, "penalti": 66, "pencil": 16, "pend": [18, 47, 65], "peopl": [16, 26, 43, 68], "per": [10, 11, 15, 28, 58, 64, 67], "percent": [67, 72], "perciev": 65, "perfect": 16, "perform": [2, 8, 9, 10, 11, 15, 16, 28, 30, 35, 38, 49, 51, 52, 59, 62, 63, 64, 65, 66, 67, 68], "permit": [10, 16, 56], "persist": [10, 11, 15], "person": [10, 16, 37, 69], "perspect": 43, "ph": 49, "phone": 51, "photobacterium": 72, "phrase": 28, "phylogenet": [15, 28, 31, 32, 65, 66], "phylogenetic_metr": 27, "phylogeni": [15, 27, 28, 31, 65], "phylum": 72, "pictur": [7, 8, 59], "piec": [2, 9, 10, 16, 68], "pielou": 32, "pielou_": 32, "pip": [7, 30, 35, 37, 41, 48], "pipelin": [2, 18, 21, 24, 27, 40, 50, 55, 56, 61, 72, 73], "pipx": 71, "pivot": 49, "pkg_resourc": 15, "place": [10, 11, 26, 29, 46, 47, 58, 62, 65, 66, 67, 68, 72], "placehold": 47, "plai": [30, 40, 50], "plain": [10, 16], "plan": [15, 18, 28, 30, 46, 48, 51, 65, 70, 71], "platform": [15, 46], "pleas": [15, 23, 36, 41, 43, 46, 48, 51, 65, 66], "plo": 0, "plot": [15, 32, 34], "plu": 11, "plugin": [2, 4, 5, 7, 8, 10, 11, 14, 15, 16, 18, 23, 24, 25, 28, 29, 31, 32, 33, 34, 39, 40, 46, 48, 49, 52, 53, 54, 57, 58, 59, 61, 62, 63, 65, 67, 68, 69, 70, 72], "plugin_id": [48, 59, 69], "plugin_setup": [33, 44, 48, 64, 65, 67, 68, 69], "pluginmanag": [2, 7, 26, 59], "pluginmethod": 56, "pluginpipelin": 56, "pluginvisu": 56, "png": [15, 34], "point": [8, 9, 15, 26, 34, 35, 41, 56, 58, 62, 63, 65, 66, 67, 68, 72], "poke": [26, 71], "popular": [43, 69], "port": [15, 23], "posit": [2, 58, 64, 65, 66], "possess": [16, 58, 59], "possibl": [9, 10, 15, 16, 18, 28, 37, 48, 51, 57, 58, 60, 63, 64, 65, 66, 67, 68, 69], "possibli": [9, 15], "post": 66, "potenti": 28, "pound": 62, "power": [16, 26, 48, 65, 66, 67, 69], "pr": 30, "practic": [16, 51, 59, 64, 65, 71], "pragmat": [0, 66, 68], "pre": [26, 64], "predecessor": 18, "predefin": [2, 72], "predetermin": 16, "predic": 16, "predict": 30, "prefer": [15, 16, 26, 28, 30, 44, 48, 59, 65], "prefix": [48, 57], "prepar": [43, 59, 68, 72], "presenc": [11, 57], "present": [4, 7, 9, 11, 15, 18, 29, 31, 34, 37, 48, 57, 62, 64, 65, 66, 67, 69, 72], "preserv": [59, 62], "presum": [43, 65], "pretend": 48, "pretti": [26, 35, 67], "prevent": [10, 11, 15, 42, 65, 68], "preview": 7, "previou": [11, 15, 37, 44, 63, 64, 65, 66], "previous": [9, 18, 23, 30, 41, 65, 68], "previous_v": 11, "primari": [2, 15], "primarili": [2, 15, 23, 39], "primit": [2, 10, 13, 17, 21, 29, 31, 48, 56, 59, 66, 68], "princip": 31, "principl": [2, 10, 68, 72], "print": [16, 48, 59, 69], "prior": [10, 15, 18, 29, 32, 37, 49], "prioriti": [43, 51], "privat": [26, 58, 65, 66], "privileg": 8, "pro": 67, "probabl": [16, 28, 43, 48, 51, 65, 67], "problem": [9, 10, 28, 30, 51, 65], "problemat": [15, 51, 67], "proce": [37, 67, 72], "proceed": 39, "process": [2, 7, 8, 12, 16, 30, 35, 36, 39, 43, 44, 48, 51, 60, 65, 66, 67, 71], "processor": 67, "procida": [0, 73], "produc": [2, 12, 15, 16, 18, 21, 24, 27, 31, 32, 34, 48, 51, 56, 58, 66, 67, 68, 69], "profession": 0, "program": 28, "programat": 15, "programm": [0, 28, 66, 68], "programmat": 16, "progress": [43, 73], "project": [5, 10, 23, 26, 31, 43, 44, 45, 51], "project_nam": 56, "prolifer": 72, "promis": 51, "promot": [4, 43], "prompt": [66, 71], "prone": 65, "proof": 10, "propag": 26, "properli": 48, "properti": [14, 49, 58, 62, 64, 65], "proport": [16, 58], "prospect": [15, 35], "protein": [0, 2, 65, 66], "protocol": 14, "prototyp": [51, 66], "proud": 43, "proven": [0, 2, 7, 8, 13, 17, 18, 32, 51, 62, 64, 67, 71, 73], "provid": [2, 4, 5, 8, 9, 10, 11, 12, 15, 16, 21, 23, 24, 26, 27, 28, 29, 30, 31, 32, 33, 34, 36, 37, 38, 40, 41, 44, 45, 47, 49, 50, 52, 58, 59, 60, 62, 63, 64, 65, 66, 67, 68, 69, 71, 72, 73], "proxi": [48, 67], "pseudomonadota": 72, "public": [4, 9, 11, 21, 40, 41, 48, 50, 51, 55, 65], "publish": [28, 43, 66, 73], "pull": [7, 9, 18, 26, 30], "pull_request": 30, "punctuat": 44, "purpos": [8, 10, 16, 23, 49, 56, 59, 64, 66, 69, 71], "push": [12, 30, 35], "put": [26, 30, 37, 65, 66, 67, 68, 72], "py": [5, 16, 18, 44, 48, 63, 64, 65, 67, 69], "pypi": 44, "pytest": [45, 48], "python": [2, 7, 8, 12, 14, 15, 16, 26, 31, 33, 39, 44, 45, 48, 51, 52, 56, 62, 65, 67, 68, 73], "python3": 66, "q": [23, 67], "q1": 67, "q2": [15, 18, 24, 27, 28, 33, 37, 42, 44, 45, 47, 48, 49, 56, 63, 64, 65, 66, 67, 68, 69, 71, 72], "q2_divers": [27, 31, 32, 34, 44], "q2_dwq2": [64, 65, 66, 67, 68, 69], "q2_feature_t": 48, "q2_type": [18, 31, 66], "q2cli": [2, 15, 45, 48, 65, 69, 73], "q2dev": 45, "q2galaxi": 69, "q2view": 15, "qiim": [0, 2, 4, 5, 7, 9, 11, 12, 13, 15, 16, 17, 18, 21, 25, 27, 28, 29, 30, 31, 32, 34, 35, 38, 39, 40, 42, 46, 48, 49, 50, 51, 52, 55, 56, 57, 58, 59, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72], "qiime2": [2, 5, 7, 9, 11, 12, 14, 15, 16, 18, 21, 23, 26, 30, 31, 34, 36, 37, 44, 45, 47, 48, 49, 51, 52, 54, 55, 56, 57, 58, 59, 60, 62, 63, 64, 65, 66, 67, 68, 69, 71, 72], "qual": 28, "qualiti": [28, 66], "quantit": 43, "queri": [49, 62, 67, 72], "query_seq": 67, "query_sequ": 67, "query_sequences_art": 67, "query_split": 67, "question": [8, 9, 11, 35, 41, 44, 46, 48, 49, 65, 71], "quick": [2, 11, 64, 65], "quickli": [11, 28, 43, 65, 69], "quiet": [28, 66, 71], "quietli": 28, "quit": 44, "quot": 73, "qza": [10, 15, 28, 29, 48, 65, 66, 69], "qzv": [7, 10, 15], "r": [0, 7, 11, 16, 31, 51, 59, 64, 65, 67, 68], "r1": 67, "r2": 67, "r3": 67, "race": 43, "raii": 12, "rais": [11, 16, 21, 39, 56, 57, 59, 62, 65, 72], "ram": [28, 67], "ran": [15, 64, 67, 69], "random": 9, "randomli": 2, "rang": [31, 32, 58, 65, 66, 67], "rank": 56, "rare": 58, "rarefi": [24, 32, 65], "rarefied_t": 32, "rather": [7, 15, 16, 28, 30, 42, 43, 51, 64, 65, 66, 69], "raw": [37, 45, 65], "re": [2, 4, 5, 7, 10, 15, 16, 23, 26, 30, 31, 35, 37, 40, 42, 43, 45, 48, 51, 63, 64, 65, 66, 67, 68, 69, 71, 72, 73], "reach": [29, 41, 43, 46, 48, 51, 65], "read": [2, 8, 9, 11, 16, 23, 26, 29, 30, 33, 51, 62, 63, 64, 65, 66, 67, 69, 70, 73], "read_csv": 56, "read_numb": 11, "readabl": [31, 64, 67], "reader": [8, 23, 35, 66], "readi": [7, 8, 31, 35, 43, 63, 65, 66, 67, 69, 71, 72], "readiab": 0, "readm": [35, 41, 71], "real": [15, 16, 23, 48, 50, 59, 67, 71, 72, 73], "realiti": 51, "realiz": [28, 58], "realli": [7, 12, 14, 69, 72], "reason": [10, 15, 28, 39, 51, 65, 68, 71, 72], "reassign": 66, "recal": [63, 65, 72], "receiv": [8, 16, 32, 51, 56, 58, 65, 67, 72, 73], "recent": [7, 10, 16, 28, 30, 35, 65], "reciev": 65, "recip": [26, 45], "recogn": [16, 26, 58, 66], "recommend": [7, 11, 16, 30, 35, 43, 45, 49, 56, 65, 66, 67, 69, 71], "reconsid": 66, "record": [8, 10, 11, 15, 18, 65, 66, 71, 73], "record_map": 11, "recreat": 15, "recur": 51, "recycl": [7, 67], "redesign": 4, "redirect": 60, "redirected_stdio": 60, "reduc": [15, 31, 41, 51, 65, 67], "redund": 15, "ref": [15, 18, 72], "refactor": [63, 67], "refer": [2, 4, 7, 9, 15, 17, 20, 23, 26, 28, 29, 30, 31, 36, 37, 38, 41, 43, 44, 47, 48, 49, 50, 63, 64, 65, 66, 67, 68, 69, 71, 72], "referenc": [26, 29, 36, 37, 66], "reference_metadata": 72, "reference_seq": [67, 72], "reference_sequ": 67, "reference_sequences_art": 67, "referenti": 9, "reflect": [15, 28, 37], "reformat": 9, "refresh": [48, 64, 65, 66, 68, 72], "refus": 16, "regard": [28, 31, 43], "regardless": [15, 28, 37, 43, 62], "regex": 59, "regist": [2, 8, 10, 11, 15, 16, 18, 24, 26, 27, 28, 40, 42, 49, 50, 51, 53, 56, 57, 63, 72], "register_artifact_class": [56, 65], "register_format": [56, 65], "register_funct": [27, 29, 31, 32, 34, 48, 49, 51, 56, 64, 65, 66, 67, 68, 69], "register_semantic_typ": [16, 56, 65], "register_semantic_type_to_format": 56, "register_transform": [33, 49, 56, 63, 65], "register_valid": 56, "register_view": 56, "registr": [11, 15, 27, 29, 44, 47, 48, 49, 50, 55, 58, 61, 66, 67, 68, 69, 72], "regroup": 49, "regular": [58, 59], "regularli": 30, "rehost": 36, "reimplement": 48, "reindex": 72, "reinstal": 48, "rel": [15, 26, 30, 36, 51, 52, 59, 62, 65, 66, 67, 72], "relat": [2, 8, 9, 10, 15, 16, 26, 35, 46, 65, 66, 73], "relationship": [16, 28], "releas": [7, 18, 29, 30, 36, 37, 41, 45, 48, 71], "relev": [4, 8, 15, 18, 23, 26, 28, 30, 37, 41, 44, 45, 49, 65, 66, 69, 72], "reli": [30, 37], "reliabl": 15, "relianc": 15, "remain": [15, 16, 18, 23, 30, 35, 67], "rememb": [15, 16, 66, 72], "remind": [37, 69], "remot": [30, 51], "remov": [4, 11, 49, 62, 65, 66, 72], "renam": [2, 26], "render": [7, 36, 48, 49, 59, 69], "reorgan": [26, 65], "repair": 15, "repeat": [2, 9, 16], "repercuss": 51, "repetit": 47, "replac": [41, 43, 56, 60, 64, 66, 69], "replai": [0, 2, 7, 15, 51, 73], "replay": 51, "repo": [30, 35], "report": [66, 67], "repositori": [7, 23, 26, 30, 35, 36, 37, 45, 48, 66], "repr": 64, "repres": [2, 9, 10, 11, 15, 16, 18, 21, 28, 49, 56, 58, 59, 62, 65, 66, 67, 72], "represent": [2, 9, 11, 15, 16, 18, 28, 34, 49, 58, 64, 68], "reproduc": [0, 10, 15, 51], "reproduct": 15, "request": [7, 8, 10, 18, 26, 28, 30, 41, 43, 46, 49, 57, 60, 62, 65, 66, 67, 71], "requir": [7, 8, 11, 15, 16, 26, 27, 29, 30, 32, 34, 35, 39, 44, 45, 47, 48, 51, 53, 58, 62, 64, 65, 66, 67, 68, 69, 71], "research": [15, 23], "reserv": 16, "reset": 57, "reset_index": 72, "resolut": 58, "resolv": [5, 39, 41], "resourc": [7, 12, 26, 36, 46, 58, 67, 68], "respect": [5, 15, 18, 26, 28, 58, 62, 66, 68], "respons": [2, 8, 9, 12, 41, 43, 46, 51, 71], "rest": 9, "restart": 67, "restrict": [8, 26, 43, 45, 49, 62, 72], "result": [2, 7, 8, 9, 15, 18, 21, 23, 28, 29, 31, 32, 34, 39, 43, 48, 49, 51, 56, 57, 58, 62, 63, 64, 65, 66, 67, 68, 69, 71, 72], "result1": 39, "result2": 39, "result_as_str": 57, "resultcollect": [21, 59], "resulttypea": 58, "resulttypeb": 58, "retain": [57, 62], "retract": [51, 66], "retriev": [59, 62, 68], "retrospect": [2, 10, 13, 17], "return": [2, 8, 11, 16, 18, 21, 28, 31, 32, 33, 34, 35, 39, 48, 49, 51, 52, 53, 56, 57, 58, 59, 60, 62, 63, 64, 65, 66, 67, 68, 69], "reus": [10, 21, 41, 67, 72], "revers": [11, 67], "review": [10, 15, 16, 41, 43, 63, 64, 65, 66, 67, 72], "revis": [26, 66], "rewrit": 14, "rfc": 2, "rich": [8, 10, 16, 69], "right": [8, 16, 41, 48, 51, 62, 65, 66, 73], "right_on": 72, "rightli": 68, "risk": 51, "rm": 66, "rna": [2, 65, 66], "robust": [12, 16], "role": 63, "root": [2, 9, 15, 18, 27, 28, 31, 36, 48, 65], "root_uuid": 18, "rough": 8, "roughli": [10, 26, 67], "round": [8, 63, 67], "roundtripp": 62, "row": [58, 62], "rrna": 65, "rstrip": 11, "rule": [10, 15, 16, 29, 58], "run": [2, 7, 11, 15, 18, 26, 28, 30, 35, 39, 41, 43, 45, 46, 48, 51, 57, 63, 64, 65, 66, 68, 69, 72, 73], "runner": 57, "runtest": 57, "runtim": [9, 14, 15, 65, 67], "s1": [48, 58, 66], "s2": [48, 66], "s3": 48, "s42": 59, "s_": 11, "s_l": 11, "sai": [16, 28, 68], "said": [43, 66], "sake": [45, 67], "same": [8, 10, 15, 16, 18, 21, 28, 29, 30, 32, 34, 37, 42, 43, 44, 48, 51, 58, 62, 63, 64, 65, 67, 68, 69, 71, 72], "sampl": [2, 10, 11, 15, 18, 24, 28, 32, 34, 44, 58, 59, 62, 72], "sample_id": [11, 48], "sampledata": [11, 28, 32, 34, 48], "sampling_depth": [15, 32], "sapienn": 47, "satisfi": 16, "saul": 66, "save": [8, 9, 10, 11, 15, 18, 49, 51, 52, 56, 62, 64, 66, 67, 69], "scale": 64, "scene": 63, "schedul": 30, "schema": 9, "scheme": [9, 15, 36, 62], "scholar": 66, "scienc": [2, 23], "scientif": 51, "scientist": [10, 26, 30], "scikit": [64, 65, 66], "scipi": 31, "scope": [15, 21, 26, 48, 69], "score": [59, 66, 67, 72], "scratch": [23, 35], "script": 15, "sdk": [2, 7, 8, 12, 14, 21, 48, 59, 66, 67, 68], "search": [0, 41, 46, 58, 62, 65, 66], "search_and_summarize_pipelin": 67, "searchabl": 49, "searchandsummarizetest": 67, "second": [15, 16, 32, 37, 50, 56, 58, 64, 65, 67, 69, 73], "section": [10, 15, 16, 18, 23, 51, 55, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72], "see": [2, 8, 9, 10, 11, 15, 16, 18, 23, 26, 27, 28, 31, 32, 34, 35, 41, 43, 44, 45, 46, 47, 48, 56, 58, 60, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72], "seek": [10, 12], "seem": [8, 16, 28, 43, 46, 66], "seen": [8, 9, 11, 59, 71], "select": [7, 15, 16, 35, 51], "self": [9, 10, 11, 15, 16, 51, 63, 64, 65, 66, 67, 69], "sell": 43, "semant": [2, 8, 10, 11, 13, 17, 18, 21, 25, 31, 33, 42, 47, 50, 56, 57, 59, 73], "semantic_express": 56, "semantic_typ": [56, 57, 59], "semantictyp": [16, 29, 58, 65], "semat": [11, 65], "send": [26, 67], "sens": [10, 16, 26, 28, 41, 64, 67, 68], "sentenc": 63, "separ": [15, 31, 44, 72], "seper": 16, "sept": 37, "septemb": 0, "seq": [63, 65, 66, 67, 69], "seq1": [63, 65, 66, 68, 69, 72], "seq1_factori": [63, 69], "seq2": [63, 65, 66, 68, 69, 72], "seq2_factori": [63, 69], "seq3": 72, "seq_num": 65, "sequenc": [0, 2, 8, 10, 11, 28, 63, 64, 65, 68, 69, 72], "sequence1": 66, "sequence2": 66, "sequences_path_mak": 11, "sequenceswithqu": 28, "seri": [23, 34, 35, 58, 62, 69], "serial": [9, 62, 65], "seriou": 66, "serv": [9, 12, 23, 48], "server": [7, 43, 51, 64], "session": 66, "set": [7, 8, 9, 11, 16, 18, 26, 29, 30, 31, 40, 41, 43, 49, 50, 56, 57, 58, 59, 62, 64, 65, 66, 67, 68, 69, 71, 72], "set_index": [67, 72], "set_path_mak": 11, "setup": [44, 57, 67], "setupi": 26, "setuptool": [26, 44], "sever": [2, 34, 42, 44, 57, 58, 67, 72], "shannon": 32, "shannon_vector": 32, "shape": 66, "share": [4, 10, 15, 18, 21, 37, 41, 43, 62, 67, 68, 71, 73], "sharp": 16, "sharp_fillet": 16, "sharpen": 16, "shell": 69, "short": [33, 36, 56, 64, 68], "short_descript": [44, 56], "shortcut": 68, "shorthand": 58, "shortli": [66, 73], "shotgun": 2, "should": [8, 10, 11, 12, 15, 16, 21, 23, 26, 28, 30, 31, 32, 34, 35, 36, 37, 41, 43, 44, 45, 46, 48, 49, 51, 56, 58, 59, 62, 64, 65, 66, 68, 69, 71, 72, 73], "shouldn": [11, 26, 28, 65, 66, 72], "show": [14, 16, 18, 36, 43, 48, 66, 71, 72, 73], "shown": [8, 15, 18, 29, 44], "shred": 16, "shutil": 60, "side": [48, 57, 67], "signatur": [14, 21, 31, 34, 59, 65, 66, 67, 68, 72], "signific": [14, 18], "silenc": [66, 71], "silicon": [23, 45], "silli": [16, 65, 71], "silvers1997effect": 56, "similar": [0, 16, 21, 24, 30, 32, 34, 37, 58, 64, 66, 67, 68, 69, 72], "similarli": [23, 28, 65, 66], "simpl": [9, 15, 16, 29, 36, 44, 48, 52, 58, 64, 65, 66, 67, 68, 71, 72], "simpler": [15, 16], "simplest": [11, 67], "simpli": [9, 15, 16, 29, 49, 51, 66, 67], "simplifi": [9, 15, 43, 44, 47, 57, 63, 65, 68], "simultan": [16, 58], "sinc": [16, 26, 28, 34, 42, 46, 51, 56, 63, 64, 65, 66, 67, 72, 73], "singl": [2, 7, 9, 10, 15, 16, 18, 24, 26, 28, 29, 32, 34, 36, 37, 42, 44, 48, 49, 56, 57, 62, 64, 65, 66, 67, 68, 69, 72], "singlednasequ": [28, 63, 65, 68, 69], "singlednasequencetest": 65, "singlednasequencetransformertest": 65, "singlefiledirectoryformat": [11, 54, 56, 65], "singleint": [29, 59], "singlelanepersamplepairedendfastqdirfmt": 18, "singlerecorddnafastadirectoryformat": [63, 65], "singlerecorddnafastaformat": [65, 69], "singlerecorddnafastaformattest": 65, "singleton": [2, 56], "singular": 29, "site": [15, 49, 66, 71], "situat": [9, 11, 16, 56, 59], "size": [15, 66], "skbio": [27, 31, 33, 64, 65, 66, 67, 68, 69], "skd": 14, "skip": [11, 48, 65], "sklearn_n_jobs_descript": 32, "slate": 23, "sleev": 16, "sloan": 23, "slow": [16, 28, 31, 65, 66, 67, 68], "small": [9, 11, 56, 58, 63, 66, 67, 69], "smaller": [16, 58, 67], "smith": [0, 66, 67, 68], "smoke": 48, "sneak": 65, "snif": 11, "so": [7, 10, 11, 15, 16, 18, 24, 26, 28, 29, 30, 31, 33, 34, 35, 36, 42, 43, 44, 48, 49, 51, 56, 57, 58, 59, 63, 64, 65, 66, 67, 68, 69, 71, 72, 73], "softwar": [2, 8, 9, 10, 11, 15, 26, 28, 30, 31, 41, 43, 51, 60, 66, 68, 73], "software_entri": 18, "sole": 62, "solid": 8, "solut": [10, 68], "solv": [10, 28], "some": [2, 4, 8, 9, 10, 11, 14, 15, 16, 18, 23, 24, 26, 28, 31, 32, 34, 35, 37, 41, 42, 43, 44, 47, 48, 49, 51, 56, 59, 63, 64, 65, 66, 67, 68, 69, 71, 72, 73], "some_act": 39, "some_artifact": 59, "some_plugin": 18, "somedai": 16, "someexcept": 39, "someon": [26, 43, 66, 68], "someth": [16, 28, 37, 39, 43, 45, 49, 51, 56, 64, 65, 66, 67, 69, 71, 73], "sometim": [10, 30, 51, 66], "somewher": [36, 51], "soon": 46, "sooner": 30, "sophist": 16, "sorri": 28, "sort": [8, 28, 64, 67, 72], "sort_kei": 16, "sortabl": 49, "soup": 16, "sourc": [2, 7, 15, 18, 21, 27, 31, 32, 34, 42, 45, 51, 52, 53, 54, 56, 57, 58, 59, 60, 62, 66, 73], "source_format": 57, "space": 44, "span": 37, "spars": 7, "spatula": 16, "speak": [51, 55], "spec": 62, "speci": 72, "special": [11, 15, 16, 26, 58, 66, 67], "specif": [2, 5, 7, 8, 10, 15, 16, 18, 23, 26, 30, 31, 35, 36, 37, 40, 44, 45, 48, 49, 56, 62, 65, 66, 67, 69, 71, 72, 73], "specifi": [2, 15, 26, 29, 30, 31, 37, 49, 57, 62, 64, 65, 66, 67], "spend": [43, 64], "split": [23, 28, 39, 48], "split_act": 67, "split_int": 59, "split_siz": 67, "spoon": 16, "spork": 16, "sqlite": 62, "squar": 15, "src": 60, "stabl": 71, "stackoverflow": 44, "stage": [26, 45, 65, 66, 67], "stai": 30, "standalon": 44, "standard": [9, 10, 26, 36, 66], "start": [8, 15, 16, 26, 28, 30, 34, 35, 37, 41, 43, 44, 45, 58, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73], "stat": 64, "state": [7, 8, 10, 12, 68], "statement": [26, 48, 65, 66], "static": [9, 12], "statist": [34, 44], "stderr": [60, 66, 71], "stdin": 16, "stdio": 60, "stdout": [60, 66, 71], "steak": 16, "stem": 66, "step": [7, 8, 10, 15, 23, 26, 35, 36, 37, 39, 40, 44, 50, 57, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72], "still": [2, 5, 10, 16, 23, 28, 29, 37, 46, 63, 64, 66, 67, 70, 71], "stitch": 32, "storag": [8, 65], "store": [9, 11, 13, 17, 18, 26, 28, 30, 56, 57, 58, 59, 62, 64, 65, 66, 67, 68], "stori": 16, "str": [16, 21, 27, 32, 33, 34, 49, 51, 52, 56, 57, 58, 59, 62, 63, 64, 65, 68, 69, 72], "straight": [16, 35, 66, 68, 69], "straightforward": [37, 44], "strategi": [42, 67], "strict": [16, 58], "strictli": [8, 58], "string": [9, 10, 16, 18, 21, 31, 44, 49, 51, 52, 56, 57, 58, 59, 62, 64, 65, 66, 69], "strip": 29, "stroke": 36, "structur": [2, 9, 10, 12, 15, 16, 18, 25, 28, 30, 31, 37, 50, 58, 69, 71], "struggl": 65, "stuck": [64, 65, 68], "studi": [11, 15, 49, 62], "stuff": [15, 26], "style": 64, "sub": [2, 8, 32, 46, 65], "subclass": [2, 18, 48, 52, 56, 57, 62, 65, 69], "subcommand": 42, "subdir": 45, "subdirectori": [9, 10, 15, 65], "subject": 49, "submit": [7, 26, 43, 58], "submodul": [21, 26, 66], "suboptim": 65, "subsequ": [0, 15, 24, 31, 49, 58, 66, 67, 68], "subset": [11, 58, 67], "substanti": 73, "substitut": 16, "substr": 64, "subsystem": 45, "subtyp": [2, 58], "succeed": 65, "success": [8, 30, 35, 65, 66, 71], "successfulli": [28, 48, 69, 71], "suffer": 31, "suffic": [16, 64], "suffici": [58, 73], "suggest": [5, 16, 30, 37, 43, 56, 67, 71], "suit": [16, 47, 67, 69], "suitabl": 45, "sum": [48, 65], "summar": [64, 68, 69], "summari": [2, 34, 64, 65, 67, 68], "summarize_align": [64, 68], "summarize_alignment_act": 68, "summarizealignmenttest": 64, "sun": 30, "sup": 2, "super": [56, 67], "supersed": 18, "supertyp": 16, "suppli": [56, 62], "support": [2, 4, 7, 9, 10, 11, 15, 18, 23, 30, 35, 36, 39, 40, 41, 43, 44, 45, 48, 49, 50, 51, 56, 58, 60, 62, 65, 66, 68, 69, 73], "suppos": [16, 64, 66], "sure": [28, 30, 35, 41, 45, 48, 63, 65, 71], "surround": 8, "sw": 66, "swap": [14, 16], "sweet": 64, "switch": 7, "sy": [12, 15, 60], "symbol": [30, 37], "symmetr": 65, "sync": [30, 72], "synchron": 12, "synonym": [10, 16, 28], "syntax": [16, 21, 29, 31, 58, 66], "system": [2, 10, 15, 16, 18, 26, 28, 29, 31, 44, 45, 51, 58, 68], "t": [0, 2, 4, 7, 9, 10, 11, 15, 16, 18, 26, 28, 30, 31, 33, 35, 37, 39, 41, 43, 45, 46, 47, 48, 51, 57, 58, 59, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72], "t_in": 58, "t_out": 58, "t_parama": 58, "t_paramb": 58, "taacacccac": [64, 66], "tab": [15, 30, 64, 71, 72], "tabl": [15, 24, 26, 27, 28, 31, 32, 34, 37, 48, 49, 51, 57, 58, 60, 62, 65, 66, 67, 71, 72], "tabul": [49, 67, 72], "tabular": [58, 62, 67], "tabularmsa": [64, 65, 66, 68], "tabulate_las_result": 67, "tabulate_las_results_act": 72, "tag": [15, 18, 44], "take": [18, 27, 28, 30, 31, 32, 34, 41, 42, 43, 46, 56, 59, 62, 63, 64, 65, 66, 68, 69, 72], "taken": 59, "talk": [16, 26], "tar": 9, "target": [23, 30, 35, 36, 37, 40, 41, 43, 57, 69, 71, 73], "task": [8, 16, 40, 64, 73], "taxa": 42, "taxonom": [67, 72], "taxonomi": [51, 66, 72], "team": [15, 23, 45], "tear": 16, "teardown": 57, "tech": 46, "technic": [4, 15, 40, 43, 44, 50, 64, 66, 68], "technologi": 23, "tediou": 65, "tell": [15, 43, 44, 65, 66], "temp_dir": [11, 64], "tempfil": 69, "templat": [7, 23, 26, 41, 50, 59, 64, 70, 73], "temporari": [26, 57, 66], "temptat": 73, "ten": 15, "tend": [43, 56, 63, 67, 69], "term": [2, 10, 15, 24, 28, 30, 37, 62, 65, 66, 69], "termin": [15, 24, 34, 45, 58, 72], "test": [16, 23, 35, 40, 43, 44, 45, 46, 50, 51, 55, 58, 59, 61, 70, 73], "test_alt_gap_extend_penalti": 66, "test_alt_gap_open_penalti": 66, "test_alt_match_scor": 66, "test_alt_mismatch_scor": 66, "test_dir_prefix": 57, "test_dna_to_single_record_fasta_simple1": 63, "test_dna_to_single_record_fasta_simple2": 63, "test_exampl": 69, "test_invalid_default_valid": 65, "test_invalid_max_valid": 65, "test_invalid_min_valid": 65, "test_method": [65, 66, 67], "test_pipelin": 67, "test_semantic_type_registr": 65, "test_simple1": [64, 65, 66, 67], "test_simple1_parallel": 67, "test_simple1_seri": 67, "test_simple2": [65, 66], "test_single_record_fasta_to_dna_simple1": 65, "test_single_record_fasta_to_dna_simple2": 65, "test_transform": [63, 65], "test_types_and_format": 65, "test_visu": 64, "testcas": 57, "testpluginbas": [47, 48, 57, 64, 65, 66, 67, 69], "text": [8, 9, 10, 15, 26, 30, 32, 34, 44, 51, 58, 59, 62, 63, 64, 66, 68, 69, 71, 72], "textfileformat": [2, 11, 51, 54, 56, 65], "textual": 34, "than": [7, 8, 11, 15, 16, 28, 29, 30, 45, 48, 49, 51, 58, 60, 62, 63, 64, 65, 66, 67, 68, 69, 71], "thank": [23, 70], "thei": [2, 8, 10, 11, 15, 16, 18, 26, 27, 28, 29, 33, 35, 36, 37, 41, 43, 46, 49, 51, 56, 58, 59, 60, 63, 64, 65, 66, 67, 68, 69], "them": [7, 8, 10, 12, 15, 16, 18, 23, 26, 29, 30, 31, 35, 37, 39, 41, 48, 51, 52, 63, 64, 65, 66, 67, 68, 69, 72, 73], "theme": 2, "themselv": [8, 15, 48, 66, 67], "theoret": 15, "theori": 67, "therefor": [2, 9, 15, 26, 37, 62, 65, 66, 67, 69], "therein": 30, "thereof": 59, "thermophili": 65, "thi": [2, 4, 5, 7, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 21, 24, 26, 27, 28, 29, 30, 31, 32, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 51, 52, 53, 55, 56, 57, 58, 59, 60, 62, 63, 64, 65, 67, 68, 69, 70, 71, 72, 73], "thing": [7, 11, 15, 16, 26, 28, 30, 43, 48, 51, 56, 59, 64, 65, 66, 67, 68, 69, 72], "think": [12, 16, 28, 49, 63, 65, 66], "third": [28, 67], "thoma": [0, 2], "thorough": 23, "those": [11, 15, 23, 27, 34, 35, 37, 40, 41, 48, 49, 51, 58, 62, 63, 65, 66, 67, 68, 69, 71, 72], "though": [8, 10, 16, 18, 23, 28, 31, 39, 43, 45, 64, 65, 69, 71], "thought": 58, "thread": [39, 58, 68], "three": [8, 11, 15, 24, 28, 48, 59, 65, 66], "three_tabl": 48, "through": [2, 11, 15, 23, 26, 28, 29, 30, 34, 35, 37, 41, 44, 45, 46, 48, 51, 64, 65, 66, 67, 68, 69, 71, 72, 73], "throughout": [23, 66], "throw": 72, "thu": [24, 34, 62], "ti": 46, "tie": 12, "time": [7, 8, 9, 10, 15, 18, 26, 27, 28, 29, 30, 37, 41, 42, 43, 45, 49, 51, 56, 59, 63, 64, 65, 66, 68, 69, 73], "timestamp": 15, "tini": [41, 67], "tip": [35, 67], "titl": [15, 56, 64, 66, 72], "tl": 2, "to_ast": [16, 21], "to_datafram": [49, 62, 72], "to_html": 72, "to_import": 59, "to_list": 72, "to_seri": 62, "to_typ": [57, 59, 60, 66], "togeth": [2, 9, 11, 16, 18, 30, 32, 65, 67, 68], "toggl": 68, "toi": [30, 67], "told": 28, "toler": 42, "too": [2, 11, 15, 49, 51, 65], "tool": [0, 2, 4, 10, 15, 18, 26, 28, 40, 41, 42, 46, 50, 65, 66, 67, 68, 69], "top": [8, 15, 26, 30, 35, 64, 65, 66, 67, 68, 69, 71], "topic": [7, 23, 38, 43, 66], "total": [32, 41, 60], "touch": [15, 66], "toward": [65, 69], "traceback": 16, "track": [9, 10, 13, 17, 18, 51, 52, 53, 62], "tracker": [44, 46, 70], "trade": 65, "train": 30, "trait": 18, "tranch": 73, "tranform": 57, "transfer": 16, "transform": [2, 15, 18, 25, 40, 42, 47, 49, 50, 56, 57, 59, 60, 66, 67, 68, 73], "transform_format": [57, 65], "transit": [7, 28, 65], "translat": [8, 69], "transpar": 15, "travers": 15, "treat": [26, 28, 58, 62], "treatment": [62, 66], "tree": [9, 21, 26, 28, 65], "treenod": 27, "tri": [39, 51, 65], "trick": 16, "tricker": 64, "trigger": 30, "trip": 63, "trivial": [58, 63], "troubleshoot": [30, 37, 41], "true": [16, 21, 57, 58, 59, 62, 66, 67, 72], "truli": 43, "trust": [10, 65, 66], "try": [11, 16, 39, 43, 46, 58, 59, 63, 64, 65, 67, 68, 69, 71, 72], "tsv": [11, 15, 34, 48, 59, 62, 72], "tt": 66, "ttt": 66, "tupl": [21, 31, 32, 56, 58, 62, 68], "ture": 16, "turn": [8, 29, 66, 69], "tutori": [7, 23, 26, 35, 39, 40, 43, 45, 49, 50, 62, 65, 68, 70, 71], "twice": 9, "two": [0, 8, 11, 15, 16, 28, 30, 33, 34, 37, 42, 48, 49, 51, 58, 59, 63, 65, 66, 67, 68, 69, 71, 72], "tx": 63, "txt": [7, 51, 59], "type": [2, 5, 8, 9, 13, 15, 17, 18, 21, 25, 27, 29, 31, 32, 33, 34, 41, 42, 45, 47, 48, 49, 50, 51, 52, 53, 55, 56, 57, 59, 60, 61, 62, 63, 64, 66, 67, 68, 69, 72, 73], "type_frag": 56, "type_from_ast": 21, "typeerror": [11, 16, 21, 59], "typeexpress": 21, "typemap": 58, "typematch": 58, "typevarexp": 58, "typic": [2, 11, 26, 27, 28, 30, 35, 42, 49, 58, 59, 65, 66, 67, 68], "u": [15, 16, 23, 26, 29, 36, 37, 41, 43, 48, 51, 63, 64, 65, 66, 67, 68, 69], "ubiquit": [9, 67], "ubuntu": 45, "ui": [8, 16], "ultim": [16, 26, 41, 43, 46, 69, 71, 73], "ultipl": 66, "uml": 8, "unabl": [5, 16], "unadorn": 16, "unambigu": [51, 65, 68], "unbound": 58, "uncommon": [15, 51], "under": [18, 23, 26, 30, 37, 43, 45, 46, 51, 59, 63, 66, 67, 69], "underli": [11, 16, 32, 33, 48, 60, 64, 66, 67, 68], "underscor": [26, 44, 48], "understand": [8, 10, 12, 15, 16, 23, 28, 30, 63, 66], "understood": 9, "unexpect": 68, "unfamilar": 16, "unfortun": [30, 43], "unicod": [16, 58], "unifi": 49, "unimport": 56, "uninitializedpluginmanagererror": [21, 59], "uninterest": 16, "union": [56, 58], "uniqu": [2, 9, 32, 42, 43, 48, 49, 58, 62, 65], "unit": [2, 26, 30, 43, 44, 48, 67, 68, 69, 70, 71], "unitl": 38, "unittest": [48, 57], "univers": [2, 28, 63], "unix": 2, "unkown": 12, "unless": [16, 18, 32, 44, 45, 58, 71], "unlik": [11, 15, 16, 23, 44, 56, 60, 65, 68, 72], "unnecessari": [65, 67, 72], "unnecessarili": 48, "unpack": [48, 58, 59], "unrecognizedformaterror": 65, "unrel": 16, "unreli": 51, "unroot": [28, 65], "unshred": 16, "unspecifi": [66, 71], "until": [7, 16, 28, 64, 66, 67, 68, 69], "unus": 66, "unusu": 66, "unweighted_unifrac_emperor": 15, "unzip": [10, 15], "up": [9, 12, 16, 18, 26, 29, 30, 40, 46, 48, 49, 50, 57, 63, 64, 65, 67, 68, 72], "upcom": 30, "upda": 48, "updat": [9, 10, 15, 16, 23, 30, 35, 43, 45, 69], "upfront": 51, "upload": 51, "upon": [8, 35], "uppercas": 44, "upstream": [30, 67, 72], "url": [0, 23, 36, 37, 44, 56, 59], "us": [2, 4, 7, 8, 9, 10, 11, 12, 14, 15, 16, 18, 21, 23, 24, 26, 28, 31, 32, 33, 34, 35, 36, 40, 41, 42, 43, 44, 45, 47, 48, 50, 51, 53, 55, 56, 57, 58, 59, 60, 62, 63, 64, 66, 68, 69, 71, 72, 73], "usabl": 30, "usag": [2, 7, 28, 40, 50, 55, 56, 57, 61, 63, 66, 67, 68, 70, 71, 73], "usage_vari": 59, "usageact": [48, 59, 69], "usagedriv": 69, "usageexampletest": 69, "usageinput": [48, 59, 69], "usageoutput": [48, 59], "usageoutputnam": [48, 59, 69], "usagevari": [48, 59], "user": [2, 4, 6, 8, 10, 12, 15, 16, 18, 21, 23, 26, 28, 30, 31, 33, 34, 35, 36, 40, 41, 42, 43, 44, 45, 48, 49, 50, 51, 52, 55, 56, 58, 61, 63, 64, 65, 66, 67, 68, 69, 71, 72, 73], "user_support_text": [44, 56], "usual": [7, 8, 16, 30, 37, 44, 51, 56, 58, 59], "utensil": 16, "utf": 64, "util": [10, 14, 15, 30, 37, 49, 50, 55, 57, 59, 61, 65, 66, 67], "utlit": 49, "uuid": [2, 9, 15, 18, 51, 71], "v": [0, 30, 56, 62], "v0": 18, "v1": [11, 18], "v2": 18, "v4": [15, 18], "v5": 18, "val": [11, 48], "valid": [2, 8, 15, 16, 29, 36, 40, 49, 50, 56, 57, 58, 59, 62, 65, 66, 69], "validate_someth": 56, "validation_level_to_n_char": 65, "validation_seq": 65, "validation_seq_len": 65, "validationerror": [11, 21, 54, 56, 65], "vallei": 23, "valu": [2, 11, 15, 16, 21, 29, 30, 31, 32, 34, 36, 37, 39, 44, 45, 48, 49, 51, 52, 58, 59, 62, 64, 66, 67, 68, 69, 71], "valuabl": 15, "valueerror": [11, 57, 62, 65], "vaniti": 59, "var": 45, "var_typ": 59, "varfield": 16, "vari": [31, 44, 51, 65], "variabl": [16, 18, 21, 26, 56, 58, 59, 64, 66, 67, 68, 69], "variad": 18, "variadic_input_simpl": 48, "varianc": 62, "variant": [16, 28, 56, 58], "variant1": 56, "variant2": 56, "variant_of": [16, 58], "variantfield": 58, "variat": 66, "varieti": 9, "variou": [15, 16, 17, 23, 62], "varriabl": 66, "vastli": 7, "ve": [16, 30, 31, 35, 40, 43, 48, 65, 66, 67, 68, 71, 72], "vector": [32, 34, 48], "verb": [2, 42], "verbos": [66, 71], "veri": [8, 9, 11, 16, 23, 28, 29, 30, 31, 32, 34, 43, 44, 56, 64, 65, 66, 67, 68, 69], "verif": 49, "verifi": [33, 64], "version": [2, 7, 8, 9, 10, 15, 17, 19, 30, 37, 43, 44, 48, 51, 56, 65, 66, 71, 72], "versu": 68, "vertic": 8, "via": [2, 5, 8, 31, 35, 36, 44, 48, 49, 52, 56, 57, 63, 67], "video": 28, "view": [2, 7, 10, 12, 15, 26, 28, 29, 32, 49, 51, 53, 56, 57, 58, 59, 63, 64, 65, 66, 67, 69, 71], "view_as_metadata": 59, "view_typ": [32, 53, 59, 63, 67], "viewer": [15, 64, 72], "viewport": 64, "violat": 68, "virtu": 16, "virtual": 15, "visibl": [15, 43], "visit": [45, 56], "visual": [2, 9, 10, 13, 15, 17, 18, 21, 24, 31, 32, 40, 44, 50, 56, 65, 66, 67, 68, 69, 70, 72, 73], "viusal": 64, "vizual": 64, "vm": 15, "vocabulari": [16, 62], "volatil": 49, "volum": 66, "w": [0, 23, 51, 54, 64, 72], "wa": [2, 9, 10, 11, 15, 16, 18, 23, 26, 28, 30, 31, 34, 35, 45, 48, 51, 56, 62, 63, 65, 66, 67, 68, 72], "wai": [4, 7, 10, 11, 12, 15, 16, 21, 26, 28, 29, 30, 35, 37, 41, 43, 45, 48, 51, 58, 59, 62, 64, 65, 66, 67, 68, 69, 70, 71], "wait": [8, 39, 67], "walk": [35, 51, 59, 73], "want": [15, 16, 23, 26, 28, 29, 34, 35, 37, 39, 41, 42, 43, 45, 48, 49, 64, 65, 66, 67, 68, 69, 71, 72, 73], "warn": [12, 29, 65, 66, 68, 69], "wast": 28, "watch": 11, "waterman": [0, 66, 67, 68], "we": [4, 5, 7, 8, 9, 10, 11, 12, 15, 16, 18, 23, 26, 27, 28, 29, 30, 31, 32, 35, 36, 37, 39, 41, 42, 43, 45, 46, 48, 49, 51, 56, 63, 64, 65, 66, 67, 68, 69, 71, 72], "web": [2, 7, 15, 35, 51], "websit": [9, 15, 18, 43, 44, 56, 66], "wednesdai": 30, "weekend": 28, "weird": 51, "welcom": 5, "well": [2, 7, 9, 10, 11, 15, 16, 28, 30, 41, 42, 43, 49, 62, 63, 64, 65, 66, 73], "went": [28, 64], "were": [2, 9, 15, 16, 18, 39, 51, 56, 58, 64, 65, 67, 69, 71, 72], "weren": 65, "weslei": 0, "what": [2, 8, 9, 10, 16, 26, 28, 30, 31, 33, 35, 36, 37, 43, 48, 51, 56, 58, 59, 63, 64, 65, 67, 68, 69, 71, 72], "whatev": [8, 15, 26, 29, 34, 64, 65, 71], "whatsoev": 65, "when": [2, 7, 8, 9, 10, 11, 12, 15, 16, 18, 21, 26, 27, 28, 29, 30, 34, 36, 39, 41, 42, 43, 44, 48, 49, 51, 56, 57, 58, 60, 62, 63, 64, 65, 66, 67, 68, 69, 71, 72, 73], "whenev": [15, 18, 41, 56, 58], "where": [2, 7, 8, 9, 10, 15, 16, 23, 26, 29, 30, 31, 35, 43, 44, 46, 47, 51, 56, 58, 62, 63, 64, 65, 66, 67, 68, 69, 72], "where_values_miss": 62, "wherev": [5, 16], "whether": [16, 28, 56, 58, 62, 65, 66, 68, 71], "which": [2, 7, 8, 9, 10, 11, 12, 14, 15, 16, 18, 23, 26, 27, 28, 29, 31, 32, 35, 37, 43, 44, 45, 48, 49, 51, 56, 58, 59, 62, 64, 65, 66, 67, 68, 69, 71, 72, 73], "whichev": 41, "while": [2, 5, 9, 10, 11, 15, 16, 28, 30, 37, 41, 43, 44, 57, 64, 66, 68, 69, 73], "who": [15, 23, 41, 45, 51, 65, 69, 73], "whole": [18, 41, 51, 66, 67], "whose": [8, 15, 18, 26, 48], "why": [7, 10, 16, 51, 68, 69], "wide": [10, 44], "widespread": 2, "width": 64, "wikipedia": [2, 51], "wild": 18, "window": 45, "winzip": 10, "wise": 58, "wish": [37, 48, 65], "witcombe2006sword": 56, "within": [2, 7, 8, 9, 11, 15, 16, 18, 21, 27, 29, 30, 37, 42, 44, 46, 48, 49, 58, 59, 62, 68], "without": [2, 9, 10, 15, 16, 26, 28, 29, 56, 58, 64, 65, 66, 67, 73], "won": [15, 46, 51, 64, 65, 66, 67, 71], "wonder": 48, "wood": 0, "word": [2, 10, 15, 16, 26, 43, 66], "work": [2, 3, 4, 7, 8, 10, 11, 15, 16, 23, 27, 28, 29, 30, 35, 37, 41, 42, 43, 44, 45, 48, 49, 51, 57, 58, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73], "workaround": 66, "workflow": [26, 30, 51, 67, 68, 72, 73], "workflow_dispatch": 30, "working_set": 15, "workspac": 16, "world": [16, 58, 73], "worri": [10, 16, 48], "wors": 28, "worst": 67, "worth": [43, 51, 66, 73], "would": [2, 9, 10, 12, 15, 16, 23, 28, 29, 30, 34, 35, 37, 40, 43, 44, 48, 51, 56, 58, 59, 62, 64, 66, 68, 69, 72], "wouldn": [16, 51, 66, 67], "wrap": [15, 31, 32, 42, 72], "wrapper": [29, 59], "write": [2, 4, 7, 8, 11, 16, 18, 23, 28, 33, 34, 35, 40, 44, 50, 63, 65, 67, 68, 70, 71, 72, 73], "write_csv": 56, "written": [18, 29, 34, 36, 42, 44, 51, 62, 64, 65, 69], "wrong": [15, 28, 64, 65, 72], "wrote": [48, 63, 64, 65, 67, 68, 72], "wsl": 45, "wunsch": [0, 66, 68], "x": 58, "x86_64": 15, "xopen": 15, "y": [51, 58, 68], "yaml": [10, 18, 26, 30, 35, 45], "year": [10, 43, 66], "yet": [9, 10, 16, 29, 30, 48, 56, 65, 66, 67], "yield": 67, "yml": [26, 30, 36, 37, 45], "you": [4, 5, 7, 9, 10, 12, 15, 16, 21, 23, 26, 27, 28, 29, 30, 31, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 51, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73], "your": [0, 4, 7, 16, 26, 28, 29, 31, 34, 36, 39, 40, 42, 48, 49, 50, 51, 56, 58, 63, 65, 66, 67, 68, 70, 72], "yourself": [2, 23, 29, 44, 49, 51, 67, 72], "zero": [2, 16, 58, 62, 66], "zip": [10, 15, 16, 48], "zipfil": 9, "zipp": 15, "zuckerberg": 23}, "titles": ["List of works cited", "Index", "Glossary", "Back matter", "Distribution Development", "Developer documentation", "Docs Development", "User documentation", "QIIME 2 architecture overview", "Anatomy of an Archive", "How Data is Stored", "File Formats and Directory Formats", "Garbage Collection", "Explanations", "Metaprogramming", "Decentralized retrospective provenance tracking", "Semantic Types, Primitives, and Visualizations", "Framework Development", "Archive versions", "References", "Interface Development", "Interface developer API reference", "References", "Developing with QIIME 2", "Types of QIIME 2 Actions", "Explanations", "The structure of QIIME 2 plugin packages", "Transformers", "Semantic types, data types, file formats, and artifact classes", "Use Artifact Collections as Action inputs or outputs", "Automate testing of your plugin", "Create and register a Method", "Create and register a pipeline", "Creating and registering a Transformer", "Create and register a visualizer", "Distribute plugins on GitHub", "Distribute plugins on QIIME 2 Library", "Facilitating installation of your plugin for users", "Defining different Format validation levels", "Handling exceptions in parallel Pipelines", "How-To Guides", "Maximize compatibility between your plugin(s) and existing QIIME 2 distribution(s)", "How to play nicely with other plugins", "Publicize your QIIME 2 plugins (or other QIIME 2-based tools)", "Register a QIIME 2 plugin", "Set up your development environment", "Provide technical support for your users", "How to test QIIME 2 plugins", "Writing Usage Examples", "How to use Metadata", "Plugin Development", "Plugin development anti-patterns", "Citations", "Pipeline Context Object", "Formats", "Plugin Development API", "Plugin & Registration", "Testing", "Types", "Usage Examples", "Utilities", "References", "User Metadata API", "Add a second transformer", "Add a first Visualizer", "Add a new Artifact Class", "Add a first (real) Method", "Add a Pipeline with parallel computing support", "Add a first Pipeline", "Add a Usage Example", "Conclusion", "Create your plugin from a template", "Integrate metadata in Actions", "Tutorial: A step-by-step guide to building your first QIIME 2 plugin"], "titleterms": {"": 41, "0": 18, "1": 18, "2": [8, 10, 18, 23, 24, 26, 36, 37, 41, 43, 44, 45, 47, 73], "3": [18, 66, 69], "4": 18, "5": 18, "6": 18, "7": 18, "A": [8, 36, 49, 66, 73], "In": 9, "The": [9, 15, 21, 26, 29, 62, 72], "To": 40, "__init__": 26, "_method": 26, "_pipelin": 68, "_version": 26, "about": 36, "access": 10, "acknowledg": 23, "action": [15, 21, 24, 29, 30, 56, 59, 64, 66, 68, 72], "activ": 45, "add": [36, 63, 64, 65, 66, 67, 68, 69, 72], "addit": [36, 55, 66], "advanc": 49, "agnost": 18, "align": [65, 66, 67, 69], "amplicon": 45, "an": [9, 16, 29, 37, 44, 64, 65, 66, 68, 72], "analogi": 16, "anatomi": 9, "ani": 37, "annot": 59, "anti": 51, "api": [21, 29, 49, 55, 62, 66, 69], "appli": 67, "ar": 27, "architectur": 8, "archiv": [9, 18], "artifact": [28, 29, 49, 65], "assert": 59, "associ": 11, "autom": [30, 69], "avoid": 68, "awai": 15, "back": 3, "base": 43, "basic": 58, "between": 41, "bib": 26, "binari": 11, "block": 15, "build": [45, 73], "call": 66, "can": [48, 49], "captur": 15, "categor": 49, "cfg": 26, "check": 10, "choic": 16, "ci": [26, 30], "citat": [26, 52, 66], "cite": 0, "class": [28, 62, 65], "cli": 29, "collect": [12, 29, 58, 59], "column": [49, 62], "combin": 67, "command": [8, 29, 69], "comment": 48, "commun": 43, "compar": 67, "compat": 41, "compon": 8, "comput": 67, "conclus": 70, "conda": [36, 45], "configur": 30, "content": [23, 73], "context": [48, 53], "continu": 30, "contribut": [7, 23, 43, 45], "cookiecutt": 71, "creat": [31, 32, 33, 34, 67, 68, 71], "current": 7, "custom": 37, "data": [9, 10, 15, 26, 28, 48, 69], "decentr": 15, "defin": [16, 38, 44, 48, 63, 65, 66, 67, 69], "depend": 58, "detail": 8, "develop": [4, 5, 6, 16, 17, 20, 21, 23, 45, 50, 51, 55, 65], "diagram": 8, "differ": 38, "directori": [11, 65], "discov": 65, "displai": 69, "distribut": [4, 35, 36, 37, 41, 45], "dna": 63, "doc": 6, "docstr": 5, "document": [5, 7, 68], "dr": [63, 64, 65, 66, 67, 68, 69, 72], "drop": 49, "duplic": 68, "dure": 71, "dwq2": 26, "each": 67, "empti": 49, "entri": 44, "environ": [15, 23, 36, 45], "exampl": [15, 36, 47, 48, 59, 69, 72], "except": [21, 39, 62], "execut": 15, "exercis": [64, 65, 66, 68, 69], "exist": [37, 41, 45], "expand": 35, "explan": [13, 25], "extend": 16, "extens": 10, "facilit": 37, "factori": 48, "feedback": 41, "few": 66, "file": [9, 11, 15, 28, 36, 49, 65], "filepath": 51, "filter": 49, "find": 5, "first": [45, 64, 66, 68, 73], "fix": 11, "flowchart": 67, "follow": 8, "format": [11, 18, 28, 38, 51, 54, 65], "forum": 43, "framework": 17, "free": 49, "from": [49, 63, 71], "function": [21, 31, 32, 34, 64, 66], "fund": 23, "garbag": 12, "gener": [49, 60], "get": [23, 41], "gha": 30, "git": [26, 71], "github": [26, 30, 35, 36], "gitignor": 26, "glossari": 2, "goal": 10, "goe": 9, "guarante": 18, "guid": [40, 73], "handl": 39, "help": [23, 43, 49], "hint": 68, "how": [10, 27, 36, 40, 42, 43, 47, 49], "i": [10, 15], "id": 15, "identifi": 9, "import": [9, 59, 65], "index": 1, "individu": 55, "inform": 68, "init": 29, "initi": [59, 71], "input": [10, 21, 29, 51, 67, 69, 72], "instal": [35, 36, 37, 45, 71], "instanti": 44, "instruct": 35, "integr": [30, 72], "interfac": [16, 20, 21, 29, 69], "interoper": 10, "intersect": 16, "latest": 45, "layout": 11, "level": [36, 38], "librari": [36, 43], "licens": [23, 26], "line": [29, 69], "list": [0, 55], "load": 29, "local": 67, "make": [49, 65], "makefil": 26, "manifest": 26, "matter": 3, "maxim": 41, "md": 26, "me": 49, "merg": 49, "metadata": [9, 10, 49, 58, 59, 62, 72], "metagenom": 45, "metaprogram": 14, "method": [31, 66, 67], "most": 9, "need": 71, "new": [63, 65, 66, 71], "next": 45, "nice": 42, "normal": 49, "note": 16, "number": 67, "numer": 49, "nw": [65, 69], "nw_align": 68, "object": [21, 28, 29, 44, 53, 55, 59], "option": [64, 65, 66, 68, 69, 71, 72], "other": [42, 43, 45], "our": [66, 67], "out": 48, "output": [21, 29, 49, 51], "overview": [8, 44], "packag": 26, "pairwis": 66, "parallel": [39, 67], "paramet": [51, 59], "pattern": 51, "pipelin": [15, 32, 39, 53, 67, 68], "plai": 42, "plan": 7, "plugin": [26, 27, 30, 35, 36, 37, 41, 42, 43, 44, 45, 47, 50, 51, 55, 56, 60, 64, 66, 71, 73], "plugin_setup": [26, 66, 72], "pluginmanag": 21, "point": 44, "post": 43, "pr": 36, "pre": 43, "predic": 58, "prerequisit": 45, "primit": [16, 58], "print": 43, "properti": 16, "proven": [9, 10, 15], "provid": [46, 48, 51], "public": 43, "publicli": 65, "put": 28, "py": [26, 66, 68, 72], "python": [29, 64, 66, 69], "q2": 26, "q2_dwq2": [26, 63], "q2cli": 66, "qiim": [8, 10, 23, 24, 26, 36, 37, 41, 43, 44, 45, 47, 62, 73], "rang": 16, "readm": [26, 36], "real": 66, "recommend": 37, "refactor": 7, "refer": [19, 21, 22, 61], "refin": 16, "regist": [29, 31, 32, 33, 34, 44, 48, 64, 65, 66, 67, 68, 69], "registr": 56, "repo": 36, "repositori": 71, "requir": [36, 37], "result": 59, "resultcollect": 29, "resumpt": 67, "retrospect": 15, "return": 29, "rule": 9, "run": [67, 71], "save": 29, "search": [67, 72], "search_and_summar": 67, "second": [63, 66], "section": 36, "semant": [16, 28, 58, 65], "sequenc": [66, 67], "serial": 67, "set": [23, 45], "setup": 26, "share": 35, "should": 67, "singl": 11, "singlerecorddnafastaformat": 63, "size": 67, "skbio": 63, "skip": 51, "sourc": 5, "split": 67, "split_sequ": 67, "splitter": 67, "sql": 49, "statu": 23, "step": [45, 73], "storag": 10, "store": 10, "structur": 26, "subtyp": 16, "summar": [67, 72], "summari": 8, "support": [46, 67], "tabl": 73, "tabulate_las_result": 72, "take": [15, 29, 67], "technic": 46, "templat": [35, 71], "test": [26, 30, 47, 48, 57, 63, 64, 65, 66, 67, 68, 69, 71, 72], "test_method": 26, "text": 11, "them": 43, "thi": [23, 66], "through": 8, "time": 67, "tini": [37, 45], "tl": [63, 64, 65, 66, 67, 68, 69, 72], "togeth": 28, "tool": [43, 71], "top": [36, 37], "topic": 55, "track": 15, "transfer": 10, "transfom": 63, "transform": [27, 33, 63, 65], "try": [48, 66], "tsv": 49, "tutori": [69, 73], "type": [10, 11, 16, 24, 28, 58, 65], "understand": 43, "union": 16, "uniqu": 15, "unit": [63, 64, 65, 66, 72], "up": [23, 45, 66], "updat": [65, 67, 68, 72], "us": [27, 29, 30, 37, 49, 65, 67], "usag": [48, 59, 69, 72], "user": [7, 37, 46, 62], "util": [21, 60], "valid": [10, 11, 38, 51], "variabl": 11, "version": [18, 26, 45], "versu": 67, "viewabl": 49, "visual": [16, 34, 49, 58, 64], "weekli": 30, "what": [15, 66], "why": [9, 15], "work": 0, "wrap": 66, "wrapper": 66, "write": [48, 64, 66, 69], "yaml": [9, 15], "your": [23, 30, 35, 37, 41, 43, 44, 45, 46, 64, 69, 71, 73], "zip": 9}}) \ No newline at end of file +Search.setIndex({"alltitles": {"": [[9, null], [10, null], [15, null], [26, null], [49, null], [66, null], [66, null], [66, null], [69, null]], "A few additional tests": [[66, "a-few-additional-tests"]], "A first test of our plugin action": [[66, "a-first-test-of-our-plugin-action"]], "A second test of our action": [[66, "a-second-test-of-our-action"]], "A visualizer for free!": [[49, "a-visualizer-for-free"]], "Accessibility and Transferability": [[10, "accessibility-and-transferability"]], "Acknowledgements": [[23, "acknowledgements"]], "Action registration": [[56, "action-registration"]], "Actions": [[21, "actions"], [59, "actions"]], "Activate the conda environment": [[45, "activate-the-conda-environment"]], "Add a Pipeline with parallel computing support": [[67, null]], "Add a Usage Example": [[69, null]], "Add a first (real) Method": [[66, null]], "Add a first Pipeline": [[68, null]], "Add a first Visualizer": [[64, null]], "Add a local alignment search Pipeline": [[67, "add-a-local-alignment-search-pipeline"]], "Add a new Artifact Class": [[65, null]], "Add a second transformer": [[63, null]], "Add an optional input to tabulate_las_results": [[72, "add-an-optional-input-to-tabulate-las-results"]], "Add parallel computing support to search_and_summarize": [[67, "add-parallel-computing-support-to-search-and-summarize"]], "Add tests and documentation": [[68, "add-tests-and-documentation"]], "Add unit tests and update the search-and-summarize usage example": [[72, "add-unit-tests-and-update-the-search-and-summarize-usage-example"]], "Add unit tests of the new transfomer": [[63, "add-unit-tests-of-the-new-transfomer"]], "Additional Objects": [[55, "additional-objects"]], "Advanced Filtering": [[49, "advanced-filtering"]], "Amplicon distribution": [[45, "amplicon-distribution"]], "An Analogy": [[16, "an-analogy"]], "An optional exercise": [[64, "an-optional-exercise"], [65, "an-optional-exercise"], [66, "an-optional-exercise"], [68, "an-optional-exercise"]], "Anatomy of an Archive": [[9, null]], "Annotations": [[59, "annotations"]], "Archive Version 0": [[18, "archive-version-0"]], "Archive Version 1": [[18, "archive-version-1"]], "Archive Version 2": [[18, "archive-version-2"]], "Archive Version 3": [[18, "archive-version-3"]], "Archive Version 4": [[18, "archive-version-4"]], "Archive Version 5": [[18, "archive-version-5"]], "Archive Version 6": [[18, "archive-version-6"]], "Archive Version 7": [[18, "archive-version-7"]], "Archive versions": [[18, null]], "Artifact classes": [[28, "artifact-classes"], [65, "artifact-classes"]], "Associating Formats with a Type": [[11, "associating-formats-with-a-type"]], "Automate testing of your plugin": [[30, null]], "Automated Testing using Continuous Integration (CI) and Github Actions (GHA)": [[30, "automated-testing-using-continuous-integration-ci-and-github-actions-gha"]], "Automated testing of usage examples": [[69, "automated-testing-of-usage-examples"]], "Back matter": [[3, null]], "Basic types": [[58, "basic-types"]], "Binary File Formats": [[11, "binary-file-formats"]], "Building your first plugin": [[45, "building-your-first-plugin"]], "Calling the action with q2cli and the Python 3 API": [[66, "calling-the-action-with-q2cli-and-the-python-3-api"]], "Categorical Metadata Columns": [[49, "categorical-metadata-columns"]], "Choices": [[16, "choices"]], "Citations": [[52, null]], "Collections": [[58, "collections"], [59, "collections"]], "Command line interface": [[69, "command-line-interface"]], "Comments can provide context": [[48, "comments-can-provide-context"]], "Community Contributions on the QIIME 2 Forum": [[43, "community-contributions-on-the-qiime-2-forum"]], "Compare the serial versus parallel run times of the search-and-summarize": [[67, "compare-the-serial-versus-parallel-run-times-of-the-search-and-summarize"]], "Conclusion": [[70, null]], "Configure Continuous Integration (CI) testing": [[30, "configure-continuous-integration-ci-testing"]], "Configure weekly automated testing": [[30, "configure-weekly-automated-testing"]], "Contributing": [[23, "contributing"]], "Contributing to existing plugins": [[45, "contributing-to-existing-plugins"]], "Contributing to the current user documentation": [[7, "contributing-to-the-current-user-documentation"]], "Create _pipelines.py and add a Pipeline": [[68, "create-pipelines-py-and-add-a-pipeline"]], "Create a function to register as a Method": [[31, "create-a-function-to-register-as-a-method"]], "Create a function to register as a Pipeline": [[32, "create-a-function-to-register-as-a-pipeline"]], "Create a function to register as a Visualizer": [[34, "create-a-function-to-register-as-a-visualizer"]], "Create and register a Method": [[31, null]], "Create and register a pipeline": [[32, null]], "Create and register a visualizer": [[34, null]], "Create your plugin from a template": [[71, null]], "Creating and registering a Transformer": [[33, null]], "Data Goes In /data/": [[9, "data-goes-in-data"]], "Data factories for usage examples": [[48, "data-factories-for-usage-examples"]], "Decentralized retrospective provenance tracking": [[15, null]], "Define a citation for this action": [[66, "define-a-citation-for-this-action"]], "Define a transformer from skbio.DNA to q2_dwq2.SingleRecordDNAFASTAFormat": [[63, "define-a-transformer-from-skbio-dna-to-q2-dwq2-singlerecorddnafastaformat"]], "Define input data for your usage example": [[69, "define-input-data-for-your-usage-example"]], "Defining a Type": [[16, "defining-a-type"]], "Defining a new directory format": [[65, "defining-a-new-directory-format"]], "Defining a new file format": [[65, "defining-a-new-file-format"]], "Defining a new semantic type": [[65, "defining-a-new-semantic-type"]], "Defining a split Method": [[67, "defining-a-split-method"]], "Defining a usage example for nw-align": [[69, "defining-a-usage-example-for-nw-align"]], "Defining and registering a combine method": [[67, "defining-and-registering-a-combine-method"]], "Defining and registering a transformer": [[65, "defining-and-registering-a-transformer"]], "Defining different Format validation levels": [[38, null]], "Defining the usage example": [[69, "defining-the-usage-example"]], "Defining usage examples": [[48, "defining-usage-examples"]], "Defining your plugin object as an entry point": [[44, "defining-your-plugin-object-as-an-entry-point"]], "Dependent Types": [[58, "dependent-types"]], "Detailed Component Diagram": [[8, "detailed-component-diagram"]], "Developer documentation": [[5, null]], "Developing a new artifact class": [[65, "developing-a-new-artifact-class"]], "Developing with QIIME 2": [[23, null]], "Development status of this content": [[23, null]], "Directory Formats": [[11, "directory-formats"]], "Discovering artifact classes": [[65, "discovering-artifact-classes"]], "Displaying usage examples": [[69, "displaying-usage-examples"]], "Distribute plugins on GitHub": [[35, null]], "Distribute plugins on QIIME 2 Library": [[36, null]], "Distribution Development": [[4, null]], "Docs Development": [[6, null]], "Dropping Empty Columns": [[49, "dropping-empty-columns"]], "Examples": [[47, "examples"]], "Exceptions": [[21, "exceptions"], [62, "exceptions"]], "Expanding on the install instructions": [[35, "expanding-on-the-install-instructions"]], "Explanations": [[13, null], [25, null]], "Extending a Type": [[16, "extending-a-type"]], "Facilitating installation of your plugin for users": [[37, null]], "File Formats": [[11, "file-formats"]], "File Formats and Directory Formats": [[11, null]], "File types (or formats) and data types (or objects)": [[28, "file-types-or-formats-and-data-types-or-objects"]], "Finding docstring sources": [[5, "finding-docstring-sources"]], "Fixed Layouts": [[11, "fixed-layouts"]], "Following A Command Through QIIME 2": [[8, "following-a-command-through-qiime-2"]], "Formats": [[54, null]], "Framework Development": [[17, null]], "Funding": [[23, "funding"]], "Garbage Collection": [[12, null]], "General Utils": [[60, "general-utils"]], "Generating metadata as output from visualizations": [[49, "generating-metadata-as-output-from-visualizations"]], "Getting Feedback on your Plugin": [[41, "getting-feedback-on-your-plugin"]], "Getting Help": [[23, "getting-help"]], "Glossary": [[2, null]], "Goals for data storage in QIIME 2": [[10, "goals-for-data-storage-in-qiime-2"]], "Handling exceptions in parallel Pipelines": [[39, null]], "Help others understand how your tool will help them": [[43, "help-others-understand-how-your-tool-will-help-them"]], "Hint": [[68, null]], "How Data is Stored": [[10, null]], "How are transformers used by a plugin?": [[27, "how-are-transformers-used-by-a-plugin"]], "How can the Metadata API Help Me?": [[49, "how-can-the-metadata-api-help-me"]], "How to play nicely with other plugins": [[42, null]], "How to test QIIME 2 plugins": [[47, null]], "How to use Metadata": [[49, null]], "How-To Guides": [[40, null]], "Importing": [[59, "importing"]], "Index": [[1, null]], "Individual Topics": [[55, "individual-topics"]], "Initializers": [[59, "initializers"]], "Input Validation (Type Checking)": [[10, "input-validation-type-checking"]], "Inputs and outputs": [[21, "inputs-and-outputs"]], "Install Prerequisites": [[45, "install-prerequisites"]], "Install and test your new plugin": [[71, "install-and-test-your-new-plugin"]], "Install the latest development version of the QIIME 2 \u201cTiny Distribution\u201d": [[45, "install-the-latest-development-version-of-the-qiime-2-tiny-distribution"]], "Install the tools needed for templating your plugin": [[71, "install-the-tools-needed-for-templating-your-plugin"]], "Installing other QIIME 2 distributions": [[45, "installing-other-qiime-2-distributions"]], "Installing your plugin on top of an existing QIIME 2 Distribution (recommended)": [[37, "installing-your-plugin-on-top-of-an-existing-qiime-2-distribution-recommended"]], "Installing your plugin using the Tiny Distribution and any custom required plugins": [[37, "installing-your-plugin-using-the-tiny-distribution-and-any-custom-required-plugins"]], "Instantiating a plugin": [[44, "instantiating-a-plugin"]], "Integrate metadata in Actions": [[72, null]], "Interface Developer Note:": [[16, null]], "Interface Development": [[20, null]], "Interface developer API reference": [[21, null]], "Interface development API": [[21, "interface-development-api"]], "Interoperability and Extension": [[10, "interoperability-and-extension"]], "Intersections": [[16, "intersections"]], "License": [[23, "license"]], "List of works cited": [[0, null]], "Making Artifacts Viewable as Metadata": [[49, "making-artifacts-viewable-as-metadata"]], "Making the new type and formats publicly importable": [[65, "making-the-new-type-and-formats-publicly-importable"]], "Maximize compatibility between your plugin(s) and existing QIIME 2 distribution(s)": [[41, null]], "Merging Metadata": [[49, "merging-metadata"]], "Metadata": [[49, "metadata"], [58, "metadata"], [59, "metadata"]], "Metadata Columns": [[49, "metadata-columns"]], "Metadata columns": [[62, "metadata-columns"]], "Metagenome distribution": [[45, "metagenome-distribution"]], "Metaprogramming": [[14, null]], "Next steps": [[45, "next-steps"]], "Normalizing TSV Files": [[49, "normalizing-tsv-files"]], "Numeric Metadata Columns": [[49, "numeric-metadata-columns"]], "Optional exercise": [[69, "optional-exercise"]], "Optionally initialize a git repository during plugin templating": [[71, null]], "Overview": [[44, "overview"]], "Pairwise sequence alignment": [[66, "pairwise-sequence-alignment"]], "Parameter Objects for Usage.action": [[59, "parameter-objects-for"]], "Pipeline Context Object": [[53, null]], "Pipeline Provenance": [[15, "pipeline-provenance"]], "Pipeline provenance example": [[15, "pipeline-provenance-example"]], "Pipeline provenance take-aways": [[15, "pipeline-provenance-take-aways"]], "Pipeline resumption \u267b\ufe0f": [[67, null]], "Plans for refactoring of user documentation": [[7, "plans-for-refactoring-of-user-documentation"]], "Plugin & Registration": [[56, null]], "Plugin API List": [[55, "plugin-api-list"]], "Plugin Development": [[50, null]], "Plugin Development API": [[55, null]], "Plugin Utils": [[60, "plugin-utils"]], "Plugin development anti-patterns": [[51, null]], "Post a pre-print": [[43, "post-a-pre-print"]], "Predicates": [[58, "predicates"], [58, "id1"]], "Primitive Types": [[16, "primitive-types"]], "Primitive types": [[58, "primitive-types"]], "Properties": [[16, "properties"]], "Provenance Goes In /provenance/": [[9, "provenance-goes-in-provenance"]], "Provenance Metadata": [[10, "provenance-metadata"]], "Provide technical support for your users": [[46, null]], "Providing input or output filepaths as parameters": [[51, "providing-input-or-output-filepaths-as-parameters"]], "Publicize your QIIME 2 plugins (or other QIIME 2-based tools)": [[43, null]], "Putting it together": [[28, "putting-it-together"]], "Python 3 API": [[69, "python-3-api"]], "QIIME 2 Library": [[43, "qiime-2-library"]], "QIIME 2 architecture overview": [[8, null]], "Range": [[16, "range"]], "References": [[19, null], [22, null], [61, null]], "Refining a Type": [[16, "refining-a-type"]], "Register a QIIME 2 plugin": [[44, null]], "Register the Method": [[31, "register-the-method"]], "Register the Pipeline": [[68, "register-the-pipeline"]], "Register the Visualizer": [[34, "register-the-visualizer"]], "Register the action in plugin_setup.py": [[66, "register-the-action-in-plugin-setup-py"]], "Register the wrapper function as a plugin action": [[66, "register-the-wrapper-function-as-a-plugin-action"]], "Register your Python function as a plugin action": [[64, "register-your-python-function-as-a-plugin-action"]], "Registering an Action that Returns an Output Collection": [[29, "registering-an-action-that-returns-an-output-collection"]], "Registering an Action that Takes an Input Collection": [[29, "registering-an-action-that-takes-an-input-collection"]], "Registering an artifact class": [[65, "registering-an-artifact-class"]], "Registering split_sequences": [[67, "registering-split-sequences"]], "Registering the Pipeline": [[32, "registering-the-pipeline"]], "Registering the type, formats, and artifact class": [[65, "registering-the-type-formats-and-artifact-class"]], "Registering the usage example": [[69, "registering-the-usage-example"]], "Registering usage examples": [[48, "registering-usage-examples"]], "Requesting addition of your plugin to the Library": [[36, "requesting-addition-of-your-plugin-to-the-library"]], "Requirements before requesting the addition of your plugin to the Library": [[36, "requirements-before-requesting-the-addition-of-your-plugin-to-the-library"]], "Results and Assertions": [[59, "results-and-assertions"]], "Rules for identifying an archive": [[9, "rules-for-identifying-an-archive"]], "Run cookiecutter to create your plugin": [[71, "run-cookiecutter-to-create-your-plugin"]], "SQL Filtering": [[49, "sql-filtering"]], "Semantic Properties": [[16, "semantic-properties"]], "Semantic Subtyping": [[16, "semantic-subtyping"]], "Semantic Type": [[58, "semantic-type"]], "Semantic Types, Primitives, and Visualizations": [[16, null]], "Semantic types": [[28, "semantic-types"]], "Semantic types, data types, file formats, and artifact classes": [[28, null]], "Set up your development environment": [[45, null]], "Setting up your development environment": [[23, null]], "Share your plugin on GitHub": [[35, "share-your-plugin-on-github"]], "Should our sequence splitter take the size of each split or the number of splits to create as input?": [[67, null]], "Single File Directory Formats": [[11, "single-file-directory-formats"]], "Skipping format validation": [[51, "skipping-format-validation"]], "Summary": [[8, "summary"]], "Template your plugin": [[35, "template-your-plugin"]], "Testing": [[57, null]], "Testing the parallel Pipeline": [[67, "testing-the-parallel-pipeline"]], "Testing the semantic type and formats": [[65, "testing-the-semantic-type-and-formats"]], "Testing the transformer": [[65, "testing-the-transformer"]], "Testing usage examples": [[48, "testing-usage-examples"]], "Text File Formats": [[11, "text-file-formats"]], "The Most Important File: metadata.yaml": [[9, "the-most-important-file-metadata-yaml"]], "The PluginManager Object": [[21, "the-pluginmanager-object"]], "The ResultCollection object": [[29, "the-resultcollection-object"]], "The action block": [[15, "the-action-block"]], "The action.yaml file": [[15, "the-action-yaml-file"]], "The environment block": [[15, "the-environment-block"]], "The execution block": [[15, "the-execution-block"]], "The input metadata": [[72, "the-input-metadata"]], "The qiime.Metadata class": [[62, "the-qiime-metadata-class"]], "The structure of QIIME 2 plugin packages": [[26, null]], "Transformers": [[27, null]], "Trying it out": [[48, "trying-it-out"]], "Trying the new action": [[66, "trying-the-new-action"]], "Tutorial table of contents": [[73, "tutorial-table-of-contents"]], "Tutorial: A step-by-step guide to building your first QIIME 2 plugin": [[73, null]], "Types": [[58, null]], "Types of QIIME 2 Actions": [[24, null]], "Unions": [[16, "unions"]], "Unique IDs": [[15, "unique-ids"]], "Unit testing": [[65, "unit-testing"]], "Unit testing the visualizer function": [[64, "unit-testing-the-visualizer-function"]], "Update plugin_setup.py": [[72, "update-plugin-setup-py"]], "Update search-and-summarize": [[72, "update-search-and-summarize"]], "Update search-and-summarize to use split and combine Methods": [[67, "update-search-and-summarize-to-use-split-and-combine-methods"]], "Update the nw_align action to avoid duplicating information": [[68, "update-the-nw-align-action-to-avoid-duplicating-information"]], "Updating nw-align to use the new artifact class": [[65, "updating-nw-align-to-use-the-new-artifact-class"]], "Usage Examples": [[59, null]], "Use Artifact Collections as Action inputs or outputs": [[29, null]], "User Metadata API": [[62, null]], "User documentation": [[7, null]], "Using Collections": [[29, "using-collections"]], "Using Collections with the Python API": [[29, "using-collections-with-the-python-api"]], "Using Collections with the command line interface (CLI)": [[29, "using-collections-with-the-command-line-interface-cli"]], "Utilities": [[60, null]], "Utility functions": [[21, "utility-functions"]], "Validation": [[11, "validation"]], "Variable Layouts": [[11, "variable-layouts"]], "Version-agnostic format guarantees": [[18, "version-agnostic-format-guarantees"]], "Visualization type": [[58, "visualization-type"]], "What Provenance Data is Captured?": [[15, "what-provenance-data-is-captured"]], "What to test and what not to test": [[66, "what-to-test-and-what-not-to-test"]], "Why Capture Provenance Data?": [[15, "why-capture-provenance-data"]], "Why a ZIP File?": [[9, "why-a-zip-file"]], "Wrapping up testing": [[66, "wrapping-up-testing"]], "Write a wrapper function": [[66, "write-a-wrapper-function"]], "Write the visualizer function": [[64, "write-the-visualizer-function"]], "Write unit tests": [[66, "write-unit-tests"]], "Writing Usage Examples": [[48, null]], "Writing tutorials": [[69, "writing-tutorials"]], "init": [[29, "init"]], "load": [[29, "load"]], "q2-dwq2": [[26, "q2-dwq2"]], "q2-dwq2/.git": [[26, "q2-dwq2-git"]], "q2-dwq2/.github": [[26, "q2-dwq2-github"]], "q2-dwq2/.gitignore": [[26, "q2-dwq2-gitignore"]], "q2-dwq2/LICENSE": [[26, "q2-dwq2-license"]], "q2-dwq2/MANIFEST.in": [[26, "q2-dwq2-manifest-in"]], "q2-dwq2/Makefile": [[26, "q2-dwq2-makefile"]], "q2-dwq2/README.md": [[26, "q2-dwq2-readme-md"]], "q2-dwq2/ci": [[26, "q2-dwq2-ci"]], "q2-dwq2/q2_dwq2": [[26, "q2-dwq2-q2-dwq2"]], "q2-dwq2/q2_dwq2/__init__.py": [[26, "q2-dwq2-q2-dwq2-init-py"]], "q2-dwq2/q2_dwq2/_methods.py": [[26, "q2-dwq2-q2-dwq2-methods-py"]], "q2-dwq2/q2_dwq2/_version.py": [[26, "q2-dwq2-q2-dwq2-version-py"]], "q2-dwq2/q2_dwq2/citations.bib": [[26, "q2-dwq2-q2-dwq2-citations-bib"]], "q2-dwq2/q2_dwq2/plugin_setup.py": [[26, "q2-dwq2-q2-dwq2-plugin-setup-py"]], "q2-dwq2/q2_dwq2/setup.cfg": [[26, "q2-dwq2-q2-dwq2-setup-cfg"]], "q2-dwq2/q2_dwq2/setup.py": [[26, "q2-dwq2-q2-dwq2-setup-py"]], "q2-dwq2/q2_dwq2/tests": [[26, "q2-dwq2-q2-dwq2-tests"]], "q2-dwq2/q2_dwq2/tests/__init__.py": [[26, "q2-dwq2-q2-dwq2-tests-init-py"]], "q2-dwq2/q2_dwq2/tests/data": [[26, "q2-dwq2-q2-dwq2-tests-data"]], "q2-dwq2/q2_dwq2/tests/test_methods.py": [[26, "q2-dwq2-q2-dwq2-tests-test-methods-py"]], "q2-dwq2/q2_dwq2/versioneer.py": [[26, "q2-dwq2-q2-dwq2-versioneer-py"]], "save": [[29, "save"]], "split-apply-combine flowchart for search and summarize": [[67, "split-apply-combine-flowchart"]], "tl;dr": [[63, null], [64, "add-alignment-visualizer-commit"], [65, "add-artifact-class-commit"], [66, "add-nw-align-method-commit"], [67, "add-parallel-pipeline-commits"], [68, "add-pipeline-commit"], [69, "add-usage-example-commit"], [72, "integrate-metadata-commits"]]}, "docnames": ["back-matter/bibliography", "back-matter/genindex", "back-matter/glossary", "back-matter/intro", "ci/intro", "docs/developer-documentation", "docs/intro", "docs/user-documentation", "framework/explanations/architecture", "framework/explanations/archives", "framework/explanations/data-storage", "framework/explanations/formats", "framework/explanations/garbage-collection", "framework/explanations/intro", "framework/explanations/metaprogramming", "framework/explanations/provenance", "framework/explanations/types", "framework/intro", "framework/references/archive-versions", "framework/references/intro", "interfaces/intro", "interfaces/references/api", "interfaces/references/intro", "intro", "plugins/explanations/actions", "plugins/explanations/intro", "plugins/explanations/package-structure", "plugins/explanations/transformers", "plugins/explanations/types-of-types", "plugins/how-to-guides/artifact-collections-as-io", "plugins/how-to-guides/automate-testing", "plugins/how-to-guides/create-register-method", "plugins/how-to-guides/create-register-pipeline", "plugins/how-to-guides/create-register-transformer", "plugins/how-to-guides/create-register-visualizer", "plugins/how-to-guides/distribute-on-gh", "plugins/how-to-guides/distribute-on-library", "plugins/how-to-guides/facilitate-installation", "plugins/how-to-guides/format-validation-levels", "plugins/how-to-guides/handle-exceptions-in-parallel-pipelines", "plugins/how-to-guides/intro", "plugins/how-to-guides/maximize-compatibility", "plugins/how-to-guides/play-nicely-with-others", "plugins/how-to-guides/publicize", "plugins/how-to-guides/register-a-plugin", "plugins/how-to-guides/set-up-development-environment", "plugins/how-to-guides/support-your-users", "plugins/how-to-guides/test-plugins", "plugins/how-to-guides/usage-examples", "plugins/how-to-guides/use-metadata", "plugins/intro", "plugins/references/antipatterns", "plugins/references/api/citations", "plugins/references/api/context", "plugins/references/api/formats", "plugins/references/api/intro", "plugins/references/api/plugin", "plugins/references/api/testing", "plugins/references/api/types", "plugins/references/api/usage", "plugins/references/api/utils", "plugins/references/intro", "plugins/references/metadata-api", "plugins/tutorials/add-2nd-transformer", "plugins/tutorials/add-alignment-visualizer", "plugins/tutorials/add-artifact-class", "plugins/tutorials/add-nw-align-method", "plugins/tutorials/add-parallel-pipeline", "plugins/tutorials/add-pipeline", "plugins/tutorials/add-usage-examples", "plugins/tutorials/conclusion", "plugins/tutorials/create-from-template", "plugins/tutorials/integrate-metadata", "plugins/tutorials/intro"], "envversion": {"sphinx": 62, "sphinx.domains.c": 3, "sphinx.domains.changeset": 1, "sphinx.domains.citation": 1, "sphinx.domains.cpp": 9, "sphinx.domains.index": 1, "sphinx.domains.javascript": 3, "sphinx.domains.math": 2, "sphinx.domains.python": 4, "sphinx.domains.rst": 2, "sphinx.domains.std": 2, "sphinx.ext.intersphinx": 1, "sphinxcontrib.bibtex": 9}, "filenames": ["back-matter/bibliography.md", "back-matter/genindex.md", "back-matter/glossary.md", "back-matter/intro.md", "ci/intro.md", "docs/developer-documentation.md", "docs/intro.md", "docs/user-documentation.md", "framework/explanations/architecture.md", "framework/explanations/archives.md", "framework/explanations/data-storage.md", "framework/explanations/formats.md", "framework/explanations/garbage-collection.md", "framework/explanations/intro.md", "framework/explanations/metaprogramming.md", "framework/explanations/provenance.md", "framework/explanations/types.md", "framework/intro.md", "framework/references/archive-versions.md", "framework/references/intro.md", "interfaces/intro.md", "interfaces/references/api.md", "interfaces/references/intro.md", "intro.md", "plugins/explanations/actions.md", "plugins/explanations/intro.md", "plugins/explanations/package-structure.md", "plugins/explanations/transformers.md", "plugins/explanations/types-of-types.md", "plugins/how-to-guides/artifact-collections-as-io.md", "plugins/how-to-guides/automate-testing.md", "plugins/how-to-guides/create-register-method.md", "plugins/how-to-guides/create-register-pipeline.md", "plugins/how-to-guides/create-register-transformer.md", "plugins/how-to-guides/create-register-visualizer.md", "plugins/how-to-guides/distribute-on-gh.md", "plugins/how-to-guides/distribute-on-library.md", "plugins/how-to-guides/facilitate-installation.md", "plugins/how-to-guides/format-validation-levels.md", "plugins/how-to-guides/handle-exceptions-in-parallel-pipelines.md", "plugins/how-to-guides/intro.md", "plugins/how-to-guides/maximize-compatibility.md", "plugins/how-to-guides/play-nicely-with-others.md", "plugins/how-to-guides/publicize.md", "plugins/how-to-guides/register-a-plugin.md", "plugins/how-to-guides/set-up-development-environment.md", "plugins/how-to-guides/support-your-users.md", "plugins/how-to-guides/test-plugins.md", "plugins/how-to-guides/usage-examples.md", "plugins/how-to-guides/use-metadata.md", "plugins/intro.md", "plugins/references/antipatterns.md", "plugins/references/api/citations.md", "plugins/references/api/context.md", "plugins/references/api/formats.md", "plugins/references/api/intro.md", "plugins/references/api/plugin.md", "plugins/references/api/testing.md", "plugins/references/api/types.md", "plugins/references/api/usage.md", "plugins/references/api/utils.md", "plugins/references/intro.md", "plugins/references/metadata-api.md", "plugins/tutorials/add-2nd-transformer.md", "plugins/tutorials/add-alignment-visualizer.md", "plugins/tutorials/add-artifact-class.md", "plugins/tutorials/add-nw-align-method.md", "plugins/tutorials/add-parallel-pipeline.md", "plugins/tutorials/add-pipeline.md", "plugins/tutorials/add-usage-examples.md", "plugins/tutorials/conclusion.md", "plugins/tutorials/create-from-template.md", "plugins/tutorials/integrate-metadata.md", "plugins/tutorials/intro.md"], "indexentries": {"__iter__() (qiime2.plugin.citations method)": [[52, "qiime2.plugin.Citations.__iter__", false]], "action": [[2, "term-Action", true]], "action() (in module qiime2.sdk)": [[21, "qiime2.sdk.Action", false]], "action() (qiime2.sdk.usage.usage method)": [[59, "qiime2.sdk.usage.Usage.action", false]], "archive": [[2, "term-Archive", true]], "artifact": [[2, "term-Artifact", true]], "artifact api": [[2, "term-Artifact-API", true]], "artifact class": [[2, "term-Artifact-class", true]], "artifact() (in module qiime2.sdk)": [[21, "qiime2.sdk.Artifact", false]], "assert_has_line_matching() (qiime2.sdk.usage.usagevariable method)": [[59, "qiime2.sdk.usage.UsageVariable.assert_has_line_matching", false]], "assert_no_nans_in_tables() (in module qiime2.plugin.testing)": [[57, "qiime2.plugin.testing.assert_no_nans_in_tables", false]], "assert_output_type() (qiime2.sdk.usage.usagevariable method)": [[59, "qiime2.sdk.usage.UsageVariable.assert_output_type", false]], "assertregisteredsemantictype() (qiime2.plugin.testing.testpluginbase method)": [[57, "qiime2.plugin.testing.TestPluginBase.assertRegisteredSemanticType", false]], "assertsemantictyperegisteredtoformat() (qiime2.plugin.testing.testpluginbase method)": [[57, "qiime2.plugin.testing.TestPluginBase.assertSemanticTypeRegisteredToFormat", false]], "binaryfileformat (class in qiime2.plugin)": [[54, "qiime2.plugin.BinaryFileFormat", false]], "bool (in module qiime2.plugin)": [[58, "qiime2.plugin.Bool", false]], "categorical (in module qiime2.plugin)": [[58, "qiime2.plugin.Categorical", false]], "categoricalmetadatacolumn (class in qiime2)": [[62, "qiime2.CategoricalMetadataColumn", false]], "choices (class in qiime2.plugin)": [[58, "qiime2.plugin.Choices", false]], "citationrecord (class in qiime2.plugin)": [[52, "qiime2.plugin.CitationRecord", false]], "citations (class in qiime2.plugin)": [[52, "qiime2.plugin.Citations", false]], "collection (in module qiime2.plugin)": [[58, "qiime2.plugin.Collection", false]], "column_count (qiime2.metadata property)": [[62, "qiime2.Metadata.column_count", false]], "columns (qiime2.metadata property)": [[62, "qiime2.Metadata.columns", false]], "comment() (qiime2.sdk.usage.usage method)": [[59, "qiime2.sdk.usage.Usage.comment", false]], "conda metapackage": [[2, "term-Conda-metapackage", true]], "construct_artifact_collection() (qiime2.sdk.usage.usage method)": [[59, "qiime2.sdk.usage.Usage.construct_artifact_collection", false]], "deployment": [[2, "term-Deployment", true]], "directory format": [[2, "term-Directory-Format", true]], "directoryformat (class in qiime2.plugin)": [[54, "qiime2.plugin.DirectoryFormat", false]], "distribution": [[2, "term-Distribution", true]], "dr": [[2, "term-tl-dr", true]], "drop_missing_values() (qiime2.metadatacolumn method)": [[62, "qiime2.MetadataColumn.drop_missing_values", false]], "dry": [[2, "term-DRY", true]], "duplicate() (in module qiime2.util)": [[60, "qiime2.util.duplicate", false]], "end() (in module qiime2.plugin)": [[58, "qiime2.plugin.End", false]], "execute_examples() (qiime2.plugin.testing.testpluginbase method)": [[57, "qiime2.plugin.testing.TestPluginBase.execute_examples", false]], "file format": [[2, "term-File-Format", true]], "filter_columns() (qiime2.metadata method)": [[62, "qiime2.Metadata.filter_columns", false]], "filter_ids() (qiime2.metadata method)": [[62, "qiime2.Metadata.filter_ids", false]], "filter_ids() (qiime2.metadatacolumn method)": [[62, "qiime2.MetadataColumn.filter_ids", false]], "float (in module qiime2.plugin)": [[58, "qiime2.plugin.Float", false]], "format": [[2, "term-Format", true]], "framework": [[2, "term-Framework", true]], "galaxy": [[2, "term-Galaxy", true]], "get_action() (qiime2.sdk.context method)": [[53, "qiime2.sdk.Context.get_action", false]], "get_artifact_collection_member() (qiime2.sdk.usage.usage method)": [[59, "qiime2.sdk.usage.Usage.get_artifact_collection_member", false]], "get_available_cores() (in module qiime2.plugin.util)": [[60, "qiime2.plugin.util.get_available_cores", false]], "get_column() (qiime2.metadata method)": [[62, "qiime2.Metadata.get_column", false]], "get_data_path() (qiime2.plugin.testing.testpluginbase method)": [[57, "qiime2.plugin.testing.TestPluginBase.get_data_path", false]], "get_ids() (qiime2.metadata method)": [[62, "qiime2.Metadata.get_ids", false]], "get_ids() (qiime2.metadatacolumn method)": [[62, "qiime2.MetadataColumn.get_ids", false]], "get_metadata_column() (qiime2.sdk.usage.usage method)": [[59, "qiime2.sdk.usage.Usage.get_metadata_column", false]], "get_missing() (qiime2.metadatacolumn method)": [[62, "qiime2.MetadataColumn.get_missing", false]], "get_transformer() (qiime2.plugin.testing.testpluginbase method)": [[57, "qiime2.plugin.testing.TestPluginBase.get_transformer", false]], "get_value() (qiime2.metadatacolumn method)": [[62, "qiime2.MetadataColumn.get_value", false]], "has_missing_values() (qiime2.metadatacolumn method)": [[62, "qiime2.MetadataColumn.has_missing_values", false]], "help() (qiime2.sdk.usage.usage method)": [[59, "qiime2.sdk.usage.Usage.help", false]], "identifier": [[2, "term-Identifier", true]], "identity": [[2, "term-Identity", true]], "implementationerror() (in module qiime2.sdk)": [[21, "qiime2.sdk.ImplementationError", false]], "import_from_format() (qiime2.sdk.usage.usage method)": [[59, "qiime2.sdk.usage.Usage.import_from_format", false]], "init_artifact() (qiime2.sdk.usage.usage method)": [[59, "qiime2.sdk.usage.Usage.init_artifact", false]], "init_artifact_collection() (qiime2.sdk.usage.usage method)": [[59, "qiime2.sdk.usage.Usage.init_artifact_collection", false]], "init_artifact_from_url() (qiime2.sdk.usage.usage method)": [[59, "qiime2.sdk.usage.Usage.init_artifact_from_url", false]], "init_format() (qiime2.sdk.usage.usage method)": [[59, "qiime2.sdk.usage.Usage.init_format", false]], "init_metadata() (qiime2.sdk.usage.usage method)": [[59, "qiime2.sdk.usage.Usage.init_metadata", false]], "init_metadata_from_url() (qiime2.sdk.usage.usage method)": [[59, "qiime2.sdk.usage.Usage.init_metadata_from_url", false]], "input": [[2, "term-Input", true]], "int (in module qiime2.plugin)": [[58, "qiime2.plugin.Int", false]], "interface": [[2, "term-Interface", true]], "jobs (in module qiime2.plugin)": [[58, "qiime2.plugin.Jobs", false]], "list (in module qiime2.plugin)": [[58, "qiime2.plugin.List", false]], "load() (qiime2.metadata class method)": [[62, "qiime2.Metadata.load", false]], "load() (qiime2.plugin.citations class method)": [[52, "qiime2.plugin.Citations.load", false]], "make_artifact() (qiime2.sdk.context method)": [[53, "qiime2.sdk.Context.make_artifact", false]], "merge() (qiime2.metadata method)": [[62, "qiime2.Metadata.merge", false]], "merge_metadata() (qiime2.sdk.usage.usage method)": [[59, "qiime2.sdk.usage.Usage.merge_metadata", false]], "metadata": [[2, "term-Metadata", true]], "metadata (class in qiime2)": [[62, "qiime2.Metadata", false]], "metadata (in module qiime2.plugin)": [[58, "qiime2.plugin.Metadata", false]], "metadatacolumn (class in qiime2)": [[62, "qiime2.MetadataColumn", false]], "metadatacolumn (in module qiime2.plugin)": [[58, "qiime2.plugin.MetadataColumn", false]], "metadatafileerror (class in qiime2.metadata)": [[62, "qiime2.metadata.MetadataFileError", false]], "method": [[2, "term-Method", true]], "method() (in module qiime2.sdk)": [[21, "qiime2.sdk.Method", false]], "missing_scheme (qiime2.metadatacolumn property)": [[62, "qiime2.MetadataColumn.missing_scheme", false]], "name (qiime2.metadatacolumn property)": [[62, "qiime2.MetadataColumn.name", false]], "numeric (in module qiime2.plugin)": [[58, "qiime2.plugin.Numeric", false]], "numericmetadatacolumn (class in qiime2)": [[62, "qiime2.NumericMetadataColumn", false]], "output": [[2, "term-Output", true]], "package (qiime2.plugin.testing.testpluginbase attribute)": [[57, "qiime2.plugin.testing.TestPluginBase.package", false]], "pairwise sequence alignment": [[2, "term-Pairwise-sequence-alignment", true]], "parameter": [[2, "term-Parameter", true]], "parse_format() (in module qiime2.sdk)": [[21, "qiime2.sdk.parse_format", false]], "parse_type() (in module qiime2.sdk)": [[21, "qiime2.sdk.parse_type", false]], "payload": [[2, "term-Payload", true]], "peek() (qiime2.sdk.usage.usage method)": [[59, "qiime2.sdk.usage.Usage.peek", false]], "pipeline": [[2, "term-Pipeline", true]], "pipeline() (in module qiime2.sdk)": [[21, "qiime2.sdk.Pipeline", false]], "plugin": [[2, "term-Plugin", true]], "plugin (class in qiime2.plugin)": [[56, "qiime2.plugin.Plugin", false]], "plugin manager": [[2, "term-Plugin-Manager", true]], "pluginmanager() (in module qiime2.sdk)": [[21, "qiime2.sdk.PluginManager", false]], "pluginmethods (class in qiime2.plugin.plugin)": [[56, "qiime2.plugin.plugin.PluginMethods", false]], "pluginpipelines (class in qiime2.plugin.plugin)": [[56, "qiime2.plugin.plugin.PluginPipelines", false]], "pluginvisualizers (class in qiime2.plugin.plugin)": [[56, "qiime2.plugin.plugin.PluginVisualizers", false]], "primitive type": [[2, "term-Primitive-Type", true]], "properties (class in qiime2.plugin)": [[58, "qiime2.plugin.Properties", false]], "provenance": [[2, "term-Provenance", true]], "provenance replay": [[2, "term-Provenance-Replay", true]], "python 3 api": [[2, "term-Python-3-API", true]], "q2cli": [[2, "term-q2cli", true]], "range (class in qiime2.plugin)": [[58, "qiime2.plugin.Range", false]], "redirected_stdio() (in module qiime2.util)": [[60, "qiime2.util.redirected_stdio", false]], "register_artifact_class() (qiime2.plugin.plugin method)": [[56, "qiime2.plugin.Plugin.register_artifact_class", false]], "register_formats() (qiime2.plugin.plugin method)": [[56, "qiime2.plugin.Plugin.register_formats", false]], "register_function() (qiime2.plugin.plugin.pluginmethods method)": [[56, "qiime2.plugin.plugin.PluginMethods.register_function", false]], "register_function() (qiime2.plugin.plugin.pluginpipelines method)": [[56, "qiime2.plugin.plugin.PluginPipelines.register_function", false]], "register_function() (qiime2.plugin.plugin.pluginvisualizers method)": [[56, "qiime2.plugin.plugin.PluginVisualizers.register_function", false]], "register_semantic_type_to_format() (qiime2.plugin.plugin method)": [[56, "qiime2.plugin.Plugin.register_semantic_type_to_format", false]], "register_semantic_types() (qiime2.plugin.plugin method)": [[56, "qiime2.plugin.Plugin.register_semantic_types", false]], "register_transformer() (qiime2.plugin.plugin method)": [[56, "qiime2.plugin.Plugin.register_transformer", false]], "register_validator() (qiime2.plugin.plugin method)": [[56, "qiime2.plugin.Plugin.register_validator", false]], "register_views() (qiime2.plugin.plugin method)": [[56, "qiime2.plugin.Plugin.register_views", false]], "result": [[2, "term-Result", true]], "result() (in module qiime2.sdk)": [[21, "qiime2.sdk.Result", false]], "resultcollection() (in module qiime2.sdk)": [[21, "qiime2.sdk.ResultCollection", false]], "results() (in module qiime2.sdk)": [[21, "qiime2.sdk.Results", false]], "save() (qiime2.plugin.citations method)": [[52, "qiime2.plugin.Citations.save", false]], "semantic type": [[2, "term-Semantic-Type", true]], "semantictype() (in module qiime2.plugin)": [[58, "qiime2.plugin.SemanticType", false]], "set (in module qiime2.plugin)": [[58, "qiime2.plugin.Set", false]], "setup() (qiime2.plugin.testing.testpluginbase method)": [[57, "qiime2.plugin.testing.TestPluginBase.setUp", false]], "single-use plugin (sup)": [[2, "term-Single-Use-Plugin-SUP", true]], "singlefiledirectoryformat() (in module qiime2.plugin)": [[54, "qiime2.plugin.SingleFileDirectoryFormat", false]], "start() (in module qiime2.plugin)": [[58, "qiime2.plugin.Start", false]], "str (in module qiime2.plugin)": [[58, "qiime2.plugin.Str", false]], "teardown() (qiime2.plugin.testing.testpluginbase method)": [[57, "qiime2.plugin.testing.TestPluginBase.tearDown", false]], "test_dir_prefix (qiime2.plugin.testing.testpluginbase attribute)": [[57, "qiime2.plugin.testing.TestPluginBase.test_dir_prefix", false]], "testpluginbase (class in qiime2.plugin.testing)": [[57, "qiime2.plugin.testing.TestPluginBase", false]], "textfileformat (class in qiime2.plugin)": [[54, "qiime2.plugin.TextFileFormat", false]], "threads (in module qiime2.plugin)": [[58, "qiime2.plugin.Threads", false]], "tl": [[2, "term-tl-dr", true]], "to_dataframe() (qiime2.metadata method)": [[62, "qiime2.Metadata.to_dataframe", false]], "to_dataframe() (qiime2.metadatacolumn method)": [[62, "qiime2.MetadataColumn.to_dataframe", false]], "to_series() (qiime2.metadatacolumn method)": [[62, "qiime2.MetadataColumn.to_series", false]], "transform() (in module qiime2.plugin.util)": [[60, "qiime2.plugin.util.transform", false]], "transform_format() (qiime2.plugin.testing.testpluginbase method)": [[57, "qiime2.plugin.testing.TestPluginBase.transform_format", false]], "transformer": [[2, "term-Transformer", true]], "type": [[2, "term-Type", true]], "type_from_ast() (in module qiime2.sdk)": [[21, "qiime2.sdk.type_from_ast", false]], "typemap (class in qiime2.plugin)": [[58, "qiime2.plugin.TypeMap", false]], "typematch (class in qiime2.plugin)": [[58, "qiime2.plugin.TypeMatch", false]], "uninitializedpluginmanagererror() (in module qiime2.sdk)": [[21, "qiime2.sdk.UninitializedPluginManagerError", false]], "usageaction (class in qiime2.sdk.usage)": [[59, "qiime2.sdk.usage.UsageAction", false]], "usageaction (qiime2.sdk.usage.usage attribute)": [[59, "qiime2.sdk.usage.Usage.UsageAction", false]], "usageinputs (class in qiime2.sdk.usage)": [[59, "qiime2.sdk.usage.UsageInputs", false]], "usageinputs (qiime2.sdk.usage.usage attribute)": [[59, "qiime2.sdk.usage.Usage.UsageInputs", false]], "usageoutputnames (class in qiime2.sdk.usage)": [[59, "qiime2.sdk.usage.UsageOutputNames", false]], "usageoutputnames (qiime2.sdk.usage.usage attribute)": [[59, "qiime2.sdk.usage.Usage.UsageOutputNames", false]], "usageoutputs (class in qiime2.sdk.usage)": [[59, "qiime2.sdk.usage.UsageOutputs", false]], "usagevariable (class in qiime2.sdk.usage)": [[59, "qiime2.sdk.usage.UsageVariable", false]], "uuid": [[2, "term-UUID", true]], "validationerror (class in qiime2.plugin)": [[54, "qiime2.plugin.ValidationError", false]], "validationerror() (in module qiime2.sdk)": [[21, "qiime2.sdk.ValidationError", false]], "view": [[2, "term-View", true]], "view_as_metadata() (qiime2.sdk.usage.usage method)": [[59, "qiime2.sdk.usage.Usage.view_as_metadata", false]], "visualization": [[2, "term-Visualization", true]], "visualization (in module qiime2.plugin)": [[58, "qiime2.plugin.Visualization", false]], "visualization (type)": [[2, "term-Visualization-Type", true]], "visualization() (in module qiime2.sdk)": [[21, "qiime2.sdk.Visualization", false]], "visualizer": [[2, "term-Visualizer", true]], "visualizer() (in module qiime2.sdk)": [[21, "qiime2.sdk.Visualizer", false]]}, "objects": {"qiime2": [[62, 0, 1, "", "CategoricalMetadataColumn"], [62, 0, 1, "", "Metadata"], [62, 0, 1, "", "MetadataColumn"], [62, 0, 1, "", "NumericMetadataColumn"]], "qiime2.Metadata": [[62, 1, 1, "", "column_count"], [62, 1, 1, "", "columns"], [62, 2, 1, "", "filter_columns"], [62, 2, 1, "", "filter_ids"], [62, 2, 1, "", "get_column"], [62, 2, 1, "", "get_ids"], [62, 2, 1, "", "load"], [62, 2, 1, "", "merge"], [62, 2, 1, "", "to_dataframe"]], "qiime2.MetadataColumn": [[62, 2, 1, "", "drop_missing_values"], [62, 2, 1, "", "filter_ids"], [62, 2, 1, "", "get_ids"], [62, 2, 1, "", "get_missing"], [62, 2, 1, "", "get_value"], [62, 2, 1, "", "has_missing_values"], [62, 1, 1, "", "missing_scheme"], [62, 1, 1, "", "name"], [62, 2, 1, "", "to_dataframe"], [62, 2, 1, "", "to_series"]], "qiime2.metadata": [[62, 0, 1, "", "MetadataFileError"]], "qiime2.plugin": [[54, 0, 1, "", "BinaryFileFormat"], [58, 3, 1, "", "Bool"], [58, 3, 1, "", "Categorical"], [58, 0, 1, "", "Choices"], [52, 0, 1, "", "CitationRecord"], [52, 0, 1, "", "Citations"], [58, 3, 1, "", "Collection"], [54, 0, 1, "", "DirectoryFormat"], [58, 4, 1, "", "End"], [58, 3, 1, "", "Float"], [58, 3, 1, "", "Int"], [58, 3, 1, "", "Jobs"], [58, 3, 1, "", "List"], [58, 3, 1, "", "Metadata"], [58, 3, 1, "", "MetadataColumn"], [58, 3, 1, "", "Numeric"], [56, 0, 1, "", "Plugin"], [58, 0, 1, "", "Properties"], [58, 0, 1, "", "Range"], [58, 4, 1, "", "SemanticType"], [58, 3, 1, "", "Set"], [54, 4, 1, "", "SingleFileDirectoryFormat"], [58, 4, 1, "", "Start"], [58, 3, 1, "", "Str"], [54, 0, 1, "", "TextFileFormat"], [58, 3, 1, "", "Threads"], [58, 0, 1, "", "TypeMap"], [58, 0, 1, "", "TypeMatch"], [54, 0, 1, "", "ValidationError"], [58, 3, 1, "", "Visualization"]], "qiime2.plugin.Citations": [[52, 2, 1, "", "__iter__"], [52, 2, 1, "", "load"], [52, 2, 1, "", "save"]], "qiime2.plugin.Plugin": [[56, 2, 1, "", "register_artifact_class"], [56, 2, 1, "", "register_formats"], [56, 2, 1, "", "register_semantic_type_to_format"], [56, 2, 1, "", "register_semantic_types"], [56, 2, 1, "", "register_transformer"], [56, 2, 1, "", "register_validator"], [56, 2, 1, "", "register_views"]], "qiime2.plugin.plugin": [[56, 0, 1, "", "PluginMethods"], [56, 0, 1, "", "PluginPipelines"], [56, 0, 1, "", "PluginVisualizers"]], "qiime2.plugin.plugin.PluginMethods": [[56, 2, 1, "", "register_function"]], "qiime2.plugin.plugin.PluginPipelines": [[56, 2, 1, "", "register_function"]], "qiime2.plugin.plugin.PluginVisualizers": [[56, 2, 1, "", "register_function"]], "qiime2.plugin.testing": [[57, 0, 1, "", "TestPluginBase"], [57, 4, 1, "", "assert_no_nans_in_tables"]], "qiime2.plugin.testing.TestPluginBase": [[57, 2, 1, "", "assertRegisteredSemanticType"], [57, 2, 1, "", "assertSemanticTypeRegisteredToFormat"], [57, 2, 1, "", "execute_examples"], [57, 2, 1, "", "get_data_path"], [57, 2, 1, "", "get_transformer"], [57, 5, 1, "", "package"], [57, 2, 1, "", "setUp"], [57, 2, 1, "", "tearDown"], [57, 5, 1, "", "test_dir_prefix"], [57, 2, 1, "", "transform_format"]], "qiime2.plugin.util": [[60, 4, 1, "", "get_available_cores"], [60, 4, 1, "", "transform"]], "qiime2.sdk": [[21, 4, 1, "", "Action"], [21, 4, 1, "", "Artifact"], [21, 4, 1, "", "ImplementationError"], [21, 4, 1, "", "Method"], [21, 4, 1, "", "Pipeline"], [21, 4, 1, "", "PluginManager"], [21, 4, 1, "", "Result"], [21, 4, 1, "", "ResultCollection"], [21, 4, 1, "", "Results"], [21, 4, 1, "", "UninitializedPluginManagerError"], [21, 4, 1, "", "ValidationError"], [21, 4, 1, "", "Visualization"], [21, 4, 1, "", "Visualizer"], [21, 4, 1, "", "parse_format"], [21, 4, 1, "", "parse_type"], [21, 4, 1, "", "type_from_ast"]], "qiime2.sdk.Context": [[53, 2, 1, "", "get_action"], [53, 2, 1, "", "make_artifact"]], "qiime2.sdk.usage": [[59, 0, 1, "", "UsageAction"], [59, 0, 1, "", "UsageInputs"], [59, 0, 1, "", "UsageOutputNames"], [59, 0, 1, "", "UsageOutputs"], [59, 0, 1, "", "UsageVariable"]], "qiime2.sdk.usage.Usage": [[59, 5, 1, "", "UsageAction"], [59, 5, 1, "", "UsageInputs"], [59, 5, 1, "", "UsageOutputNames"], [59, 2, 1, "", "action"], [59, 2, 1, "", "comment"], [59, 2, 1, "", "construct_artifact_collection"], [59, 2, 1, "", "get_artifact_collection_member"], [59, 2, 1, "", "get_metadata_column"], [59, 2, 1, "", "help"], [59, 2, 1, "", "import_from_format"], [59, 2, 1, "", "init_artifact"], [59, 2, 1, "", "init_artifact_collection"], [59, 2, 1, "", "init_artifact_from_url"], [59, 2, 1, "", "init_format"], [59, 2, 1, "", "init_metadata"], [59, 2, 1, "", "init_metadata_from_url"], [59, 2, 1, "", "merge_metadata"], [59, 2, 1, "", "peek"], [59, 2, 1, "", "view_as_metadata"]], "qiime2.sdk.usage.UsageVariable": [[59, 2, 1, "", "assert_has_line_matching"], [59, 2, 1, "", "assert_output_type"]], "qiime2.util": [[60, 4, 1, "", "duplicate"], [60, 4, 1, "", "redirected_stdio"]]}, "objnames": {"0": ["py", "class", "Python class"], "1": ["py", "property", "Python property"], "2": ["py", "method", "Python method"], "3": ["py", "data", "Python data"], "4": ["py", "function", "Python function"], "5": ["py", "attribute", "Python attribute"]}, "objtypes": {"0": "py:class", "1": "py:property", "2": "py:method", "3": "py:data", "4": "py:function", "5": "py:attribute"}, "terms": {"": [0, 2, 5, 8, 9, 10, 11, 15, 16, 18, 23, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 40, 42, 43, 44, 46, 48, 49, 50, 51, 52, 56, 57, 58, 59, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73], "0": [9, 11, 15, 16, 23, 29, 30, 32, 45, 48, 58, 59, 60, 64, 65, 66, 68, 71, 72], "00": 15, "001": 66, "00a294c": 18, "01": [23, 66], "03d_r": 11, "04": 15, "06": 69, "07": 15, "080381": 15, "1": [0, 11, 15, 16, 23, 26, 29, 31, 32, 36, 37, 48, 58, 59, 63, 64, 65, 66, 68, 69], "10": [11, 15, 18, 23, 30, 37, 58, 59, 60, 66], "100": [44, 58, 59, 67], "100014989": 23, "11": [0, 15, 18, 45, 51, 59], "1103": 15, "12": [7, 11, 15, 18, 45, 58], "13": 18, "13039": 23, "14": 65, "147": 0, "15": [41, 45, 67, 69], "16": [15, 30, 46, 67], "17": 66, "171": 65, "18": [45, 68], "184": 16, "19": 0, "195": 0, "197": 0, "1970": [0, 66], "1976": 26, "1981": 0, "1990": 0, "1u24ca248454": 23, "2": [0, 2, 4, 5, 7, 9, 11, 12, 13, 15, 16, 17, 21, 25, 27, 28, 29, 30, 31, 32, 34, 35, 38, 39, 40, 42, 46, 48, 49, 50, 51, 52, 55, 56, 57, 58, 59, 60, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72], "20": [10, 15, 28, 58, 67], "2016": 18, "2017": 18, "2018": 18, "2019": [0, 18], "2021": [0, 15], "2022": 59, "2023": [0, 7, 45, 51], "2024": [2, 4, 11, 30, 35, 37, 41, 43, 46, 51, 65, 66, 70, 71], "2025": 30, "207342": 23, "20px": 64, "20th": [0, 66], "21": 15, "215": 0, "21t14": 15, "22": 70, "23": [4, 43, 65, 66], "24": [18, 35], "25": [64, 67, 69], "27a5": 15, "29": 68, "2adb9": 15, "2adb9f00": 15, "2c00": 18, "2nd": 0, "3": [0, 2, 11, 15, 16, 23, 31, 44, 45, 48, 58, 59, 62, 67, 72, 73], "30": 67, "300": 36, "333fd63a2b4a102e58e364f37cd98b74": 18, "34b07e56": 15, "35": 67, "3611a0c1": 15, "37921": 23, "38": 15, "3rd": 42, "4": [0, 2, 9, 15, 23, 30, 58, 59, 65, 66, 68], "40": 67, "403": 0, "41": 66, "410": 0, "411d": 15, "414": 18, "42": [15, 59], "42b5": 15, "4308": 15, "4322": 15, "4373b96f26689f78889caeb1fbb94090": 18, "4389a0b": 18, "44": 71, "443": [0, 66], "453": [0, 66], "45c12936": 9, "469998": 15, "48": [0, 66], "484d": 9, "4886": 18, "4b60": 9, "4e2f": 15, "4f03": 15, "5": [0, 9, 11, 16, 37, 51, 58, 59, 65, 66, 67, 68], "50": 65, "5000": 11, "51": 65, "587": 15, "5a7118c14fd1bacc957ddf01e61491b7": 18, "6": [0, 15, 59, 66, 67], "610383": 15, "62c7": 15, "64": [45, 58], "66": 68, "68": 16, "684b8b7": 18, "6dada99d0c81": 18, "7": [0, 2, 15], "7a40cff7855daffa28d4082194bdf60": 18, "7zip": 10, "8": [11, 15, 18, 45, 60, 64, 66], "80": 64, "8000": 7, "81b130d538c3": 15, "85": 67, "8601": 15, "862772dbrrej": 23, "87058ae3": 15, "8dd3": 15, "9": [11, 15, 18], "90": 67, "93224813": 15, "95": 67, "98ff96bad145": 9, "999": 58, "A": [0, 2, 9, 10, 11, 15, 16, 18, 21, 23, 24, 26, 29, 31, 32, 34, 41, 44, 45, 48, 50, 52, 56, 57, 58, 59, 60, 62, 63, 65, 67, 68, 70], "And": [16, 49, 65, 67, 69, 73], "As": [4, 7, 9, 11, 15, 16, 18, 26, 29, 31, 32, 35, 37, 43, 48, 51, 56, 58, 63, 64, 65, 66, 67, 68, 69, 70], "At": [5, 8, 45, 49, 56, 63, 65, 66, 67, 72], "BY": 23, "Be": 35, "But": [51, 58, 65, 66, 72], "By": [15, 26, 31, 37, 48, 49, 66, 72], "For": [2, 5, 10, 11, 12, 15, 16, 18, 23, 24, 26, 27, 28, 29, 30, 31, 35, 42, 43, 44, 45, 48, 49, 51, 60, 62, 64, 65, 66, 67, 68, 69, 71, 72], "If": [5, 9, 10, 12, 15, 16, 23, 26, 28, 29, 30, 31, 34, 35, 36, 37, 39, 40, 41, 42, 43, 44, 45, 46, 48, 49, 51, 56, 57, 58, 59, 62, 63, 64, 65, 66, 67, 68, 69, 71, 72, 73], "In": [2, 5, 8, 10, 11, 15, 16, 18, 24, 26, 29, 30, 31, 34, 37, 39, 44, 48, 49, 51, 56, 58, 62, 63, 64, 65, 66, 67, 68, 69, 71, 72], "It": [8, 9, 11, 12, 15, 16, 18, 21, 23, 24, 28, 29, 30, 32, 35, 43, 44, 48, 51, 56, 58, 63, 64, 65, 66, 68, 69, 73], "NOT": [29, 36], "No": [58, 65], "Not": [8, 16, 58], "Of": [16, 59], "On": [29, 65, 72], "One": [11, 16, 28, 36, 59, 62, 65, 66, 67, 68, 73], "Or": [58, 66, 71], "That": [15, 16, 28, 43, 51, 64, 65, 66, 67, 68, 69, 70, 72], "Thats": 16, "The": [0, 2, 7, 8, 10, 11, 12, 14, 16, 18, 23, 25, 27, 28, 30, 31, 32, 33, 34, 35, 36, 37, 39, 41, 42, 43, 44, 45, 48, 49, 50, 51, 52, 53, 56, 57, 58, 59, 60, 63, 64, 65, 66, 67, 68, 69, 70, 71, 73], "Then": [7, 8, 9, 26, 64, 65, 66, 67, 69, 72], "There": [2, 9, 10, 15, 16, 26, 28, 30, 39, 42, 44, 48, 51, 58, 59, 65, 66, 67], "These": [2, 7, 8, 9, 10, 11, 15, 16, 18, 24, 27, 29, 30, 31, 33, 36, 44, 48, 51, 55, 58, 59, 62, 66, 67, 68, 69], "To": [7, 8, 10, 11, 16, 23, 26, 28, 30, 35, 41, 45, 48, 50, 51, 57, 62, 64, 65, 66, 67, 68, 69, 71, 72, 73], "WILL": 36, "Will": [21, 58], "With": [15, 18, 30, 37, 41, 63, 65], "_": [11, 26, 31, 44, 56, 65, 66, 68], "_0": 56, "_001": 11, "_1": [33, 49, 56, 65], "_2": [33, 63, 65], "_3": 65, "_4": 65, "__all__": 65, "__getitem__": 16, "__init__": [5, 18, 65], "__iter__": 52, "__release__": 59, "__repr__": 64, "__super__": 57, "__version__": [44, 56, 66], "_action": 68, "_align_and_summarize_output": 68, "_align_and_summarize_output_descript": 68, "_archiv": [9, 18], "_batch": 67, "_confirm_acgt_onli": 65, "_confirm_single_record": 65, "_create_seq_artifact": [63, 69], "_exampl": [63, 69], "_exit": 12, "_fn": 56, "_html_templat": [64, 72], "_l": 11, "_method": [65, 66, 67, 68], "_nw_align_default": 68, "_nw_align_input": 68, "_nw_align_input_descript": 68, "_nw_align_paramet": 68, "_nw_align_parameter_descript": 68, "_pipelin": [67, 72], "_r": 11, "_result": 39, "_split_seqs_default": 67, "_tabulate_las_default": 72, "_tabulate_las_paramet": 72, "_tabulate_las_parameter_descript": 72, "_test_simple1_help": 67, "_transform": [18, 63, 65], "_transform_singlerecorddnafastaformat_to_dna": 65, "_types_and_format": 65, "_validate_": [11, 38, 51, 65], "_validate_field_": 16, "_validate_n_int": 11, "_visual": [64, 72], "_ziparch": 9, "a10d5d44": 15, "a416": 15, "a692": 15, "a6d07fc80a01": 15, "a983": 15, "a_boo": 59, "a_div_vector": 48, "aaa": 66, "aaaa": 66, "aaaaaaaagg": [64, 66], "aaaaaaaaggggcctttttttt": 66, "aaaaaaaaggtggcctttttttt": [64, 66], "aaaag": 66, "aaaaggttt": 66, "aaaattt": 66, "aaccgctggcgaa": [63, 69], "aaccggttaacacccac": [64, 66], "aaccggttggccaa": [63, 69], "abbrevi": [15, 67], "abil": [38, 65], "abl": [9, 10, 11, 15, 16, 18, 26, 35, 42, 45, 46, 59, 64, 65, 66, 68, 69, 73], "about": [2, 7, 8, 10, 11, 15, 16, 26, 28, 35, 36, 43, 44, 47, 48, 49, 51, 56, 58, 62, 63, 66, 67, 69, 71, 72, 73], "abov": [7, 8, 15, 16, 18, 26, 30, 31, 36, 37, 41, 44, 45, 48, 58, 64, 65, 66, 67, 68, 69], "absenc": 58, "absolut": 36, "abstract": [10, 15, 16, 21, 62, 69], "abstractli": 69, "ac92": 15, "acactcaccacccaattgct": 67, "acactctccacccatttgct": 67, "acactctccagccatttgct": 67, "accept": [2, 5, 16, 24, 31, 32, 34, 43, 48, 56, 66, 67], "access": [2, 9, 15, 21, 23, 31, 41, 44, 51, 56, 57, 58, 59, 62, 63, 64, 65, 66, 67, 68, 73], "accggt": [64, 66], "accggtaaccggttaacacccac": [63, 65, 66], "accggtggaaccgg": [64, 66], "accggtggaaccggtaacacccac": [63, 65, 66], "accident": [10, 15, 28, 58], "accomplish": [10, 23, 32], "accord": [16, 35, 48], "accordingli": 66, "account": 37, "accur": [11, 15], "accuraci": 31, "acgt": 65, "achiev": [10, 14, 28, 40, 51, 66, 67, 68, 73], "acid": [0, 66], "acknowledg": 5, "acronym": 2, "across": [15, 18, 26, 31, 51, 62, 66, 67, 68], "act": [21, 69], "actinomycetota": 72, "action": [2, 7, 8, 9, 10, 11, 14, 16, 18, 25, 26, 27, 28, 32, 40, 42, 44, 48, 49, 50, 51, 53, 58, 62, 65, 67, 69, 71, 73], "action_id": [48, 59, 69], "activ": [4, 8, 15, 23, 28, 30, 43, 46, 66], "actor": 8, "actual": [15, 16, 28, 29, 39, 48, 49, 59, 64, 65, 66, 67, 69, 72], "ad": [9, 11, 16, 18, 26, 28, 31, 32, 34, 36, 42, 48, 58, 63, 64, 65, 66, 67, 68, 69, 70, 72], "adapt": [8, 23, 63, 65, 67, 68, 69], "add": [7, 16, 18, 35, 36, 39, 41, 50, 56, 58, 71, 73], "add_plugin": 21, "addion": 69, "addison": 0, "addit": [2, 9, 10, 12, 15, 16, 26, 30, 34, 35, 37, 43, 45, 48, 49, 56, 58, 62, 64, 65, 67, 69, 72, 73], "addition": [10, 12, 16, 28, 49, 69], "additon": 9, "address": [10, 28, 30, 41, 64, 65, 66, 68], "adequ": 10, "adher": [31, 68], "adjust": [30, 66], "adopt": [16, 26, 51, 65, 66], "advanc": [10, 29, 30, 43], "advantag": 10, "advis": 23, "ae0d0e26da5b84a6c0722148789c51e0": 18, "ae57": 15, "afb": 15, "afford": 58, "after": [26, 28, 30, 35, 39, 45, 62, 65, 66, 67, 68, 69, 71, 72, 73], "ag": [43, 49, 59], "again": [8, 26, 29, 30, 37, 42, 62, 63, 64, 66, 67, 68, 72], "against": [30, 35, 36, 59, 65, 67], "agnost": [4, 15], "ahead": [8, 48], "aid": 23, "aim": [11, 15], "airplan": 58, "alabast": 15, "alert": 30, "alfr": 23, "algorithm": [15, 28, 31, 66, 67, 73], "alia": [15, 18, 58], "alias": 15, "align": [0, 2, 15, 18, 64, 68, 72], "align_and_summar": 68, "aligned_sequ": [66, 69], "aligned_sequence1": [64, 66], "aligned_sequence2": [64, 66], "alignedproteinsequ": 65, "alignedrnasequ": 65, "alignedsequ": [64, 66, 68], "all": [2, 7, 8, 9, 10, 11, 15, 16, 18, 21, 23, 26, 27, 28, 29, 30, 31, 35, 37, 43, 44, 47, 48, 49, 51, 56, 57, 58, 59, 62, 64, 65, 66, 67, 68, 69, 71, 72, 73], "alloc": 12, "allot": 67, "allow": [2, 8, 9, 10, 11, 15, 16, 18, 21, 23, 26, 28, 30, 41, 44, 48, 49, 51, 56, 58, 62, 65, 66, 67, 68, 69, 72], "almost": [2, 16, 35, 72], "alon": 18, "along": [2, 26, 27, 29, 41, 67, 71, 72], "alongsid": [10, 18], "alpha": [18, 24, 32, 34, 44, 48], "alpha_divers": 34, "alpha_group_signific": 34, "alphadivers": [32, 34, 48], "alreadi": [15, 16, 28, 35, 40, 41, 46, 48, 51, 65, 66, 67, 71, 72, 73], "also": [4, 8, 9, 11, 15, 16, 18, 21, 23, 28, 29, 30, 35, 37, 43, 46, 48, 49, 51, 56, 57, 58, 62, 63, 64, 65, 66, 67, 68, 69, 71, 72, 73], "alter": 2, "altern": [10, 41, 60, 66, 67, 68], "although": [11, 49], "altschul": 0, "alwai": [8, 9, 11, 12, 15, 16, 30, 49, 58, 59, 62, 63, 64, 65, 66, 67, 68], "am": [26, 69], "ambigu": [2, 58, 65], "amino": [0, 66], "among": [15, 65], "amongst": 49, "amount": [8, 14, 67], "ampl": 30, "amplicon": [2, 7, 30, 35, 37, 41, 49], "an": [0, 2, 4, 8, 10, 11, 12, 13, 15, 17, 18, 21, 23, 26, 27, 28, 30, 31, 32, 33, 34, 35, 36, 40, 41, 42, 47, 48, 49, 51, 52, 53, 56, 57, 58, 59, 62, 63, 67, 69, 71], "an_input_filepath": 51, "an_output_filepath": 51, "anaconda": 44, "analys": [15, 69], "analysi": [2, 10, 15, 24, 31, 34, 52, 66], "analyt": [34, 65], "analyz": [43, 67], "anatomi": [10, 13, 15, 17], "ancestor": [9, 18], "ancestor_uuid": 18, "ancestr": [2, 9, 66], "andrew": 0, "angl": 8, "angri": 66, "ani": [2, 7, 8, 9, 10, 11, 12, 15, 16, 23, 24, 26, 27, 29, 30, 31, 35, 36, 41, 44, 45, 48, 49, 56, 57, 58, 62, 63, 64, 65, 66, 67, 68, 69, 71, 72], "anniversari": [0, 66], "annot": [2, 16, 27, 29, 31, 32, 33, 34, 48, 49, 56, 66, 67], "announc": 43, "anoth": [2, 9, 10, 11, 12, 16, 24, 26, 33, 43, 46, 49, 58, 64, 65, 67, 68, 69, 72], "answer": [12, 35, 41, 46, 71], "anti": [11, 50, 61, 65], "antipattern": 66, "anyon": [4, 16, 65], "anyth": [10, 12, 16, 23, 26, 28, 29, 30, 31, 34, 39, 48, 58, 59, 64, 65, 66, 67, 69, 72], "anytim": 30, "anywai": 16, "anywher": [16, 44, 49, 68], "api": [2, 5, 8, 14, 15, 16, 20, 22, 23, 30, 31, 32, 44, 48, 50, 51, 53, 57, 59, 61, 63, 64, 65, 68, 73], "app": 51, "appar": 67, "appear": [15, 16, 51, 66, 67], "append": [32, 67], "appl": [16, 45, 58], "appli": [0, 2, 26, 28, 31, 32, 51, 56, 62, 63, 66, 68, 72, 73], "applic": [0, 31, 45, 62, 66, 68, 69, 72, 73], "approach": [4, 7, 10, 15, 23, 37, 41, 42, 43, 51, 65, 67, 73], "appropri": [9, 12, 18, 27, 28, 32, 44, 48, 53, 66], "approv": 4, "april": [4, 30, 35, 43, 65], "apt": 26, "aptli": 9, "ar": [2, 4, 5, 7, 8, 9, 10, 11, 12, 14, 15, 16, 18, 21, 23, 24, 26, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 51, 55, 56, 58, 59, 60, 62, 63, 64, 65, 66, 67, 68, 69, 71, 72, 73], "arbitrari": [15, 51, 56, 58, 65, 67, 72], "arbitrarili": 2, "arbitrary_kei": 58, "architectur": [4, 13, 17], "archiv": [2, 8, 10, 11, 13, 15, 17, 19, 23, 28], "archiveformat": 18, "area": 4, "aren": [11, 16, 18, 51, 66], "arg": [16, 39, 65, 66], "argument": [8, 16, 18, 29, 48, 51, 53, 56, 58, 59, 65, 68], "argumentless": 56, "aris": [16, 28, 30, 65], "aritfact": 63, "around": [10, 26, 29, 30, 46, 59, 66, 67], "arrai": [10, 48], "arrow": [8, 18], "art": 10, "articl": [26, 28, 43, 52, 65, 66, 69], "artifact": [2, 8, 9, 10, 11, 12, 14, 15, 16, 18, 21, 24, 25, 26, 27, 31, 32, 33, 34, 40, 41, 42, 48, 50, 51, 53, 56, 58, 59, 62, 63, 64, 66, 67, 68, 69, 71, 72, 73], "artifact_collect": 59, "artifact_for_md": 59, "artifact_format": 56, "artifactapiusag": [48, 69], "artifactclass": 65, "arvum": 72, "arxiv": 43, "ask": [16, 35, 41, 43], "aspect": [10, 14, 15, 17, 47, 65, 66], "assembl": 66, "assert": [16, 48, 57], "assert_frame_equ": 67, "assert_has_line_match": [48, 59], "assert_no_nans_in_t": 57, "assert_output_typ": [48, 59], "assertequ": [63, 65, 66], "assertin": [64, 67], "assertionerror": 59, "assertnotequ": 66, "assertraisesregex": 65, "assertregisteredsemantictyp": [57, 65], "assertsemantictyperegisteredtoformat": 57, "assess": 69, "asset": [9, 44, 45, 57], "assign": [15, 16, 18, 28, 48, 49, 58, 66, 68, 69], "assist": [26, 37, 41, 45], "associ": [2, 7, 15, 16, 18, 26, 27, 28, 37, 44, 51, 56, 58, 59, 62, 63, 65, 66, 67, 68, 69, 71, 72], "assum": [10, 30, 35, 37, 51, 62, 66], "assur": 58, "ast": 21, "astut": 11, "asynchron": 8, "atom": 36, "attach": 16, "attempt": [48, 49, 65, 66], "attent": 35, "attribut": [21, 29, 57, 67], "attt": 66, "audienc": 8, "august": [30, 41, 46, 70], "auth": 35, "authent": 35, "author": [5, 23, 43, 59, 66, 68], "authorit": 68, "auto": 58, "autodoc": 5, "autom": [7, 26, 40, 46, 48, 50, 65, 73], "automat": [12, 15, 16, 31, 32, 34, 36, 52, 53, 56, 65, 68, 69], "avail": [2, 8, 9, 11, 23, 28, 37, 41, 42, 48, 49, 53, 55, 59, 60, 65, 66, 67, 68, 69, 72], "avoid": [7, 16, 28, 41, 42, 44, 48, 51, 65, 66, 69, 73], "awai": [16, 51, 56, 65], "awar": [16, 28, 37, 46, 51, 53, 65, 67, 72], "ax": 58, "b": [0, 16, 58, 59, 66], "b733": 18, "bacillota": 72, "bacillus_a": 72, "back": [10, 15, 16, 30, 51, 60, 62, 63, 64, 65, 66, 68, 69, 70, 71, 73], "backfir": 43, "background": [65, 66], "backward": [9, 29, 42, 73], "bacteri": 28, "bacteria": 72, "bad": [51, 65], "baerheim1994effect": 56, "bag": 16, "bail": 11, "banana": [16, 58], "bar": [29, 36, 56, 58, 59], "bar1": 59, "bar2": 59, "bar3": 59, "bar4": 59, "bar5": 59, "bar6": 59, "bar7": 59, "barcod": [11, 49], "barcode_id": 11, "base": [2, 4, 10, 11, 14, 21, 26, 27, 28, 30, 40, 41, 46, 49, 50, 51, 56, 58, 62, 64, 65, 66, 67, 69], "basetyp": 56, "basi": [28, 30, 66], "basic": [0, 11, 15, 16, 29, 30, 37, 48, 65, 66], "baz": 58, "bbe1": 9, "bdc8a": 18, "beauti": 4, "becaus": [2, 8, 9, 10, 11, 12, 15, 16, 18, 26, 28, 30, 37, 39, 48, 51, 62, 63, 64, 65, 66, 67, 68, 69, 72], "becom": [8, 11, 12, 16, 27, 30, 56, 58, 65, 67, 69], "been": [9, 16, 18, 23, 26, 27, 29, 35, 41, 51, 62, 65, 66, 67, 68, 71, 73], "befor": [7, 8, 16, 28, 30, 39, 40, 41, 42, 44, 48, 49, 63, 64, 65, 66, 67, 68, 69, 72, 73], "begin": [27, 43, 46, 62, 65, 66, 68, 73], "behav": 72, "behavior": [2, 8, 32, 48, 49, 56, 58, 66, 67, 68], "behind": [15, 16, 63, 68], "being": [5, 10, 12, 15, 16, 18, 28, 31, 37, 39, 42, 49, 51, 62, 65, 66], "believ": 10, "belong": 16, "below": [8, 9, 15, 18, 29, 30, 37, 44, 59, 62, 65], "benchmark": 46, "benefici": 30, "benefit": [15, 51, 65, 67, 69], "best": [16, 51, 58, 65, 66, 67], "beta": [27, 31, 32, 44], "beta_phylogenet": [27, 31], "beta_result": 32, "better": [8, 10, 12, 15, 16, 28, 45, 56, 63, 65], "between": [2, 4, 7, 8, 9, 10, 11, 15, 16, 18, 21, 27, 28, 30, 31, 32, 40, 50, 51, 58, 63, 65, 67, 72], "beyond": 48, "bib": [15, 18, 31, 44, 66], "bibtex": [15, 26, 31, 44, 52, 66], "bibtext": 66, "big": [51, 67, 69], "bigger": [44, 64], "binaryfileformat": [2, 11, 54, 56], "bio": [64, 65, 66], "bioconda": [30, 37], "bioinformat": [0, 2, 65, 66, 67, 72, 73], "biol": 0, "biolog": [2, 11], "biologi": [43, 66], "biom": [11, 26, 27, 28, 48, 66], "biomv210dirfmt": 9, "biopython": 65, "birthdai": 16, "bit": [11, 16, 30, 44, 58, 64, 65, 66, 67, 68], "blame": 51, "blank": [16, 58, 62], "blast": [66, 67], "blith": 16, "blob": 45, "block": [39, 48, 65, 67, 68, 72], "blue": [15, 18], "blur": 7, "bodi": [49, 64, 65], "bolyen": [0, 5, 23], "book": [23, 26, 32, 66, 69], "bool": [16, 29, 56, 57, 58, 62], "bool_dict": 29, "bool_list": 29, "boolean": [16, 58, 59, 66], "bore": 65, "both": [8, 11, 15, 16, 28, 36, 42, 44, 48, 58, 65, 66, 67, 68, 69], "bother": 69, "bottleneck": 4, "bottom": [8, 15, 65, 66, 69], "bound": [16, 58], "boundari": 66, "bowtie2index": 65, "box": [8, 15, 18, 51, 68], "brackendb": 65, "bracket": [8, 30, 37], "brai": 32, "branch": [7, 30, 36, 37, 58], "bray_curtis_distance_matrix": 32, "bray_curtis_emperor": 32, "bray_curtis_pcoa_result": 32, "braycurti": 32, "break": [9, 11, 16, 26, 69], "breviti": 8, "brief": [36, 43, 44, 65, 66, 72], "briefli": [47, 65, 66, 67], "bring": [15, 16, 66], "broad": [16, 58], "broadli": [51, 55, 69], "broken": [15, 23, 69], "browser": [2, 7, 35, 51], "bsd": [23, 66], "bug": [15, 51, 68], "buggi": 51, "bui": 43, "build": [4, 7, 16, 23, 26, 30, 40, 41, 50, 51, 55, 65, 66, 67, 68, 71], "built": [7, 8, 10, 16, 23, 26, 40, 43, 51, 62, 64, 65, 66, 68, 72], "bunch": [41, 64, 66], "bundl": 16, "burn": 51, "busi": [11, 43, 51], "bytesio": 60, "c": [0, 16, 51, 58, 59, 66], "c1": 58, "c9811bcaa3e6": 15, "cach": [7, 48, 64, 65, 66, 68, 72], "cake": 16, "calcul": [24, 44], "call": [8, 9, 10, 11, 12, 16, 21, 26, 27, 28, 29, 31, 32, 33, 34, 39, 44, 48, 49, 51, 56, 57, 59, 60, 64, 65, 67, 68, 69, 71, 72], "callabl": [53, 56, 59], "came": 48, "can": [2, 4, 5, 7, 8, 9, 10, 11, 12, 15, 16, 18, 23, 24, 26, 27, 28, 29, 30, 31, 32, 34, 35, 36, 37, 38, 41, 43, 44, 45, 46, 47, 51, 52, 56, 57, 58, 59, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73], "cancer": [7, 23], "cannot": [2, 8, 16, 24, 34, 60, 62], "canon": [23, 59], "capabl": [2, 11], "capit": 16, "caporaso": [0, 5, 23, 37, 41, 63, 64, 65, 66, 67, 68, 69, 71, 72], "captur": [9, 18, 41, 48, 73], "care": [8, 15, 27, 28, 48, 67], "carri": [10, 16, 28, 56], "casava": 11, "casavaoneeightsinglelanepersampledirfmt": 11, "case": [2, 5, 8, 9, 11, 12, 15, 16, 26, 28, 29, 31, 37, 41, 45, 48, 49, 51, 58, 59, 62, 64, 65, 66, 67, 68, 69, 71, 72], "cast": [49, 62, 69], "cat": [58, 66], "cat1": 18, "catch": 30, "categor": [16, 58, 62], "categori": [16, 43, 46], "categorical_md_col": 49, "categoricalmetadatacolumn": [49, 62], "caught": 39, "caus": [8, 58], "caveat": [41, 73], "cc": 23, "cd": [7, 45], "cd4015db31da": 15, "cell": 49, "central": [2, 15, 46, 49, 63], "certain": [5, 10, 62, 68], "certainli": [2, 35], "chain": [15, 63, 65, 68], "chalk": 16, "challeng": [10, 65], "chan": 23, "chang": [2, 4, 7, 8, 18, 23, 26, 29, 30, 35, 42, 43, 45, 48, 51, 56, 59, 64, 65, 66, 67, 68, 69, 71, 73], "changelog": 18, "channel": [30, 37], "chapter": [2, 23, 29, 40, 66, 67, 68, 72], "charact": [36, 44, 58, 62, 64, 65, 66], "characterist": [15, 18], "charset": 64, "chart": 67, "check": [8, 9, 11, 18, 28, 43, 45, 48, 49, 57, 59, 63, 64, 65, 66, 67, 69, 71], "checkbox": [16, 66], "checksum": 18, "chef": 16, "child": 12, "chloe": 0, "choic": [27, 28, 31, 35, 43, 58, 68], "choos": [10, 12, 15, 28, 42, 46, 49, 67], "chose": [15, 66, 72], "christian": 66, "christoph": 0, "ci": 45, "circl": [15, 16, 63], "circular": 42, "circumst": 51, "circumv": 51, "citabl": 43, "citat": [10, 15, 18, 31, 32, 34, 44, 50, 51, 55, 56, 61, 64, 68, 69, 71], "citation_text": 56, "citationrecord": [52, 56], "citatonrecord": 56, "cite": [2, 3, 9, 15, 18, 43, 66], "clang": 15, "clarifi": [10, 16], "class": [2, 10, 11, 15, 16, 18, 21, 25, 27, 29, 31, 33, 41, 42, 47, 48, 49, 50, 51, 52, 54, 56, 57, 58, 59, 63, 64, 66, 67, 68, 69, 72, 73], "classmethod": [52, 62], "claus": [23, 62], "clean": [12, 26, 53], "cleaner": 48, "cleanup": [12, 53], "clear": [36, 43, 66], "cleric": 15, "clever": [48, 56], "cli": 15, "click": [15, 66], "client": [15, 26], "clinic": [51, 66], "clone": [7, 45], "close": [9, 10, 16, 41, 62, 65], "closest": 72, "clunki": [48, 64, 65, 66], "cluster": [28, 67], "co": 43, "code": [2, 5, 7, 8, 9, 11, 15, 18, 21, 26, 27, 30, 36, 39, 41, 44, 48, 49, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73], "coerc": [27, 58], "cogniz": 41, "cohes": 2, "colin": 0, "colleagu": 15, "collect": [2, 13, 15, 16, 17, 18, 21, 32, 40, 48, 50, 52, 56, 62, 65, 66, 67], "collection_1": 59, "collection_2": 59, "collector": 12, "collis": 42, "color": 64, "column": [8, 16, 58, 59, 67, 72], "column_a": 59, "column_count": 62, "column_missing_schem": 62, "column_nam": 59, "column_ord": 72, "column_typ": [49, 62], "columnar": 2, "columnproperti": [58, 62], "com": [7, 15, 18, 30, 37, 44, 45], "combin": [2, 10, 11, 15, 16, 24, 31, 32, 34, 39, 48, 57], "combinator": 16, "combine_act": 67, "combine_las_report": 67, "come": [16, 24, 27, 28, 36, 46, 51, 58, 63, 65, 66, 69, 70, 71, 72, 73], "comfort": [40, 45, 67, 71, 73], "comma": 68, "command": [2, 7, 15, 16, 24, 26, 28, 31, 35, 37, 41, 44, 45, 48, 51, 65, 66, 68, 71, 72, 73], "comment": [59, 62], "commentari": 59, "commerci": 23, "commit": [18, 26, 30, 35, 36, 42, 65, 67, 69, 71], "common": [0, 2, 9, 10, 11, 15, 16, 18, 21, 27, 48, 51, 56, 65, 66, 68, 72], "commonli": [28, 49, 55, 66], "commun": [2, 8, 23, 30, 36, 44, 46, 59, 68, 69], "compabl": 42, "compar": [8, 34, 56, 64, 65, 66, 68], "comparison": 34, "compat": [8, 9, 10, 21, 30, 36, 37, 40, 44, 50, 51, 58], "complet": [7, 8, 10, 15, 16, 23, 28, 33, 35, 39, 41, 44, 56, 64, 65, 66, 67, 68, 69, 71, 73], "complex": [9, 15, 16, 44, 48, 64, 67], "compliant": 36, "complic": 72, "compon": [11, 18, 23, 26], "compos": [10, 11, 41, 58, 62, 68], "composit": [10, 15, 16, 37, 58], "compound": 16, "comprehens": 16, "compromis": [15, 16], "comput": [0, 2, 7, 10, 15, 16, 28, 31, 32, 35, 39, 48, 49, 50, 51, 65, 68, 69, 71, 73], "computation": 68, "concat": 67, "concaten": 67, "concept": [28, 66], "conceptu": [58, 65], "concern": [8, 15, 23, 28, 31, 65, 66], "concis": 16, "conclud": 28, "conclus": [50, 73], "concret": [16, 49, 56, 60, 62], "concurr": 42, "conda": [2, 15, 30, 35, 36, 37, 41, 48], "conda_subdir": 45, "condit": [57, 66], "confid": 51, "config": 45, "configur": [9, 11, 26, 46, 67, 68], "confirm": [7, 35, 43, 48, 63, 65, 66, 67, 69, 72], "conflict": [10, 30, 41], "confound": 12, "confus": [10, 28, 30], "congratul": 71, "connect": [44, 56], "consensu": 16, "consequ": [16, 58], "consid": [2, 10, 11, 15, 16, 18, 26, 41, 51, 58, 62, 65, 66, 67, 68], "consider": [16, 42, 62, 67], "consist": [9, 18, 49, 58, 62], "constrain": [16, 58], "constraint": [8, 10, 35], "construct": [8, 11, 14, 16, 21, 41, 58, 62], "construct_artifact_collect": 59, "constructor": 59, "consum": [49, 51], "consumm": [15, 66], "consumpt": [2, 66], "contain": [2, 8, 9, 10, 11, 15, 16, 23, 26, 28, 29, 31, 32, 34, 36, 44, 49, 51, 52, 56, 59, 62, 65, 66, 69, 71, 72, 73], "content": [2, 4, 7, 9, 15, 28, 29, 37, 48, 62, 64, 65, 66, 70], "context": [2, 12, 15, 16, 26, 37, 44, 45, 50, 55, 56, 60, 61, 65, 67, 68, 69], "contigu": 58, "continu": [26, 35, 51, 65, 67, 71], "contract": 31, "contraint": 10, "contrast": [2, 9, 15, 24], "contribut": [5, 15], "contributor": 5, "control": [26, 65, 67, 68, 71], "convei": 66, "conveni": [9, 10, 16, 18, 26, 49, 51, 56, 57, 63, 64, 65], "convent": [26, 33, 44, 48, 58, 65, 66, 68, 69, 72], "convers": 27, "converst": 63, "convert": [2, 8, 10, 21, 27, 33, 56, 59, 60, 62, 63, 65, 72], "convinc": [66, 69], "cook": 16, "cookiecutt": [23, 26, 70], "cool": [26, 35, 43, 49, 51, 56, 63, 66, 67], "cool_project": 49, "coordin": [2, 8, 31], "copi": [63, 66, 71], "copyfil": 60, "copyright": 66, "core": [9, 12, 14, 15, 16, 18, 32, 49, 58, 59, 60, 66, 67], "core_metr": 32, "core_metrics_phylogenet": 15, "correct": [15, 48, 51], "correctli": [51, 64], "correspond": [29, 31, 37, 58, 62, 65, 66, 72], "corrupt": 11, "cost": [16, 51], "costli": 51, "could": [10, 15, 16, 24, 28, 29, 31, 37, 43, 44, 48, 51, 56, 58, 64, 65, 66, 67, 69, 72], "couldn": [15, 51], "count": [28, 31, 64], "counter": 66, "counterpart": 16, "counterproduct": 51, "coupl": [8, 30, 51, 63, 65, 66], "courier": 64, "cours": [16, 30, 46, 66, 68], "cover": [7, 23, 44, 48], "cpu": 58, "crash": [39, 51], "creat": [4, 7, 9, 11, 12, 15, 16, 23, 26, 28, 29, 30, 35, 36, 37, 40, 41, 42, 43, 44, 45, 48, 49, 50, 51, 53, 56, 57, 58, 59, 62, 63, 64, 65, 66, 69, 70, 72, 73], "creation": [10, 15, 67], "creator": 65, "credit": 69, "criteria": [46, 62], "critic": [2, 68], "cron": 30, "cross": [7, 15, 51], "crude": 64, "cryptosporangium": 72, "csvdirformat": 56, "csvformat": 56, "ctx": [32, 53, 55, 56, 67, 68], "curiou": 48, "current": [4, 9, 11, 12, 15, 16, 18, 23, 29, 30, 35, 37, 41, 43, 45, 48, 60, 62], "curti": 32, "custom": [4, 15, 18, 30, 71], "custom_ax": 15, "cut": 16, "cutadapt": [42, 49], "cutleri": 16, "cycl": 37, "czi": 23, "d": [0, 5, 23, 26, 30, 31, 41, 44, 64, 65, 66, 68, 69, 71], "d_001": 11, "dada2": [15, 42], "daf": 23, "daf2019": 23, "dag": 15, "dai": 23, "daniel": [0, 73], "darn": 35, "dash": [8, 44], "data": [2, 7, 8, 11, 12, 13, 16, 17, 18, 25, 27, 31, 33, 43, 49, 50, 51, 56, 57, 58, 59, 60, 62, 64, 65, 66, 67, 71, 73], "databas": 67, "datafram": [28, 49, 51, 56, 58, 59, 62, 67, 68, 72], "dataset": [7, 31], "date": [23, 30, 36], "datetim": 15, "david": 0, "de": 29, "deal": [7, 16, 63], "debug": 30, "decemb": 51, "decentr": [10, 13, 17, 18], "decid": [8, 51, 58, 66, 68], "decis": [10, 16, 28, 67], "declar": [11, 28], "decor": [14, 16, 33, 56, 65], "decoupl": 8, "decreas": 67, "dedic": 48, "deep": [12, 15, 16], "def": [11, 27, 29, 31, 32, 33, 34, 48, 49, 51, 56, 59, 63, 64, 65, 66, 67, 68, 69, 72], "default": [15, 26, 30, 31, 35, 37, 49, 52, 56, 57, 59, 62, 65, 66, 67, 68, 69, 71], "default_missing_schem": 62, "defer": [8, 59], "defin": [2, 5, 8, 10, 11, 15, 18, 21, 24, 26, 27, 28, 29, 30, 31, 32, 33, 34, 37, 40, 41, 45, 49, 50, 51, 56, 57, 58, 59, 62, 64, 68, 72, 73], "definit": [11, 16, 24, 29, 34, 48, 57, 65, 66, 67, 69], "defunct": 56, "degre": 31, "delai": 28, "delet": [63, 66, 71], "deliber": 57, "deliv": 10, "demonstr": [10, 56, 59, 66, 71], "demultiplex": [11, 28], "demultiplexed_seq": 18, "demutiplex": 65, "demux": 49, "denot": [2, 8], "depend": [2, 8, 9, 15, 18, 28, 30, 35, 37, 41, 44, 45, 48, 49, 65, 67, 68], "deploi": [42, 69], "deploy": [2, 28, 41, 42, 63, 68, 71], "deprec": [23, 56, 58], "depth": 24, "deriv": [2, 23, 66], "descend": 67, "describ": [2, 4, 8, 9, 10, 11, 15, 16, 18, 26, 28, 30, 31, 32, 34, 44, 45, 48, 51, 59, 62, 63, 64, 65, 66, 67, 68, 69], "descript": [8, 9, 10, 15, 29, 31, 32, 34, 36, 44, 51, 56, 62, 63, 64, 65, 66, 68, 72], "descriptor": [14, 16, 42, 60], "design": [9, 10, 27, 30, 62, 63, 67, 68], "desir": 59, "destin": [10, 27, 29, 60], "destroi": 12, "destruct": 12, "destructor": 12, "detail": [2, 4, 9, 10, 15, 16, 18, 29, 31, 33, 36, 38, 44, 48, 49, 55, 62, 65, 66, 67], "detect": [28, 65], "determin": [9, 10, 15, 16, 26, 27, 31, 49, 62, 64, 66, 67], "dev": [23, 26, 30, 45, 48, 64, 65, 66, 68, 72], "dev0": 45, "develop": [2, 7, 8, 10, 11, 15, 18, 22, 26, 28, 30, 33, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 46, 48, 49, 56, 57, 61, 62, 63, 64, 66, 67, 68, 69, 70, 71, 72, 73], "devic": 64, "df": [49, 59, 65], "diagram": 18, "dialog": [16, 51], "diataxi": [0, 69], "dict": [21, 29, 52, 56, 58, 59, 62, 66, 67, 68], "dict_of_int": 59, "dictat": [58, 59], "dictionari": [21, 29, 31, 44, 48, 56, 58, 67, 68, 69, 72], "did": [63, 65, 66, 67, 68, 72], "didn": [2, 16, 39, 64, 66], "diff": 65, "differ": [2, 7, 9, 10, 11, 15, 16, 18, 21, 23, 28, 30, 31, 34, 37, 40, 44, 45, 50, 51, 59, 62, 63, 64, 65, 66, 67, 68, 69, 71], "differec": 51, "differenti": [11, 16, 18, 67, 72], "difficult": [10, 12, 28, 37], "digress": 65, "dillon": 0, "dimens": 31, "dine": 16, "dir": [57, 66, 71], "direct": [8, 15, 16, 30, 46, 73], "directli": [8, 10, 12, 15, 18, 21, 26, 27, 28, 29, 31, 33, 48, 49, 58, 63, 65, 66, 68, 72], "directori": [2, 9, 10, 12, 13, 15, 17, 18, 26, 28, 29, 30, 35, 36, 37, 45, 48, 56, 59, 64, 66, 68, 69, 71], "directory_format": [14, 56], "directoryformat": [2, 11, 54, 56, 65], "disabl": 65, "disambigu": 28, "disassoci": 15, "discontinu": 58, "discourag": 9, "discours": 46, "discov": [15, 28, 30, 35, 43, 66, 69], "discoveri": [28, 51], "discret": 2, "discuss": [4, 7, 10, 15, 16, 23, 26, 28, 30, 38, 41, 51, 65, 66, 69, 70], "disk": [2, 10, 11, 28, 29, 59, 62, 65], "dispatch": [9, 16, 18], "displai": [15, 26, 44, 48, 59, 64, 66, 71], "disregard": 48, "dissemin": 69, "distanc": [31, 32, 49, 65], "distance_matrix": [27, 31, 32], "distancematrix": [27, 31, 32, 33, 65], "distinct": [15, 16, 32, 56, 58, 66, 72], "distinguish": [2, 10, 16, 58], "distribut": [2, 7, 15, 23, 30, 40, 44, 49, 50, 51, 66, 67, 71], "distro": 36, "dive": [15, 16], "divers": [15, 24, 31, 32, 34, 42, 44, 48, 68], "diversity_lib": 48, "divid": 67, "di\u00e1taxi": [0, 23, 73], "dm": 32, "dna": [2, 11, 64, 65, 66, 67, 68, 69], "dnafastaformat": [11, 66], "dnaiter": [18, 65, 66, 67], "dnasequencesdirectoryformat": [11, 18], "do": [7, 10, 15, 16, 18, 23, 26, 27, 29, 31, 32, 33, 34, 35, 36, 39, 41, 44, 46, 48, 49, 51, 56, 58, 59, 63, 64, 65, 66, 67, 68, 69, 70, 72, 73], "doc": [7, 23, 36, 59, 62, 69], "docstr": [62, 66], "doctyp": 64, "document": [0, 6, 8, 10, 15, 16, 17, 18, 23, 26, 28, 29, 35, 36, 40, 41, 44, 46, 47, 48, 51, 56, 59, 60, 62, 66, 69, 71, 73], "documentat": 69, "docx": 10, "doe": [2, 8, 9, 10, 12, 15, 16, 23, 24, 26, 29, 31, 34, 36, 43, 48, 56, 57, 58, 60, 62, 65, 66, 67, 68, 69], "doen": 9, "doesn": [11, 15, 16, 26, 28, 31, 41, 43, 45, 47, 62, 64, 65, 66, 67, 68, 69], "doi": [23, 43], "domain": [8, 16, 42, 56, 58], "don": [2, 4, 7, 10, 16, 26, 30, 33, 35, 37, 43, 48, 51, 63, 64, 65, 66, 68, 69, 70, 71, 72], "done": [7, 8, 15, 28, 30, 31, 35, 41, 44, 52, 59, 65, 66, 67, 68, 69, 72], "dot": 8, "doubl": 58, "doubt": 43, "down": [15, 16, 65], "download": [15, 45, 51, 59, 71], "downstream": [30, 51, 72], "dozen": 16, "dr": 2, "draft": 41, "drill": 15, "driven": [2, 66], "driver": [7, 48, 56, 59, 69], "drop": 62, "drop_all_miss": 62, "drop_all_uniqu": 62, "drop_missing_valu": [49, 62], "drop_zero_vari": 62, "dropdown": 16, "dry": [2, 68, 72], "dst": 60, "dtype": 62, "due": [10, 29, 30, 67], "dull": 16, "dull_par": 16, "dummi": 51, "dummy_output": 51, "dummy_plugin": [29, 59], "dump": 16, "duplic": [9, 15, 60, 69, 71, 72], "duplicate_t": [28, 66], "durat": 15, "dure": [7, 15, 35, 44, 48, 51, 56, 59, 65, 66, 68], "dwq2": [4, 23, 28, 37, 44, 63, 64, 65, 66, 67, 68, 69, 71, 72], "dwq2_action": 69, "dynam": [8, 12], "e": [0, 2, 7, 9, 10, 11, 12, 15, 18, 21, 23, 26, 28, 29, 30, 31, 32, 34, 35, 36, 37, 41, 42, 43, 44, 48, 49, 51, 52, 56, 58, 59, 60, 62, 64, 65, 66, 67, 68, 69, 71, 73], "e072706": 18, "e1011676": 0, "e168": 15, "e5c5": 15, "each": [8, 9, 10, 15, 16, 18, 23, 26, 28, 30, 31, 32, 36, 37, 41, 48, 49, 56, 58, 59, 62, 64, 65, 66, 68, 69, 73], "earli": [4, 73], "earlier": [16, 29, 65, 66, 68], "eas": [10, 15], "easi": [9, 16, 48, 65, 66, 68], "easier": [15, 16, 18, 35, 37, 41, 63, 65, 66], "easiest": [37, 48, 70, 71], "easili": [15, 26, 28, 69], "eat": 16, "ebb5968ebafb": 15, "ecosystem": [30, 46, 65], "ed": 58, "ed5d": 15, "edg": 66, "edit": [0, 7, 26, 39, 51, 65, 66], "editor": 26, "effect": [8, 15, 58, 67], "effici": [28, 65], "effort": [8, 15, 51], "eigendecomposit": 31, "eigenvalu": 31, "eigenvector": 31, "eigh": 31, "either": [2, 8, 16, 28, 30, 35, 41, 51, 58, 62, 65, 66, 67, 68, 71], "element": [15, 16, 44, 49, 58, 59], "elev": 49, "elig": [46, 49], "elizabeth": 0, "els": [10, 26, 28, 29, 48, 65, 68], "elsevi": 66, "elsewher": [51, 68], "email": [15, 46], "emp": 49, "emperor": [15, 32, 44], "emperor_plot": 32, "emploi": [42, 64], "emppairedenddirfmt": 11, "empti": [26, 29, 51, 56, 58], "en": 64, "enabl": [2, 9, 10, 15, 26, 35, 39, 43, 48, 49, 63, 64, 65, 66, 67, 68, 69, 72], "enclos": 37, "encod": [9, 10, 62], "encode_miss": 62, "encount": [41, 65, 67], "encourag": [46, 56, 72], "end": [8, 15, 29, 43, 44, 58, 64, 65, 66, 68, 70, 71, 73], "endnot": 66, "energi": 67, "enforc": [16, 58, 62], "engin": [2, 51, 66, 68], "enough": [9, 16, 48, 67], "ensur": [9, 11, 12, 30, 45, 48, 49, 51, 57, 64, 65, 66, 67, 69], "entir": [8, 9, 11, 12, 16, 37, 49, 56, 64, 68], "entireti": [65, 67], "entiti": [5, 10, 65], "entri": [2, 8, 26, 51, 52, 56, 58], "entry_point": [26, 44], "enumer": [8, 11, 29, 58, 67], "env": [30, 37, 45, 66], "environ": [2, 7, 10, 18, 30, 35, 36, 37, 40, 41, 48, 50, 65, 66, 69, 71, 72], "environment": 66, "epeat": 68, "epoch": [30, 36, 37, 59], "epub": 10, "equal": [11, 16, 67], "equenc": 66, "equival": [7, 21, 58, 68], "erron": 68, "error": [10, 11, 28, 51, 59, 62, 65, 66, 72], "especi": [28, 71], "essenti": [16, 29, 44, 51, 56, 58, 65], "establish": 42, "etc": [11, 15, 16, 18, 31, 44, 49], "euclidean": 49, "eval": 14, "evalu": [16, 59], "evan": [0, 5, 16, 23], "evelop": 23, "even": [10, 15, 16, 26, 28, 32, 41, 48, 51, 64, 65, 66, 67], "evenness_vector": 32, "event": [15, 30, 58, 59, 66], "eventu": 39, "ever": [15, 16, 26, 34, 58, 63, 72], "everi": [9, 10, 11, 15, 34, 56, 58, 62, 66, 68, 69, 73], "everyon": [16, 43, 51], "everyth": [28, 45, 48, 51, 55, 63, 64, 65, 66, 67, 71], "everywher": 14, "evid": 67, "evil": 11, "evolut": 66, "evolv": [9, 18], "exact": 31, "exactli": [2, 10, 15, 24, 34, 48, 62, 63, 65, 66, 72], "examin": 27, "exampl": [2, 4, 7, 8, 9, 11, 12, 16, 18, 23, 24, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 39, 40, 42, 43, 44, 45, 49, 50, 51, 55, 56, 57, 58, 60, 61, 62, 63, 64, 65, 66, 67, 68, 70, 71, 73], "example1": 56, "example2": 56, "example_funct": 29, "example_function_variant1": 56, "example_function_variant2": 56, "excacerb": 12, "except": [11, 12, 15, 16, 32, 34, 40, 43, 50, 58, 64, 65, 66, 68], "excit": [49, 69], "exclud": [16, 26, 44, 58], "exclus": [42, 48, 57, 58, 68], "execut": [2, 8, 31, 48, 56, 57, 59, 66, 67, 68, 69, 71, 73], "execute_exampl": [48, 57, 69], "executionusag": 48, "executionusagevari": 59, "exemplifi": 28, "exercis": 67, "exist": [2, 4, 10, 11, 15, 16, 26, 28, 29, 31, 35, 39, 40, 42, 46, 49, 50, 51, 56, 58, 59, 60, 65, 66, 67, 71], "exit": [12, 21, 28, 39, 66, 71], "exp": 48, "exp_format": 57, "expand": [4, 7, 15, 56, 64, 73], "expect": [7, 10, 11, 16, 21, 23, 28, 29, 31, 34, 41, 43, 45, 48, 51, 57, 63, 64, 65, 66, 67, 69, 71], "expected_hit": 67, "expens": 68, "experi": [15, 43, 45, 67, 69], "experienc": [26, 41], "expert": 46, "expertis": [51, 69], "explain": 16, "explan": [17, 23, 26, 28, 38, 50, 65], "explanatori": 65, "explicit": 72, "explicitli": [16, 26, 29, 39, 51, 58], "explor": [23, 34, 44, 64, 68, 69], "export": [7, 49, 64, 66, 69], "expos": [11, 48, 49, 68], "express": [15, 16, 21, 48, 56, 58, 59, 69], "ext": 59, "extend": [2, 10, 29, 57, 66], "extens": [5, 30, 34, 38, 59, 65], "extension": 16, "extent": 43, "extern": [51, 56, 68], "extol": 16, "extra": [11, 16, 36, 51, 57, 66, 72], "extract": [9, 10, 15], "extrem": 65, "f": [0, 11, 37, 48, 52, 59, 65, 72], "f1000": 43, "f6105891": 18, "f95f324": 18, "face": [48, 65, 69], "facet": 10, "facilit": [0, 7, 10, 30, 36, 40, 41, 50, 66, 71, 72], "fact": [29, 41, 66], "facto": 29, "factori": [11, 16, 21, 58, 59, 63, 69], "factory1": 59, "factory2": 59, "fail": [8, 28, 30, 51, 57, 64, 65], "failur": [28, 30, 51, 65, 66], "fair": [10, 66], "fairli": [37, 67], "faith_pd": 18, "fall": 66, "fallen": 30, "fals": [15, 33, 56, 57, 58, 62, 65, 66, 67], "familar": 72, "famili": 64, "familiar": [28, 37, 44, 48, 49, 65], "fanci": 16, "far": [16, 31, 72], "fast": 31, "fasta": [10, 11, 28, 65, 66], "faster": [7, 8], "fastq": [10, 11, 28, 65], "fastqgzformat": 11, "favorit": 66, "featur": [2, 10, 24, 28, 32, 36, 37, 48, 49, 51, 56, 58, 62, 65, 67, 69, 71, 72], "feature_data": [18, 66], "feature_t": [32, 48, 51], "feature_table1": 48, "feature_table2": 48, "feature_table3": 48, "feature_table_merge_exampl": 48, "feature_table_merge_three_tables_exampl": 48, "featuredata": [51, 64, 65, 66, 67, 68, 72], "featuret": [9, 27, 28, 31, 32, 48, 51, 71], "feb": 15, "feedback": [4, 5, 26, 70], "feel": [15, 30, 41, 43, 51, 65, 67, 69, 71], "few": [15, 16, 27, 28, 30, 32, 34, 36, 42, 46, 47, 57, 64, 65, 68, 72, 73], "fewer": 67, "ff": [33, 56, 59, 63, 65, 69], "ff427b50aaa1": 15, "fh": [11, 33, 56, 57, 64, 65, 67, 72], "field": [15, 16, 21, 36, 51, 52, 58, 59, 65, 66], "field_memb": [16, 58], "field_nam": [16, 58], "fifteen": 15, "fig": [9, 15, 18, 36], "figur": [2, 8, 34, 51, 64, 65, 67], "file": [2, 8, 10, 13, 16, 17, 18, 24, 25, 26, 29, 30, 31, 33, 34, 35, 36, 37, 44, 45, 48, 50, 51, 52, 56, 57, 59, 60, 62, 63, 64, 66, 67, 68, 69, 71, 72], "file1": 59, "file2": 59, "filecollect": 11, "fileformat": 11, "filehandl": 52, "filenam": [10, 11, 15, 18, 26, 30, 57, 65], "filepath": [26, 52, 57, 58, 62, 65], "filesystem": [12, 58], "fill": 37, "fillet": 16, "filter": [7, 62, 67, 72], "filter_column": [49, 62], "filter_id": 62, "final": [8, 15, 16, 34, 41, 44, 48, 49, 58, 65, 66, 67, 68, 69, 72, 73], "find": [15, 16, 23, 26, 28, 32, 34, 37, 40, 43, 44, 51, 56, 58, 60, 63, 66, 67, 68, 69, 71, 72, 73], "fine": [15, 35, 41, 45, 51], "finish": 8, "first": [7, 8, 11, 16, 23, 26, 27, 30, 32, 34, 35, 37, 40, 41, 48, 50, 51, 53, 56, 58, 63, 65, 67, 69, 70, 71, 72], "first_memb": 59, "fish": 16, "fit": 58, "five": 15, "fix": [10, 16, 30, 51, 58, 65], "flake8": 45, "flavor": [24, 36], "flexibl": [41, 64, 65, 69, 72], "flexilib": 48, "float": [16, 58, 62, 65, 66, 68], "flow": 67, "flower": 16, "fly": 11, "fn": 65, "focu": [11, 15, 23, 41, 45, 48, 65], "focus": [46, 62, 66], "fold": 72, "folder": 36, "folk": 69, "follow": [2, 9, 10, 16, 18, 26, 29, 30, 31, 32, 34, 35, 36, 37, 39, 41, 44, 45, 48, 56, 62, 63, 64, 65, 66, 67, 68, 69, 71, 72], "font": 64, "foo": [29, 56, 58, 59], "forg": [15, 30, 37], "forget": [15, 16, 66, 70], "fork": [7, 16], "form": [2, 8, 15, 16, 29, 51, 65, 66], "formal": [16, 67, 68], "format": [2, 8, 9, 10, 13, 15, 16, 17, 25, 26, 27, 30, 31, 33, 36, 40, 41, 42, 44, 47, 48, 49, 50, 55, 56, 57, 59, 61, 62, 63, 64, 66, 67, 69, 72, 73], "format_inst": 11, "format_str": 21, "former": 41, "formerli": 2, "fortun": [12, 29], "forum": [29, 41, 44, 46, 51, 56, 65, 66, 69, 70], "forward": [11, 30, 35, 66, 68, 69, 73], "found": [5, 8, 15, 18, 30, 57, 58, 63, 64, 65, 66, 67, 71, 72], "foundat": [23, 41], "four": [8, 66], "fp": 65, "fr": 0, "fraction": 67, "fragil": 64, "fragment": [18, 56, 58, 67], "framework": [0, 2, 8, 9, 11, 14, 15, 16, 18, 23, 27, 38, 42, 44, 45, 48, 49, 51, 57, 59, 66, 69], "free": [2, 15, 26, 43, 44, 46, 51, 65, 66, 67, 71], "freedom": [16, 65], "frequenc": [9, 27, 28, 30, 31, 32, 48, 51, 71], "frequent": [28, 69], "fridai": 28, "friendli": [16, 44, 66, 67], "from": [2, 4, 5, 7, 8, 9, 10, 11, 12, 15, 16, 18, 21, 23, 26, 27, 28, 29, 30, 31, 32, 33, 35, 37, 39, 41, 42, 43, 44, 45, 46, 48, 50, 51, 52, 53, 56, 57, 58, 59, 62, 64, 65, 66, 67, 68, 69, 70, 72, 73], "from_typ": [57, 60, 66], "front": [26, 36], "frost": 16, "fruit": 16, "frustrat": [28, 51, 67], "fsvd": 31, "ft": 48, "ft1_factori": 48, "ft2_factori": 48, "full": [15, 18, 23, 47, 64, 66, 67, 68, 69], "fulli": [7, 15, 36, 51, 68], "fun": 69, "function": [2, 4, 8, 9, 11, 15, 16, 26, 27, 28, 29, 30, 33, 36, 38, 41, 44, 45, 48, 49, 51, 53, 56, 57, 59, 63, 65, 67, 68, 69, 72, 73], "fundament": [16, 66, 73], "funder": 23, "further": [8, 12, 15, 16, 58, 62], "futur": [7, 10, 11, 23, 29, 39, 51, 58, 68, 69], "fuzzi": 16, "g": [9, 10, 11, 12, 15, 18, 21, 23, 26, 28, 30, 32, 34, 35, 36, 37, 41, 42, 43, 44, 48, 49, 51, 52, 59, 62, 65, 67, 68, 69, 71, 73], "g1827eab": 45, "g7cf7a7a": 45, "g8ac7e3": 45, "gain": 62, "galaxi": [2, 51, 66, 69, 73], "game": 66, "gap": [64, 66], "gap_extend_penalti": [65, 66, 67, 68], "gap_open_penalti": [65, 66, 67, 68], "garbag": [13, 17, 51], "gatekeep": 4, "gave": 29, "gehret": 0, "gene": 67, "gener": [0, 2, 4, 7, 8, 9, 10, 11, 15, 16, 21, 23, 24, 26, 27, 28, 30, 31, 34, 35, 37, 42, 43, 46, 48, 51, 56, 58, 59, 63, 64, 65, 66, 67, 68, 69, 70, 72, 73], "genera": 28, "genom": 66, "genu": 72, "get": [8, 10, 15, 16, 26, 29, 33, 35, 43, 44, 45, 48, 51, 57, 64, 65, 66, 67, 68, 69, 71, 72, 73], "get_act": [32, 53, 67, 68], "get_artifact_collection_memb": 59, "get_available_cor": 60, "get_column": [58, 62], "get_data_path": [57, 65, 66], "get_id": [49, 62], "get_index_path": 67, "get_metadata_column": 59, "get_miss": 62, "get_sequence_id": 65, "get_transform": [57, 63], "get_valu": 62, "ggcctttttttt": [64, 66], "gh": [35, 71], "gish": 0, "git": [7, 30, 35, 37, 45, 66], "github": [4, 5, 7, 15, 18, 23, 36, 37, 40, 41, 44, 45, 46, 50, 65, 69, 71], "githubusercont": [37, 45], "give": [8, 15, 16, 36, 44, 48, 65, 68, 69], "given": [2, 10, 15, 16, 21, 28, 48, 53, 56, 58, 59, 64, 65, 66, 67], "glanc": [8, 10], "global": [15, 42, 56, 66, 68], "global_pairwise_align_nucleotid": [65, 66, 68], "glossari": 3, "go": [7, 16, 26, 30, 35, 43, 48, 51, 64, 65, 66, 67, 68, 69, 70, 71], "goal": [8, 16, 23, 28, 40, 43, 51, 63, 64, 66, 67, 68, 69, 72], "goe": [11, 15], "golden": [66, 71], "gone": 51, "good": [16, 26, 30, 44, 49, 59, 64, 65, 66, 67, 69, 70, 71], "googl": 66, "gotcha": 11, "grab": 45, "grai": 8, "grain": 15, "grammar": 16, "grant": 23, "granular": 16, "grape": 16, "graph": 15, "graphic": [2, 10, 16, 34, 51, 66], "grasp": 16, "great": [16, 36, 48, 65, 69], "greater": [18, 58, 66], "greg": [5, 23, 43, 66], "gregcaporaso": 45, "gregori": 0, "gross": 16, "groundwork": 5, "group": [2, 8, 16, 34, 67, 69], "grow": 26, "grumpi": 35, "gttt": 66, "guarante": 51, "guid": [23, 26, 30, 37, 38, 45, 48, 50, 69], "guidanc": [41, 73], "guidelin": [37, 69], "gz": 11, "gzip": 11, "ha": [8, 9, 10, 11, 15, 16, 18, 23, 26, 28, 30, 32, 35, 39, 41, 44, 48, 49, 51, 58, 62, 64, 65, 66, 67, 68, 71, 72, 73], "habit": 44, "hack": [45, 48], "had": [9, 16, 28, 43, 56, 64, 65, 68], "hadn": 9, "halfwai": 8, "halko2011": 31, "hand": [8, 15, 16, 28, 49, 51, 65, 72], "handl": [12, 15, 27, 29, 40, 49, 50, 51, 62, 63, 67], "happen": [15, 16, 26, 28, 31, 59, 65, 67], "happi": [16, 69, 70], "har": [47, 57], "hard": [15, 16, 28, 42, 65], "harder": 16, "hardwar": 15, "has_missing_valu": [49, 62], "hash": 16, "hassl": 30, "have": [2, 5, 8, 9, 10, 11, 12, 15, 16, 18, 23, 27, 28, 29, 30, 31, 32, 35, 36, 37, 39, 41, 42, 43, 45, 46, 48, 49, 51, 57, 58, 59, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73], "haven": [10, 16, 30, 51, 65, 66, 67], "head": [16, 57, 64], "header": 62, "hear": [5, 12, 28], "hello": [58, 59], "help": [4, 7, 10, 15, 16, 26, 28, 30, 34, 35, 36, 37, 41, 44, 45, 46, 48, 51, 56, 59, 65, 66, 68, 69, 70, 71, 72], "helper": [57, 63, 65, 67, 69], "here": [2, 4, 7, 8, 11, 15, 16, 18, 23, 26, 27, 28, 30, 31, 32, 33, 34, 35, 37, 43, 44, 45, 47, 48, 49, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72], "herman": 0, "heurist": 31, "hide": 15, "hierarchi": 16, "high": [8, 15, 44, 65, 66, 67, 68], "highest": [8, 36, 67], "highli": [11, 51, 66, 69], "highlight": 10, "hint": [64, 65, 66, 69], "histor": [9, 18, 26], "histori": [2, 10, 15, 18], "hit": [67, 72], "hoc": [11, 58], "hold": [15, 16], "home": 16, "homebrew": 26, "homologi": [67, 72], "honor": 69, "hood": [63, 67, 69], "hook": [14, 57, 64], "hope": [28, 43, 67], "hopefulli": [30, 65], "host": [2, 7, 15, 23, 36, 37, 71], "hour": 28, "hous": [15, 37, 72], "how": [2, 4, 7, 8, 9, 11, 13, 15, 16, 17, 23, 26, 28, 30, 31, 33, 35, 36, 38, 41, 44, 45, 48, 50, 51, 58, 59, 62, 64, 65, 66, 67, 68, 69, 71, 72, 73], "howev": [2, 5, 8, 10, 16, 37, 41, 49, 51, 65, 72], "html": [7, 9, 34, 64, 67, 72], "http": [0, 7, 15, 18, 23, 30, 37, 44, 45, 59, 62, 66], "huge": [9, 28, 66], "human": [18, 31, 56, 58, 64, 65, 66, 67], "hunt": [0, 2], "hurt": 43, "hyphen": 56, "hypothes": 66, "hypothesi": [2, 66], "i": [2, 4, 5, 7, 8, 9, 11, 12, 13, 14, 16, 17, 18, 21, 23, 24, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 41, 42, 43, 44, 45, 47, 48, 49, 51, 52, 53, 55, 56, 57, 58, 59, 60, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73], "i_tabl": 48, "icon": [15, 18], "id": [2, 48, 49, 56, 58, 59, 62, 63, 65, 67, 69, 72], "id_count": 62, "id_head": 62, "idea": [2, 4, 7, 8, 9, 10, 16, 26, 28, 30, 43, 65, 66, 69, 72], "ideal": [7, 16, 41, 43, 56, 65, 66, 69], "ident": [2, 9, 18, 65, 66, 68], "identfii": 65, "identif": 0, "identifi": [2, 8, 15, 27, 30, 48, 49, 51, 56, 58, 59, 62, 65, 66, 67, 72], "identity_with_metadata_column_get_mdc": 48, "ids_to_keep": 62, "idx": 11, "ignor": [9, 10, 26, 51, 56, 58, 62, 66], "ignore_missing_sampl": 15, "ignore_pcoa_featur": 15, "iim": 23, "illumina": 11, "illustr": [8, 9, 16, 18, 27, 35, 36, 41, 66, 68], "imag": 36, "imagin": [16, 29, 48], "immedi": [43, 73], "immutablemetadata": 49, "impact": [10, 15, 28, 31, 58, 66, 67], "imped": 16, "implement": [9, 16, 29, 30, 37, 48, 51, 59, 62, 65, 66, 67, 68, 72, 73], "implementationerror": 21, "impli": [9, 65, 66, 68], "implic": 66, "implicit": 58, "import": [7, 8, 10, 14, 15, 16, 18, 26, 28, 30, 31, 33, 42, 43, 44, 48, 51, 56, 58, 63, 64, 66, 67, 68, 69, 72], "import_data": [32, 48, 59, 63, 67, 69], "import_from_format": 59, "import_modul": 65, "importantli": [8, 15, 66, 69, 72], "importlib": 65, "imposs": [15, 28], "improv": [4, 43], "in_": 63, "inaccur": [15, 23], "inact": 8, "inadvertantli": 15, "inappropri": 28, "incident": 69, "includ": [2, 7, 9, 10, 11, 15, 16, 23, 26, 30, 31, 32, 34, 36, 37, 43, 44, 48, 49, 51, 56, 58, 59, 62, 65, 66, 67, 68, 69, 71, 72, 73], "include_suffix": 62, "inclus": 58, "inclusive_end": [16, 58, 66], "inclusive_start": [58, 66], "incompat": [29, 73], "incomplet": [15, 51, 68], "incomprehens": 15, "inconveni": 10, "incorpor": 24, "incorrect": 28, "increas": [66, 67], "incredibli": 10, "increment": [43, 58], "incur": 66, "indent": 16, "independ": [28, 58, 65], "index": [3, 9, 34, 58, 59, 62, 64, 67, 72], "index_fp": 67, "indic": [5, 8, 15, 28, 29, 31, 35, 41, 44, 45, 48, 57, 58, 62, 64, 65, 66, 67, 68, 72], "indistinct": 16, "individu": [2, 15, 26, 44, 48, 52, 62, 66, 67], "ineffect": 51, "inequ": 16, "inf": 51, "infer": [48, 49, 62, 66, 72], "infin": 58, "influenc": 31, "info": 45, "inforamt": 26, "inform": [2, 8, 9, 10, 11, 12, 14, 15, 16, 18, 23, 26, 28, 30, 31, 33, 41, 43, 44, 46, 49, 56, 64, 65, 66, 67, 71, 72], "informat": 23, "infrastructur": 67, "infrequ": 63, "inher": 65, "inherit": [18, 66], "ini": 9, "init_artifact": [48, 59, 69], "init_artifact_collect": 59, "init_artifact_from_url": 59, "init_format": 59, "init_metadata": 59, "init_metadata_from_url": 59, "initi": [11, 23, 26, 28, 30, 35, 48, 64, 65, 66, 73], "inject": 48, "inner": [15, 62, 72], "inplac": [67, 72], "input": [2, 8, 9, 11, 12, 15, 16, 18, 24, 27, 28, 31, 32, 33, 34, 40, 48, 49, 50, 56, 57, 58, 59, 64, 65, 66, 68, 71], "input_descript": [31, 32, 34, 51, 56, 64, 66, 68], "inputtypea": 58, "inputtypeb": 58, "insdc": 62, "insert": [18, 64, 66], "insid": [10, 16, 18, 31, 48, 65, 67, 72], "insight": 43, "inspect": 16, "inspir": 59, "instal": [2, 7, 10, 26, 30, 36, 40, 41, 42, 43, 44, 48, 50, 63, 65, 69, 72], "instanc": [2, 16, 29, 31, 44, 48, 49, 56, 57, 65, 66, 68], "instanti": [21, 26, 29, 31, 49, 56, 59, 65, 66, 69], "instead": [8, 12, 16, 21, 28, 32, 44, 51, 52, 56, 58, 62, 64, 66, 67, 68], "institut": 23, "instruct": [7, 10, 23, 26, 30, 31, 36, 37, 40, 41, 45, 69, 71, 73], "int": [11, 16, 29, 31, 32, 56, 58, 59, 60, 62, 67], "int_collect": 59, "int_collection6": 59, "int_collection7": 59, "int_dict": 29, "int_list": 29, "int_seq_collect": 59, "integ": [9, 11, 16, 29, 56, 58, 62], "integr": [15, 26, 39, 41, 48, 50, 67, 73], "intellig": 16, "intend": [2, 8, 21, 23, 28, 35, 45, 48, 49, 65, 66, 67, 69, 73], "intent": [2, 8, 28, 58], "intention": [9, 64], "inter": [8, 16, 66], "interact": [2, 8, 9, 16, 21, 29, 44, 49, 51, 66, 68], "interest": [11, 15, 16, 23, 26, 37, 43, 49, 56, 58, 67, 70], "interestingdataformat": 49, "interfac": [2, 4, 7, 8, 10, 11, 15, 18, 22, 23, 24, 26, 31, 35, 44, 45, 48, 49, 51, 56, 58, 59, 65, 66, 73], "intermedi": [15, 24, 65], "intern": [10, 28, 29, 49, 56, 59, 65, 68, 69], "interoper": 41, "interpret": [2, 9, 15, 18, 24, 43, 51, 58, 62, 67, 69], "interrupt": 67, "intersect": 58, "intervent": 7, "intial": 59, "introduc": [4, 18, 28, 35], "introduct": [0, 2, 48, 66, 67, 72], "introspect": 8, "intsequence1": [56, 59], "intsequence2": 56, "intsequenceformat": [11, 59], "intuit": [16, 66], "invalid": [11, 28, 51, 62, 65, 66], "invent": 10, "invers": 58, "invert": 16, "invest": 43, "investig": 15, "invoc": 16, "invok": [8, 12, 48, 53, 57, 59], "involv": [10, 16], "io": [52, 65], "ipython": [66, 69], "iq": 28, "is_semantic_typ": 58, "isn": [7, 11, 16, 26, 36, 43, 57, 59, 65, 66, 67, 69, 72], "iso": 15, "issu": [12, 15, 28, 30, 41, 44, 46, 48, 65, 70], "itcr": 30, "item": [29, 66], "iter": [7, 29, 43, 52, 58, 59, 62, 66, 67], "ith": 23, "its": [2, 7, 8, 10, 11, 15, 16, 18, 26, 27, 28, 29, 31, 34, 38, 44, 48, 49, 53, 56, 59, 62, 64, 65, 66, 67, 68, 69, 71, 72], "itself": [8, 9, 10, 15, 29, 58, 65, 66], "iupac": 65, "j": 0, "jaccard": 32, "jaccard_distance_matrix": 32, "jaccard_emperor": 32, "jaccard_pcoa_result": 32, "januari": [7, 51], "jargon": 65, "jewel": 0, "job": [28, 30, 58, 67], "join": [62, 64, 67, 70, 72], "journal": [43, 66], "journei": [0, 66], "json": [16, 21], "jsonp": 18, "juggl": 12, "jupyt": [2, 23, 69], "just": [8, 14, 15, 16, 23, 26, 28, 29, 41, 43, 45, 48, 49, 51, 58, 63, 64, 65, 66, 67, 69, 71, 72], "k": 56, "keef": 0, "keep": [11, 15, 16, 26, 30, 32, 36, 42, 64, 67], "kei": [8, 15, 18, 29, 31, 36, 44, 48, 51, 52, 56, 58, 59, 66, 69], "kept": 72, "key1": 58, "key2": 58, "keyerror": 72, "keyword": 48, "kind": [2, 8, 11, 16, 28, 49, 65], "kishitanii": 72, "kit": 8, "kitchen": 16, "knife": 16, "knive": 16, "know": [9, 11, 16, 23, 26, 28, 35, 43, 48, 51, 64, 65, 66, 67, 69, 71, 72], "knowledg": [8, 46, 66, 68], "known": [10, 12, 16, 28, 31, 58], "kruskal1952us": 34, "kwarg": 59, "la": [67, 72], "lab": [23, 37, 41, 63, 64, 65, 66, 67, 68, 69, 71, 72], "label": [8, 16, 48], "lack": 16, "lai": 5, "lane_numb": 11, "lang": 64, "languag": [10, 14, 15, 16, 28], "laptop": [67, 69], "larg": [9, 15, 28, 31, 43, 56, 65, 66, 73], "larger": [8, 58, 67], "las_act": 67, "las_result": 67, "last": [14, 16, 35, 51, 64, 65, 67, 71], "latebindingattribut": 14, "later": [8, 10, 65, 66, 71], "latest": [30, 36, 48, 71], "latter": 41, "launch": 7, "layer": 8, "layout": [2, 10], "lead": [26, 28, 39, 51, 65], "learn": [10, 23, 26, 27, 43, 47, 66, 68, 69, 71, 73], "least": [2, 11, 28, 29, 34, 51, 62, 65], "leav": [16, 26, 28, 30, 37, 64], "left": [28, 62, 72], "left_on": 72, "legal": 58, "legendrelegendr": 31, "len": [65, 72], "length": [67, 72], "lengthi": 16, "less": [8, 23, 28, 60, 65], "lesson": [64, 66], "let": [15, 16, 23, 26, 32, 35, 48, 51, 58, 63, 64, 65, 66, 67, 68, 69, 71, 72, 73], "level": [8, 11, 15, 26, 30, 35, 36, 37, 40, 44, 49, 50, 51, 56, 62, 64, 65, 66, 68, 69, 71], "lib": [30, 66], "librari": [30, 31, 40, 41, 44, 48, 50, 65, 66], "licens": 66, "life": 27, "lifetim": 12, "lift": 10, "lightli": 26, "lignment": 66, "like": [2, 7, 8, 9, 10, 11, 15, 16, 18, 23, 26, 28, 29, 30, 31, 32, 34, 35, 37, 39, 40, 41, 42, 44, 45, 46, 48, 49, 51, 56, 58, 59, 60, 63, 64, 65, 66, 67, 68, 69, 71, 72], "limit": [11, 15, 16, 37, 41, 42, 58], "line": [2, 7, 11, 15, 16, 18, 27, 28, 31, 35, 44, 45, 51, 56, 59, 64, 65, 66, 72], "linear": 9, "link": [5, 15, 34, 48, 60, 62, 65, 66, 67, 68], "linkcod": 5, "linux": [35, 45], "lipman": 0, "list": [3, 7, 11, 14, 15, 16, 18, 28, 29, 31, 32, 34, 36, 37, 41, 44, 45, 48, 52, 56, 57, 58, 59, 65, 66, 67, 68, 70, 72], "liter": [48, 56, 59], "littl": [7, 16, 44, 64, 65, 66, 71], "live": [15, 26, 41, 44, 65], "ll": [15, 16, 23, 26, 28, 30, 35, 37, 40, 45, 48, 51, 63, 64, 65, 66, 67, 68, 69, 71, 72, 73], "llm": 15, "load": [8, 11, 18, 26, 28, 31, 36, 44, 48, 49, 51, 52, 56, 57, 62, 64, 65, 66, 69, 71], "local": [0, 7, 35, 45, 48, 57, 66, 68, 71, 72], "local_alignment_search": 67, "local_pairwise_align_nucleotid": [66, 68], "localalignmentsearchresult": [67, 72], "localalignmentsearchresultsformat": 72, "localhost": 7, "locat": [8, 12, 36, 37, 51], "log": [15, 32, 35], "logic": [9, 11, 58, 60], "login": 35, "long": [2, 8, 10, 11, 27, 28, 31, 36, 37, 41, 56, 58, 64, 65, 66, 67], "longer": [56, 64, 65, 66, 67], "longitudin": 49, "look": [8, 9, 11, 16, 18, 26, 28, 29, 30, 32, 34, 37, 39, 40, 44, 48, 49, 57, 58, 63, 64, 65, 66, 67, 68, 69, 71, 72, 73], "lookup": [59, 66], "loop": 67, "loss": 31, "lot": [16, 26, 28, 30, 43, 44, 46, 48, 51, 63, 64, 65, 67, 69, 72], "loudli": 28, "love": [5, 12, 41, 43], "lower": 62, "lsmat": 33, "lsmatformat": 33, "luck": 43, "luckili": 64, "m": [0, 7, 26, 48, 64, 65, 66, 67, 68, 69, 71], "m3": 67, "macbook": 67, "machin": [15, 16, 51, 65], "machineri": [35, 57, 65], "maco": 45, "macosx": 15, "made": [10, 18, 23, 28, 39, 48, 49, 59, 65, 66, 71], "magic": [26, 67], "magnitud": 31, "mai": [2, 4, 7, 8, 10, 15, 16, 18, 23, 26, 28, 29, 30, 31, 40, 41, 48, 49, 51, 53, 56, 58, 59, 62, 65, 66, 67, 68, 69, 71, 73], "mail": 44, "main": [16, 30, 37, 39, 62, 64, 65], "maintain": [10, 26, 30, 37, 41, 46, 48, 68, 72], "mainten": [15, 30], "major": [51, 64, 65], "make": [4, 7, 9, 10, 11, 15, 16, 18, 26, 28, 29, 30, 31, 34, 35, 36, 37, 41, 42, 43, 45, 48, 51, 56, 58, 62, 63, 64, 66, 67, 68, 69, 71, 72, 73], "make_artifact": [32, 53, 68], "makefil": 35, "manag": [2, 9, 12, 15, 26, 45, 51, 53, 57, 59, 60, 65, 66, 67, 68, 71], "mani": [5, 9, 10, 11, 15, 16, 18, 26, 28, 31, 34, 42, 43, 48, 49, 65, 66, 67, 68, 72], "manipul": [8, 9, 10, 58, 59, 62], "manner": [31, 49], "manual": [15, 29, 30, 48, 65], "manuscript": [2, 15, 43], "map": [21, 31, 58, 59, 62, 66, 67, 69], "mapping_1": 59, "mapping_2": 59, "mappingproxytyp": 62, "march": [0, 2, 11], "mari": 0, "markdown": [23, 36], "market": 43, "massiv": 15, "masteri": [0, 66], "match": [16, 18, 42, 44, 45, 53, 56, 58, 59, 62, 64, 66, 67, 72], "match_scor": [65, 66, 67, 68], "materi": [7, 49, 57, 59, 69], "matric": 31, "matrix": [31, 32, 65], "matter": [16, 31, 58], "matthew": 0, "max": [11, 56, 65], "maxim": [40, 50, 65], "mayb": [64, 68], "md": [18, 35, 36, 41, 49, 58, 59, 71], "md1": 59, "md2": 59, "md3": 59, "md5": 18, "md5sum": 18, "md_for_column": 59, "me": [16, 26, 51, 64, 65, 66, 68, 69, 71], "mean": [5, 8, 9, 10, 12, 15, 16, 23, 28, 37, 42, 44, 58, 65, 66, 67, 71], "meaning": [48, 51], "meaningless": 51, "meant": [2, 58], "meantim": 65, "mechan": [16, 35, 41, 51, 56], "medic": 66, "meet": [36, 48, 62, 69], "member": [11, 16, 21, 58, 59], "memori": [2, 10, 12, 28, 62, 67], "mention": [35, 64, 65, 66, 68, 69], "menu": 16, "merg": [9, 36, 48, 59, 62, 72], "merge_metadata": 59, "merged_t": 48, "messag": [28, 51, 56, 62, 66, 71, 72], "met": 36, "meta": [26, 45, 64], "metaclass": 14, "metadata": [2, 15, 16, 18, 24, 26, 32, 34, 40, 44, 48, 50, 55, 61, 63, 64, 65, 67, 69, 73], "metadata_column": 72, "metadata_index": 72, "metadatacolumn": [16, 49, 58, 62], "metadatafileerror": 62, "metagenom": [2, 30, 37, 41], "metapackag": [2, 30, 41], "metaprogram": [13, 17], "method": [0, 2, 11, 14, 15, 16, 18, 21, 24, 26, 27, 29, 32, 34, 37, 40, 42, 48, 49, 50, 51, 53, 56, 57, 59, 62, 64, 65, 68, 69, 70, 71, 72, 73], "methodnam": 57, "metric": [15, 27, 31, 32, 44], "mi": 15, "microbiom": [2, 7], "microsecond": 15, "mid": 67, "might": [10, 11, 16, 28, 29, 37, 44, 45, 48, 49, 57, 59, 65, 66, 67], "migrat": 56, "miller": 0, "min": [11, 56, 65], "mind": [15, 16, 41, 42, 65, 69], "mine": [16, 65, 67, 69], "mini": 46, "miniconda": 45, "miniconda3": [45, 66], "minim": [11, 38, 39, 45, 51, 65], "minimum": 64, "minor": [39, 66], "minut": [14, 28, 63, 64, 65, 66, 67], "mirror": 15, "miscellan": [66, 71], "misdiagnos": 51, "misialq": 23, "misinform": 51, "misinterpret": 28, "mismatch": [16, 64, 66], "mismatch_scor": [65, 66, 67, 68], "miss": [28, 41, 49, 51, 62, 67, 72], "missing_id": 72, "missing_schem": [58, 62], "mission": 16, "mistak": 65, "misus": 10, "mix": [16, 73], "mode": [7, 8, 11, 45, 54, 65], "model": [11, 14, 15, 16, 51, 65], "moder": 46, "modestli": 69, "modif": [39, 65], "modifi": [18, 66, 67], "modul": [2, 5, 16, 26, 55, 56, 58, 64, 65, 66, 68, 69], "modulo": 16, "mol": 0, "molecular": [0, 66], "moment": [5, 7, 47, 66], "mondai": 28, "monitor": [44, 46, 67], "monospac": 64, "month": 46, "more": [2, 4, 8, 9, 10, 11, 12, 15, 16, 18, 23, 24, 26, 28, 30, 31, 32, 35, 36, 37, 38, 40, 41, 43, 44, 46, 47, 48, 49, 51, 56, 58, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73], "morn": 28, "most": [7, 8, 10, 15, 16, 23, 28, 30, 36, 39, 42, 43, 49, 51, 56, 58, 64, 65, 66, 67, 68, 69, 73], "mostli": 65, "motiv": [10, 28], "mouth": [16, 43], "move": [7, 8, 9, 10, 29, 30, 45, 59, 63, 65, 66, 67, 68, 73], "mroe": 26, "msa": [64, 65, 66, 68, 69], "msa_summari": 68, "much": [8, 10, 11, 16, 28, 29, 45, 48, 59, 65, 66], "multi": [7, 67, 68], "multiindex": 72, "multipl": [7, 8, 10, 11, 15, 16, 18, 21, 23, 28, 29, 37, 51, 56, 57, 58, 59, 64, 65, 66, 67, 73], "multiprocess": 12, "must": [2, 8, 11, 15, 16, 18, 27, 29, 31, 32, 34, 36, 39, 44, 48, 56, 57, 58, 59, 60, 62, 65, 66, 67, 68], "mutual": 57, "mv": 2, "my": [26, 28, 36, 43, 48, 51, 56, 63, 64, 65, 66, 67, 68, 69, 71, 72, 73], "my_act": [51, 59], "my_artifact": 59, "my_column": 59, "my_int": 59, "my_metadata": 59, "my_method": 56, "my_pipelin": 56, "my_plugin": 59, "my_visu": 56, "my_viz": 49, "myer": 0, "mynewformat": 51, "mypi": 31, "myself": 69, "myst": 23, "n": [11, 37, 45, 67], "n_char": 65, "n_job": 32, "n_jobs_or_thread": 15, "n_less": 60, "name": [2, 8, 9, 10, 11, 15, 16, 18, 21, 26, 29, 30, 31, 32, 33, 34, 36, 37, 42, 44, 45, 48, 51, 54, 56, 57, 58, 59, 62, 64, 65, 66, 67, 68, 69, 72], "namedtupl": [21, 52], "namespac": [21, 42], "nan": [57, 62], "narrow": [8, 58], "nation": 23, "nativ": 2, "natur": [58, 62, 69, 73], "navig": [35, 58], "nc": 23, "nd": 23, "nearli": 66, "neat": 26, "necessari": [10, 11, 16, 49, 55, 67], "necessarili": [8, 16, 28, 46, 56], "necessit": [30, 73], "need": [4, 7, 8, 9, 10, 11, 16, 21, 23, 26, 28, 29, 30, 32, 35, 36, 37, 41, 43, 44, 45, 48, 49, 51, 56, 58, 59, 60, 63, 64, 65, 66, 67, 68, 69, 70, 72], "needleman": [0, 66, 68], "needleman1970": [66, 69], "needleman1970gener": 66, "neg": [51, 58, 66], "neither": [15, 16], "nest": [2, 8, 15, 16, 26], "network": 30, "never": [8, 16, 30, 33, 40, 51, 65, 66, 68], "new": [2, 4, 7, 9, 10, 11, 12, 15, 16, 18, 23, 28, 29, 30, 31, 35, 36, 37, 38, 41, 42, 43, 44, 45, 50, 51, 53, 58, 60, 62, 64, 67, 68, 69, 70, 72, 73], "newick": [10, 28, 65], "next": [15, 30, 34, 35, 43, 44, 46, 51, 65, 66, 67, 68, 69, 70, 71, 72, 73], "nexu": 65, "nice": [16, 40, 50, 69], "nicer": 64, "nih": 23, "node": [15, 65, 67], "nois": 56, "nomenclatur": 16, "non": [8, 10, 15, 21, 31, 32, 48, 49, 58, 59, 65, 66], "non_definite_chars_count": 65, "none": [8, 11, 21, 31, 32, 34, 48, 49, 52, 53, 54, 56, 57, 58, 59, 60, 62, 64, 65, 66, 72], "nonetheless": 16, "nonsens": 58, "nor": 15, "normal": [12, 15, 16, 32, 58, 62, 65, 66], "notabl": [10, 15], "note": [8, 15, 29, 30, 35, 37, 47, 48, 56, 58, 60, 62, 63, 65, 66, 67], "notebook": [2, 15], "noth": [15, 26, 56, 58, 59, 60, 62], "notic": [11, 28, 31, 46, 65, 67, 68], "notif": [28, 46, 73], "notion": 15, "noun": 2, "novemb": 0, "now": [8, 10, 11, 16, 18, 23, 30, 35, 39, 41, 43, 45, 48, 58, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72], "np": [48, 62], "nucleotid": [64, 66], "null": [9, 15], "num": 58, "num1": 56, "num2": 56, "num_split": 67, "number": [8, 11, 15, 16, 26, 27, 31, 44, 45, 49, 56, 58, 59, 60, 62, 66, 71, 72], "number_of_dimens": 31, "numer": [16, 58, 62], "numeric_md_col": 49, "numericmetadatacolumn": [49, 62], "numpi": 48, "nw": [64, 66, 68], "nw_align": [64, 65, 66, 69], "nw_align_act": 68, "nw_align_example_1": 69, "nwaligntest": 66, "o": [15, 29, 48, 52, 58, 60, 64, 66, 69, 71, 72], "o1": 48, "o2": 48, "ob": 57, "object": [2, 8, 12, 14, 15, 16, 26, 27, 31, 32, 33, 34, 49, 50, 52, 56, 57, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 72], "obs_feat_vector": 48, "obscur": [51, 63, 65], "observ": [8, 11, 16, 32, 41, 51, 63, 64, 65, 66, 67], "observed_featur": 48, "observed_features_exampl": 48, "observed_hit": 67, "observed_index": 67, "observed_otu": 32, "observed_otus_vector": 32, "observed_viz": 67, "obtain": [49, 59, 62, 67], "obviou": 16, "obvious": [16, 43], "occur": [8, 11, 12, 15, 48, 66], "occurr": 30, "octob": [0, 18, 30], "odd": 66, "off": [12, 16, 30, 37, 43, 51, 65, 68], "offend": 42, "offens": 65, "offer": [12, 18, 46, 49], "offici": [30, 37], "often": [10, 15, 16, 26, 28, 33, 37, 51, 64, 66, 67, 69, 73], "ok": [28, 51, 64, 65], "okai": 45, "old": [7, 16, 23], "older": [9, 15, 28, 56, 71], "omiss": 58, "omit": 62, "onc": [8, 10, 11, 16, 30, 31, 36, 43, 48, 58, 63, 65, 67], "one": [2, 8, 9, 10, 11, 15, 16, 18, 24, 26, 28, 29, 30, 31, 32, 33, 34, 35, 37, 39, 41, 42, 44, 47, 48, 49, 51, 56, 58, 62, 64, 65, 66, 67, 68, 69, 71, 72], "oner": 8, "ones": [41, 65, 66], "onion": 8, "onli": [2, 5, 8, 9, 11, 15, 16, 18, 23, 24, 28, 31, 32, 34, 35, 36, 41, 43, 44, 45, 49, 51, 56, 58, 59, 60, 62, 63, 64, 65, 66, 67, 68, 71, 72, 73], "onlin": [30, 43], "opaqu": 65, "open": [4, 7, 10, 11, 15, 33, 36, 45, 49, 51, 56, 64, 65, 66, 67, 69, 72], "oper": [2, 10, 15, 16, 24, 26, 28, 49, 51, 56, 67, 72], "opinion": 11, "opportun": [49, 51, 67, 68], "oppos": [2, 45, 65, 67], "opposit": [58, 67], "opt": [67, 71], "option": [11, 15, 21, 30, 35, 37, 43, 44, 46, 48, 57, 58, 62, 67], "optional1": 56, "optional2": 56, "orang": 58, "orchestr": 2, "order": [10, 11, 15, 16, 29, 30, 48, 56, 58, 59, 62, 66, 67, 72], "ordereddict": 52, "ordinationresult": 31, "org": [0, 7, 15, 18, 23, 30, 37, 45, 59, 62, 66], "organ": [16, 23, 37, 41, 45, 65], "orient": 56, "origin": [2, 9, 10, 18, 29, 31, 32, 34, 57, 62, 67, 72], "osx": 45, "other": [2, 4, 5, 8, 9, 10, 11, 15, 16, 23, 24, 26, 28, 29, 31, 34, 35, 36, 37, 40, 41, 44, 50, 51, 53, 56, 57, 59, 62, 64, 65, 66, 67, 68, 69, 71, 72, 73], "other_plugin": 16, "otherwis": [11, 29, 49, 56, 57, 58, 62, 71, 72], "otu": 32, "our": [4, 7, 10, 15, 16, 23, 28, 37, 41, 43, 48, 51, 63, 64, 65, 68, 69, 70, 71, 72], "ourself": 68, "ourselv": [16, 66], "out": [9, 11, 14, 16, 26, 28, 30, 36, 41, 43, 49, 51, 56, 59, 62, 64, 65, 66, 67, 68, 69, 71, 72], "outcom": [15, 28, 48, 49, 51, 66], "outdat": [15, 23, 28], "outer": 15, "outf": 51, "outlin": [30, 37, 59], "output": [2, 11, 15, 16, 18, 24, 27, 28, 31, 32, 33, 34, 40, 48, 50, 56, 58, 59, 64, 65, 66, 67, 68, 69, 71, 72], "output_descript": [31, 32, 34, 51, 56, 66, 68], "output_dir": [34, 49, 56, 64, 72], "outsid": [26, 39, 58, 66], "outweigh": 67, "over": [7, 8, 9, 11, 15, 16, 18, 28, 32, 43, 44, 52, 59, 65, 66, 67, 68], "overal": [8, 18], "overhead": 67, "overlap": [48, 58, 62], "overlap_method": 48, "overload": 28, "overrid": [57, 59, 62], "overridden": 57, "overriden": 59, "oversel": 43, "oversight": 65, "overview": [13, 17], "overwrit": 60, "own": [2, 4, 7, 11, 15, 16, 27, 30, 40, 41, 46, 48, 51, 53, 63, 66, 69, 70, 71, 72, 73], "owner": [30, 36, 37], "p": [23, 48, 64, 66], "pacakg": 26, "packag": [2, 8, 14, 15, 25, 30, 31, 37, 44, 45, 50, 52, 56, 57, 64, 65, 66, 67, 69, 71], "pad": 64, "page": [5, 7, 12, 26, 35, 36, 43, 44, 51, 59, 64, 66], "pai": [35, 51], "pain": 66, "pair": [2, 10, 27, 32, 36, 49, 52, 58, 66], "pairedendsequenceswithqu": 11, "pairwis": [2, 49, 64, 67, 68], "panda": [28, 34, 49, 58, 59, 62, 67, 68], "paper": [16, 43, 66], "paperpil": 66, "paragraph": 15, "parallel": [7, 8, 26, 40, 50, 68, 73], "parallel_config": 67, "parallelconfig": 67, "paramet": [2, 8, 10, 15, 16, 21, 24, 27, 29, 31, 32, 34, 44, 45, 48, 49, 52, 56, 57, 58, 60, 62, 64, 65, 66, 67, 68, 69, 71, 72], "parameter_descript": [31, 32, 34, 49, 51, 56, 64, 66, 68], "params_only_method": 59, "paranthraci": 72, "pare": 16, "parent": 15, "parenthesi": 8, "pars": [9, 18, 28], "parse_format": 21, "parse_typ": [14, 21], "parser": [9, 18], "parsl": 67, "part": [4, 11, 12, 17, 23, 29, 30, 37, 38, 41, 47, 51, 55, 58, 59, 64, 65, 66, 69, 70, 72], "parti": 42, "particular": [2, 8, 9, 10, 37, 49, 58, 59], "particularli": 12, "partit": 49, "pass": [2, 10, 11, 15, 18, 28, 29, 30, 35, 37, 44, 45, 48, 49, 51, 58, 64, 65, 66, 67, 68, 69, 72], "passag": 8, "passthrough": 15, "past": [37, 63, 66], "pastri": 16, "pastrybag": 16, "path": [5, 12, 28, 29, 34, 36, 44, 48, 51, 52, 54, 57, 58, 59, 62, 63, 64, 66, 69, 71, 72], "pathlib": 57, "pathlik": 52, "pathspec": 54, "pattern": [11, 26, 37, 50, 61, 65], "payload": [2, 9, 10, 11], "pcoa": [15, 31, 32], "pcoa_result": 32, "pcoaresult": [31, 32], "pd": [28, 34, 49, 51, 56, 58, 59, 62, 67, 72], "pdt": 67, "pear": 16, "peek": [59, 66, 69], "peer": 43, "pen": 16, "penalti": 66, "pencil": 16, "pend": [18, 47, 65], "peopl": [16, 26, 43, 68], "per": [10, 11, 15, 28, 58, 64, 67], "percent": [67, 72], "perciev": 65, "perfect": 16, "perform": [2, 8, 9, 10, 11, 15, 16, 28, 30, 35, 38, 49, 51, 52, 59, 62, 63, 64, 65, 66, 67, 68], "permit": [10, 16, 56], "persist": [10, 11, 15], "person": [10, 16, 37, 69], "perspect": 43, "ph": 49, "phone": 51, "photobacterium": 72, "phrase": 28, "phylogenet": [15, 28, 31, 32, 65, 66], "phylogenetic_metr": 27, "phylogeni": [15, 27, 28, 31, 65], "phylum": 72, "pictur": [7, 8, 59], "piec": [2, 9, 10, 16, 68], "pielou": 32, "pielou_": 32, "pip": [7, 30, 35, 37, 41, 48], "pipelin": [2, 18, 21, 24, 27, 40, 50, 55, 56, 61, 72, 73], "pipx": 71, "pivot": 49, "pkg_resourc": 15, "place": [10, 11, 26, 29, 36, 46, 47, 58, 62, 65, 66, 67, 68, 72], "placehold": 47, "plai": [30, 40, 50], "plain": [10, 16], "plan": [15, 18, 28, 30, 46, 48, 51, 65, 70, 71], "platform": [15, 46], "pleas": [15, 23, 41, 43, 46, 48, 51, 65, 66], "plo": 0, "plot": [15, 32, 34], "plu": 11, "plugin": [2, 4, 5, 7, 8, 10, 11, 14, 15, 16, 18, 23, 24, 25, 28, 29, 31, 32, 33, 34, 39, 40, 46, 48, 49, 52, 53, 54, 57, 58, 59, 61, 62, 63, 65, 67, 68, 69, 70, 72], "plugin_id": [48, 59, 69], "plugin_setup": [33, 44, 48, 64, 65, 67, 68, 69], "pluginmanag": [2, 7, 26, 59], "pluginmethod": 56, "pluginpipelin": 56, "pluginvisu": 56, "png": [15, 34], "point": [8, 9, 15, 26, 34, 35, 41, 56, 58, 62, 63, 65, 66, 67, 68, 72], "poke": [26, 71], "popular": [43, 69], "port": [15, 23], "posit": [2, 58, 64, 65, 66], "possess": [16, 58, 59], "possibl": [9, 10, 15, 16, 18, 28, 36, 37, 48, 51, 57, 58, 60, 63, 64, 65, 66, 67, 68, 69], "possibli": [9, 15], "post": 66, "potenti": 28, "pound": 62, "power": [16, 26, 48, 65, 66, 67, 69], "pr": [30, 36], "practic": [16, 51, 59, 64, 65, 71], "pragmat": [0, 66, 68], "pre": [26, 64], "predecessor": 18, "predefin": [2, 72], "predetermin": 16, "predic": 16, "predict": 30, "prefer": [15, 16, 26, 28, 30, 44, 48, 59, 65], "prefix": [48, 57], "prepar": [43, 59, 68, 72], "presenc": [11, 57], "present": [4, 7, 9, 11, 15, 18, 29, 31, 34, 37, 48, 57, 62, 64, 65, 66, 67, 69, 72], "preserv": [59, 62], "presum": [43, 65], "pretend": 48, "pretti": [26, 35, 67], "prevent": [10, 11, 15, 42, 65, 68], "preview": 7, "previou": [11, 15, 37, 44, 63, 64, 65, 66], "previous": [9, 18, 23, 30, 41, 65, 68], "previous_v": 11, "primari": [2, 15], "primarili": [2, 15, 23, 39], "primit": [2, 10, 13, 17, 21, 29, 31, 48, 56, 59, 66, 68], "princip": 31, "principl": [2, 10, 68, 72], "print": [16, 48, 59, 69], "prior": [10, 15, 18, 29, 32, 37, 49], "prioriti": [43, 51], "privat": [26, 58, 65, 66], "privileg": 8, "pro": 67, "probabl": [16, 28, 43, 48, 51, 65, 67], "problem": [9, 10, 28, 30, 51, 65], "problemat": [15, 51, 67], "proce": [37, 67, 72], "proceed": 39, "process": [2, 7, 8, 12, 16, 30, 35, 36, 39, 43, 44, 48, 51, 60, 65, 66, 67, 71], "processor": 67, "procida": [0, 73], "produc": [2, 12, 15, 16, 18, 21, 24, 27, 31, 32, 34, 48, 51, 56, 58, 66, 67, 68, 69], "profession": 0, "program": 28, "programat": 15, "programm": [0, 28, 66, 68], "programmat": 16, "progress": [43, 73], "project": [5, 10, 23, 26, 31, 43, 44, 45, 51], "project_nam": 56, "prolifer": 72, "promis": 51, "promot": [4, 43], "prompt": [66, 71], "prone": 65, "proof": 10, "propag": 26, "properli": 48, "properti": [14, 49, 58, 62, 64, 65], "proport": [16, 58], "prospect": [15, 35], "protein": [0, 2, 65, 66], "protocol": 14, "prototyp": [51, 66], "proud": 43, "proven": [0, 2, 7, 8, 13, 17, 18, 32, 51, 62, 64, 67, 71, 73], "provid": [2, 4, 5, 8, 9, 10, 11, 12, 15, 16, 21, 23, 24, 26, 27, 28, 29, 30, 31, 32, 33, 34, 36, 37, 38, 40, 41, 44, 45, 47, 49, 50, 52, 58, 59, 60, 62, 63, 64, 65, 66, 67, 68, 69, 71, 72, 73], "proxi": [48, 67], "pseudomonadota": 72, "public": [4, 9, 11, 21, 40, 41, 48, 50, 51, 55, 65], "publish": [28, 43, 66, 73], "pull": [7, 9, 18, 26, 30, 36], "pull_request": 30, "punctuat": 44, "purpos": [8, 10, 16, 23, 49, 56, 59, 64, 66, 69, 71], "push": [12, 30, 35], "put": [26, 30, 37, 65, 66, 67, 68, 72], "py": [5, 16, 18, 44, 48, 63, 64, 65, 67, 69], "pypi": 44, "pytest": [45, 48], "python": [2, 7, 8, 12, 14, 15, 16, 26, 31, 33, 39, 44, 45, 48, 51, 52, 56, 62, 65, 67, 68, 73], "python3": 66, "q": [23, 67], "q1": 67, "q2": [15, 18, 24, 27, 28, 33, 37, 42, 44, 45, 47, 48, 49, 56, 63, 64, 65, 66, 67, 68, 69, 71, 72], "q2_divers": [27, 31, 32, 34, 44], "q2_dwq2": [64, 65, 66, 67, 68, 69], "q2_feature_t": 48, "q2_type": [18, 31, 66], "q2cli": [2, 15, 45, 48, 65, 69, 73], "q2dev": 45, "q2galaxi": 69, "q2view": 15, "qiim": [0, 2, 4, 5, 7, 9, 11, 12, 13, 15, 16, 17, 18, 21, 25, 27, 28, 29, 30, 31, 32, 34, 35, 38, 39, 40, 42, 46, 48, 49, 50, 51, 52, 55, 56, 57, 58, 59, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72], "qiime2": [2, 5, 7, 9, 11, 12, 14, 15, 16, 18, 21, 23, 26, 30, 31, 34, 36, 37, 44, 45, 47, 48, 49, 51, 52, 54, 55, 56, 57, 58, 59, 60, 62, 63, 64, 65, 66, 67, 68, 69, 71, 72], "qual": 28, "qualiti": [28, 66], "quantit": 43, "queri": [49, 62, 67, 72], "query_seq": 67, "query_sequ": 67, "query_sequences_art": 67, "query_split": 67, "question": [8, 9, 11, 35, 41, 44, 46, 48, 49, 65, 71], "quick": [2, 11, 64, 65], "quickli": [11, 28, 43, 65, 69], "quiet": [28, 66, 71], "quietli": 28, "quit": 44, "quot": 73, "qza": [10, 15, 28, 29, 48, 65, 66, 69], "qzv": [7, 10, 15], "r": [0, 7, 11, 16, 31, 51, 59, 64, 65, 67, 68], "r1": 67, "r2": 67, "r3": 67, "race": 43, "raii": 12, "rais": [11, 16, 21, 39, 56, 57, 59, 62, 65, 72], "ram": [28, 67], "ran": [15, 64, 67, 69], "random": 9, "randomli": 2, "rang": [31, 32, 58, 65, 66, 67], "rank": 56, "rare": 58, "rarefi": [24, 32, 65], "rarefied_t": 32, "rather": [7, 15, 16, 28, 30, 42, 43, 51, 64, 65, 66, 69], "raw": [37, 45, 65], "re": [2, 4, 5, 7, 10, 15, 16, 23, 26, 30, 31, 35, 36, 37, 40, 42, 43, 45, 48, 51, 63, 64, 65, 66, 67, 68, 69, 71, 72, 73], "reach": [29, 41, 43, 46, 48, 51, 65], "read": [2, 8, 9, 11, 16, 23, 26, 29, 30, 33, 51, 62, 63, 64, 65, 66, 67, 69, 70, 73], "read_csv": 56, "read_numb": 11, "readabl": [31, 64, 67], "reader": [8, 23, 35, 66], "readi": [7, 8, 31, 35, 43, 63, 65, 66, 67, 69, 71, 72], "readiab": 0, "readm": [35, 36, 41, 71], "real": [15, 16, 23, 48, 50, 59, 67, 71, 72, 73], "realiti": 51, "realiz": [28, 58], "realli": [7, 12, 14, 69, 72], "reason": [10, 15, 28, 39, 51, 65, 68, 71, 72], "reassign": 66, "recal": [63, 65, 72], "receiv": [8, 16, 32, 51, 56, 58, 65, 67, 72, 73], "recent": [7, 10, 16, 28, 30, 35, 65], "reciev": 65, "recip": [26, 45], "recogn": [16, 26, 58, 66], "recommend": [7, 11, 16, 30, 35, 43, 45, 49, 56, 65, 66, 67, 69, 71], "reconsid": 66, "record": [8, 10, 11, 15, 18, 65, 66, 71, 73], "record_map": 11, "recreat": 15, "recur": 51, "recycl": [7, 67], "redesign": 4, "redirect": 60, "redirected_stdio": 60, "reduc": [15, 31, 41, 51, 65, 67], "redund": 15, "ref": [15, 18, 72], "refactor": [63, 67], "refer": [2, 4, 7, 9, 15, 17, 20, 23, 26, 28, 29, 30, 31, 36, 37, 38, 41, 43, 44, 47, 48, 49, 50, 63, 64, 65, 66, 67, 68, 69, 71, 72], "referenc": [26, 29, 36, 37, 66], "reference_metadata": 72, "reference_seq": [67, 72], "reference_sequ": 67, "reference_sequences_art": 67, "referenti": 9, "reflect": [15, 28, 37], "reformat": 9, "refresh": [48, 64, 65, 66, 68, 72], "refus": 16, "regard": [28, 31, 43], "regardless": [15, 28, 37, 43, 62], "regex": 59, "regist": [2, 8, 10, 11, 15, 16, 18, 24, 26, 27, 28, 40, 42, 49, 50, 51, 53, 56, 57, 63, 72], "register_artifact_class": [56, 65], "register_format": [56, 65], "register_funct": [27, 29, 31, 32, 34, 48, 49, 51, 56, 64, 65, 66, 67, 68, 69], "register_semantic_typ": [16, 56, 65], "register_semantic_type_to_format": 56, "register_transform": [33, 49, 56, 63, 65], "register_valid": 56, "register_view": 56, "registr": [11, 15, 27, 29, 44, 47, 48, 49, 50, 55, 58, 61, 66, 67, 68, 69, 72], "regroup": 49, "regular": [58, 59], "regularli": [30, 36], "reimplement": 48, "reindex": 72, "reinstal": 48, "rel": [15, 26, 30, 36, 51, 52, 59, 62, 65, 66, 67, 72], "relat": [2, 8, 9, 10, 15, 16, 26, 35, 46, 65, 66, 73], "relationship": [16, 28], "releas": [7, 18, 29, 30, 36, 37, 41, 45, 48, 71], "relev": [4, 8, 15, 18, 23, 26, 28, 30, 37, 41, 44, 45, 49, 65, 66, 69, 72], "reli": [30, 37], "reliabl": 15, "relianc": 15, "remain": [15, 16, 18, 23, 30, 35, 67], "rememb": [15, 16, 66, 72], "remind": [37, 69], "remot": [30, 51], "remov": [4, 11, 49, 62, 65, 66, 72], "renam": [2, 26], "render": [7, 36, 48, 49, 59, 69], "reorgan": [26, 65], "repair": 15, "repeat": [2, 9, 16], "repercuss": 51, "repetit": 47, "replac": [41, 43, 56, 60, 64, 66, 69], "replai": [0, 2, 7, 15, 51, 73], "replay": 51, "repo": [30, 35], "report": [66, 67], "repositori": [7, 23, 26, 30, 35, 36, 37, 45, 48, 66], "repr": 64, "repres": [2, 9, 10, 11, 15, 16, 18, 21, 28, 49, 56, 58, 59, 62, 65, 66, 67, 72], "represent": [2, 9, 11, 15, 16, 18, 28, 34, 49, 58, 64, 68], "reproduc": [0, 10, 15, 51], "reproduct": 15, "request": [7, 8, 10, 18, 26, 28, 30, 41, 43, 46, 49, 57, 60, 62, 65, 66, 67, 71], "requir": [7, 8, 11, 15, 16, 26, 27, 29, 30, 32, 34, 35, 39, 44, 45, 47, 48, 51, 53, 58, 62, 64, 65, 66, 67, 68, 69, 71], "research": [15, 23], "reserv": 16, "reset": 57, "reset_index": 72, "resolut": 58, "resolv": [5, 39, 41], "resourc": [7, 12, 26, 36, 46, 58, 67, 68], "respect": [5, 15, 18, 26, 28, 58, 62, 66, 68], "respons": [2, 8, 9, 12, 41, 43, 46, 51, 71], "rest": 9, "restart": 67, "restrict": [8, 26, 43, 45, 49, 62, 72], "result": [2, 7, 8, 9, 15, 18, 21, 23, 28, 29, 31, 32, 34, 39, 43, 48, 49, 51, 56, 57, 58, 62, 63, 64, 65, 66, 67, 68, 69, 71, 72], "result1": 39, "result2": 39, "result_as_str": 57, "resultcollect": [21, 59], "resulttypea": 58, "resulttypeb": 58, "retain": [57, 62], "retract": [51, 66], "retriev": [59, 62, 68], "retrospect": [2, 10, 13, 17], "return": [2, 8, 11, 16, 18, 21, 28, 31, 32, 33, 34, 35, 39, 48, 49, 51, 52, 53, 56, 57, 58, 59, 60, 62, 63, 64, 65, 66, 67, 68, 69], "reus": [10, 21, 41, 67, 72], "revers": [11, 67], "review": [10, 15, 16, 41, 43, 63, 64, 65, 66, 67, 72], "revis": [26, 66], "rewrit": 14, "rfc": 2, "rich": [8, 10, 16, 69], "right": [8, 16, 36, 41, 48, 51, 62, 65, 66, 73], "right_on": 72, "rightli": 68, "risk": 51, "rm": 66, "rna": [2, 65, 66], "robust": [12, 16], "role": 63, "root": [2, 9, 15, 18, 27, 28, 31, 36, 48, 65], "root_uuid": 18, "rough": 8, "roughli": [10, 26, 67], "round": [8, 63, 67], "roundtripp": 62, "row": [58, 62], "rrna": 65, "rstrip": 11, "rule": [10, 15, 16, 29, 58], "run": [2, 7, 11, 15, 18, 26, 28, 30, 35, 39, 41, 43, 45, 46, 48, 51, 57, 63, 64, 65, 66, 68, 69, 72, 73], "runner": 57, "runtest": 57, "runtim": [9, 14, 15, 65, 67], "s1": [48, 58, 66], "s2": [48, 66], "s3": 48, "s42": 59, "s_": 11, "s_l": 11, "sai": [16, 28, 68], "said": [43, 66], "sake": [45, 67], "same": [8, 10, 15, 16, 18, 21, 28, 29, 30, 32, 34, 37, 42, 43, 44, 48, 51, 58, 62, 63, 64, 65, 67, 68, 69, 71, 72], "sampl": [2, 10, 11, 15, 18, 24, 28, 32, 34, 44, 58, 59, 62, 72], "sample_id": [11, 48], "sampledata": [11, 28, 32, 34, 48], "sampling_depth": [15, 32], "sapienn": 47, "satisfi": 16, "saul": 66, "save": [8, 9, 10, 11, 15, 18, 49, 51, 52, 56, 62, 64, 66, 67, 69], "scale": 64, "scene": 63, "schedul": 30, "schema": 9, "scheme": [9, 15, 36, 62], "scholar": 66, "scienc": [2, 23], "scientif": 51, "scientist": [10, 26, 30], "scikit": [64, 65, 66], "scipi": 31, "scope": [15, 21, 26, 48, 69], "score": [59, 66, 67, 72], "scratch": [23, 35], "script": 15, "sdk": [2, 7, 8, 12, 14, 21, 48, 59, 66, 67, 68], "search": [0, 41, 46, 58, 62, 65, 66], "search_and_summarize_pipelin": 67, "searchabl": 49, "searchandsummarizetest": 67, "second": [15, 16, 32, 37, 50, 56, 58, 64, 65, 67, 69, 73], "section": [10, 15, 16, 18, 23, 36, 51, 55, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72], "see": [2, 8, 9, 10, 11, 15, 16, 18, 23, 26, 27, 28, 31, 32, 34, 35, 36, 41, 43, 44, 45, 46, 47, 48, 56, 58, 60, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72], "seek": [10, 12], "seem": [8, 16, 28, 43, 46, 66], "seen": [8, 9, 11, 59, 71], "select": [7, 15, 16, 35, 51], "self": [9, 10, 11, 15, 16, 51, 63, 64, 65, 66, 67, 69], "sell": 43, "semant": [2, 8, 10, 11, 13, 17, 18, 21, 25, 31, 33, 42, 47, 50, 56, 57, 59, 73], "semantic_express": 56, "semantic_typ": [56, 57, 59], "semantictyp": [16, 29, 58, 65], "semat": [11, 65], "send": [26, 67], "sens": [10, 16, 26, 28, 41, 64, 67, 68], "sentenc": 63, "separ": [15, 31, 44, 72], "seper": 16, "sept": 37, "septemb": 0, "seq": [63, 65, 66, 67, 69], "seq1": [63, 65, 66, 68, 69, 72], "seq1_factori": [63, 69], "seq2": [63, 65, 66, 68, 69, 72], "seq2_factori": [63, 69], "seq3": 72, "seq_num": 65, "sequenc": [0, 2, 8, 10, 11, 28, 63, 64, 65, 68, 69, 72], "sequence1": 66, "sequence2": 66, "sequences_path_mak": 11, "sequenceswithqu": 28, "seri": [23, 34, 35, 58, 62, 69], "serial": [9, 62, 65], "seriou": 66, "serv": [9, 12, 23, 48], "server": [7, 43, 51, 64], "session": 66, "set": [7, 8, 9, 11, 16, 18, 26, 29, 30, 31, 40, 41, 43, 49, 50, 56, 57, 58, 59, 62, 64, 65, 66, 67, 68, 69, 71, 72], "set_index": [67, 72], "set_path_mak": 11, "setup": [44, 57, 67], "setupi": 26, "setuptool": [26, 44], "sever": [2, 34, 42, 44, 57, 58, 67, 72], "shannon": 32, "shannon_vector": 32, "shape": 66, "share": [4, 10, 15, 18, 21, 36, 37, 41, 43, 62, 67, 68, 71, 73], "sharp": 16, "sharp_fillet": 16, "sharpen": 16, "shell": 69, "short": [33, 36, 56, 64, 68], "short_descript": [44, 56], "shortcut": 68, "shorthand": 58, "shortli": [66, 73], "shotgun": 2, "should": [8, 10, 11, 12, 15, 16, 21, 23, 26, 28, 30, 31, 32, 34, 35, 36, 37, 41, 43, 44, 45, 46, 48, 49, 51, 56, 58, 59, 62, 64, 65, 66, 68, 69, 71, 72, 73], "shouldn": [11, 26, 28, 65, 66, 72], "show": [14, 16, 18, 43, 48, 66, 71, 72, 73], "shown": [8, 15, 18, 29, 44], "shred": 16, "shutil": 60, "side": [48, 57, 67], "signatur": [14, 21, 31, 34, 59, 65, 66, 67, 68, 72], "signific": [14, 18], "silenc": [66, 71], "silicon": [23, 45], "silli": [16, 65, 71], "silvers1997effect": 56, "similar": [0, 16, 21, 24, 30, 32, 34, 37, 58, 64, 66, 67, 68, 69, 72], "similarli": [23, 28, 65, 66], "simpl": [9, 15, 16, 29, 36, 44, 48, 52, 58, 64, 65, 66, 67, 68, 71, 72], "simpler": [15, 16], "simplest": [11, 67], "simpli": [9, 15, 16, 29, 49, 51, 66, 67], "simplifi": [9, 15, 43, 44, 47, 57, 63, 65, 68], "simultan": [16, 58], "sinc": [16, 26, 28, 34, 42, 46, 51, 56, 63, 64, 65, 66, 67, 72, 73], "singl": [2, 7, 9, 10, 15, 16, 18, 24, 26, 28, 29, 32, 34, 36, 37, 42, 44, 48, 49, 56, 57, 62, 64, 65, 66, 67, 68, 69, 72], "singlednasequ": [28, 63, 65, 68, 69], "singlednasequencetest": 65, "singlednasequencetransformertest": 65, "singlefiledirectoryformat": [11, 54, 56, 65], "singleint": [29, 59], "singlelanepersamplepairedendfastqdirfmt": 18, "singlerecorddnafastadirectoryformat": [63, 65], "singlerecorddnafastaformat": [65, 69], "singlerecorddnafastaformattest": 65, "singleton": [2, 56], "singular": 29, "site": [15, 49, 66, 71], "situat": [9, 11, 16, 56, 59], "size": [15, 66], "skbio": [27, 31, 33, 64, 65, 66, 67, 68, 69], "skd": 14, "skip": [11, 48, 65], "sklearn_n_jobs_descript": 32, "slate": 23, "sleev": 16, "sloan": 23, "slow": [16, 28, 31, 65, 66, 67, 68], "small": [9, 11, 56, 58, 63, 66, 67, 69], "smaller": [16, 58, 67], "smith": [0, 66, 67, 68], "smoke": 48, "sneak": 65, "snif": 11, "so": [7, 10, 11, 15, 16, 18, 24, 26, 28, 29, 30, 31, 33, 34, 35, 42, 43, 44, 48, 49, 51, 56, 57, 58, 59, 63, 64, 65, 66, 67, 68, 69, 71, 72, 73], "softwar": [2, 8, 9, 10, 11, 15, 26, 28, 30, 31, 41, 43, 51, 60, 66, 68, 73], "software_entri": 18, "sole": 62, "solid": 8, "solut": [10, 68], "solv": [10, 28], "some": [2, 4, 8, 9, 10, 11, 14, 15, 16, 18, 23, 24, 26, 28, 31, 32, 34, 35, 37, 41, 42, 43, 44, 47, 48, 49, 51, 56, 59, 63, 64, 65, 66, 67, 68, 69, 71, 72, 73], "some_act": 39, "some_artifact": 59, "some_plugin": 18, "somedai": 16, "someexcept": 39, "someon": [26, 43, 66, 68], "someth": [16, 28, 37, 39, 43, 45, 49, 51, 56, 64, 65, 66, 67, 69, 71, 73], "sometim": [10, 30, 51, 66], "somewher": 51, "soon": [36, 46], "sooner": 30, "sophist": 16, "sorri": 28, "sort": [8, 28, 64, 67, 72], "sort_kei": 16, "sortabl": 49, "soup": 16, "sourc": [2, 7, 15, 18, 21, 27, 31, 32, 34, 36, 42, 45, 51, 52, 53, 54, 56, 57, 58, 59, 60, 62, 66, 73], "source_format": 57, "space": 44, "span": 37, "spars": 7, "spatula": 16, "speak": [51, 55], "spec": 62, "speci": 72, "special": [11, 15, 16, 26, 58, 66, 67], "specif": [2, 5, 7, 8, 10, 15, 16, 18, 23, 26, 30, 31, 35, 36, 37, 40, 44, 45, 48, 49, 56, 62, 65, 66, 67, 69, 71, 72, 73], "specifi": [2, 15, 26, 29, 30, 31, 37, 49, 57, 62, 64, 65, 66, 67], "spend": [43, 64], "split": [23, 28, 39, 48], "split_act": 67, "split_int": 59, "split_siz": 67, "spoon": 16, "spork": 16, "sqlite": 62, "squar": 15, "src": 60, "stabl": 71, "stackoverflow": 44, "stage": [26, 45, 65, 66, 67], "stai": 30, "standalon": 44, "standard": [9, 10, 26, 66], "start": [8, 15, 16, 26, 28, 30, 34, 35, 37, 41, 43, 44, 45, 58, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73], "stat": 64, "state": [7, 8, 10, 12, 68], "statement": [26, 48, 65, 66], "static": [9, 12], "statist": [34, 44], "stderr": [60, 66, 71], "stdin": 16, "stdio": 60, "stdout": [60, 66, 71], "steak": 16, "stem": 66, "step": [7, 8, 10, 15, 23, 26, 35, 36, 37, 39, 40, 44, 50, 57, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72], "still": [2, 5, 10, 16, 23, 28, 29, 36, 37, 46, 63, 64, 66, 67, 70, 71], "stitch": 32, "storag": [8, 65], "store": [9, 11, 13, 17, 18, 26, 28, 30, 56, 57, 58, 59, 62, 64, 65, 66, 67, 68], "stori": 16, "str": [16, 21, 27, 32, 33, 34, 49, 51, 52, 56, 57, 58, 59, 62, 63, 64, 65, 68, 69, 72], "straight": [16, 35, 66, 68, 69], "straightforward": [37, 44], "strategi": [42, 67], "strict": [16, 58], "strictli": [8, 58], "string": [9, 10, 16, 18, 21, 31, 44, 49, 51, 52, 56, 57, 58, 59, 62, 64, 65, 66, 69], "strip": 29, "structur": [2, 9, 10, 12, 15, 16, 18, 25, 28, 30, 31, 37, 50, 58, 69, 71], "struggl": 65, "stuck": [64, 65, 68], "studi": [11, 15, 49, 62], "stuff": [15, 26], "style": 64, "sub": [2, 8, 32, 46, 65], "subclass": [2, 18, 48, 52, 56, 57, 62, 65, 69], "subcommand": 42, "subdir": 45, "subdirectori": [9, 10, 15, 65], "subject": 49, "submit": [7, 26, 36, 43, 58], "submodul": [21, 26, 66], "suboptim": 65, "subsequ": [0, 15, 24, 31, 49, 58, 66, 67, 68], "subset": [11, 58, 67], "substanti": 73, "substitut": 16, "substr": 64, "subsystem": 45, "subtyp": [2, 58], "succeed": 65, "success": [8, 30, 35, 65, 66, 71], "successfulli": [28, 48, 69, 71], "suffer": 31, "suffic": [16, 64], "suffici": [58, 73], "suggest": [5, 16, 30, 37, 43, 56, 67, 71], "suit": [16, 47, 67, 69], "suitabl": 45, "sum": [48, 65], "summar": [64, 68, 69], "summari": [2, 34, 64, 65, 67, 68], "summarize_align": [64, 68], "summarize_alignment_act": 68, "summarizealignmenttest": 64, "sun": 30, "sup": 2, "super": [56, 67], "supersed": 18, "supertyp": 16, "suppli": [56, 62], "support": [2, 4, 7, 9, 10, 11, 15, 18, 23, 30, 35, 36, 39, 40, 41, 43, 44, 45, 48, 49, 50, 51, 56, 58, 60, 62, 65, 66, 68, 69, 73], "suppos": [16, 64, 66], "sure": [28, 30, 35, 41, 45, 48, 63, 65, 71], "surround": 8, "sw": 66, "swap": [14, 16], "sweet": 64, "switch": 7, "sy": [12, 15, 60], "symbol": [30, 37], "symmetr": 65, "sync": [30, 72], "synchron": 12, "synonym": [10, 16, 28], "syntax": [16, 21, 29, 31, 58, 66], "system": [2, 10, 15, 16, 18, 26, 28, 29, 31, 36, 44, 45, 51, 58, 68], "t": [0, 2, 4, 7, 9, 10, 11, 15, 16, 18, 26, 28, 30, 31, 33, 35, 36, 37, 39, 41, 43, 45, 46, 47, 48, 51, 57, 58, 59, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72], "t_in": 58, "t_out": 58, "t_parama": 58, "t_paramb": 58, "taacacccac": [64, 66], "tab": [15, 30, 64, 71, 72], "tabl": [15, 24, 26, 27, 28, 31, 32, 34, 37, 48, 49, 51, 57, 58, 60, 62, 65, 66, 67, 71, 72], "tabul": [49, 67, 72], "tabular": [58, 62, 67], "tabularmsa": [64, 65, 66, 68], "tabulate_las_result": 67, "tabulate_las_results_act": 72, "tag": [15, 18, 44], "take": [18, 27, 28, 30, 31, 32, 34, 41, 42, 43, 46, 56, 59, 62, 63, 64, 65, 66, 68, 69, 72], "taken": 59, "talk": [16, 26], "tar": 9, "target": [23, 30, 35, 36, 37, 40, 41, 43, 57, 69, 71, 73], "task": [8, 16, 40, 64, 73], "taxa": 42, "taxonom": [67, 72], "taxonomi": [51, 66, 72], "team": [15, 23, 45], "tear": 16, "teardown": 57, "tech": 46, "technic": [4, 15, 40, 43, 44, 50, 64, 66, 68], "technologi": 23, "tediou": 65, "tell": [15, 43, 44, 65, 66], "temp_dir": [11, 64], "tempfil": 69, "templat": [7, 23, 26, 41, 50, 59, 64, 70, 73], "temporari": [26, 57, 66], "temptat": 73, "ten": 15, "tend": [43, 56, 63, 67, 69], "term": [2, 10, 15, 24, 28, 30, 37, 62, 65, 66, 69], "termin": [15, 24, 34, 45, 58, 72], "test": [16, 23, 35, 40, 43, 44, 45, 46, 50, 51, 55, 58, 59, 61, 70, 73], "test_alt_gap_extend_penalti": 66, "test_alt_gap_open_penalti": 66, "test_alt_match_scor": 66, "test_alt_mismatch_scor": 66, "test_dir_prefix": 57, "test_dna_to_single_record_fasta_simple1": 63, "test_dna_to_single_record_fasta_simple2": 63, "test_exampl": 69, "test_invalid_default_valid": 65, "test_invalid_max_valid": 65, "test_invalid_min_valid": 65, "test_method": [65, 66, 67], "test_pipelin": 67, "test_semantic_type_registr": 65, "test_simple1": [64, 65, 66, 67], "test_simple1_parallel": 67, "test_simple1_seri": 67, "test_simple2": [65, 66], "test_single_record_fasta_to_dna_simple1": 65, "test_single_record_fasta_to_dna_simple2": 65, "test_transform": [63, 65], "test_types_and_format": 65, "test_visu": 64, "testcas": 57, "testpluginbas": [47, 48, 57, 64, 65, 66, 67, 69], "text": [8, 9, 10, 15, 26, 30, 32, 34, 44, 51, 58, 59, 62, 63, 64, 66, 68, 69, 71, 72], "textfileformat": [2, 11, 51, 54, 56, 65], "textual": 34, "than": [7, 8, 11, 15, 16, 28, 29, 30, 45, 48, 49, 51, 58, 60, 62, 63, 64, 65, 66, 67, 68, 69, 71], "thank": [23, 70], "thei": [2, 8, 10, 11, 15, 16, 18, 26, 27, 28, 29, 33, 35, 36, 37, 41, 43, 46, 49, 51, 56, 58, 59, 60, 63, 64, 65, 66, 67, 68, 69], "them": [7, 8, 10, 12, 15, 16, 18, 23, 26, 29, 30, 31, 35, 37, 39, 41, 48, 51, 52, 63, 64, 65, 66, 67, 68, 69, 72, 73], "theme": 2, "themselv": [8, 15, 48, 66, 67], "theoret": 15, "theori": 67, "therefor": [2, 9, 15, 26, 37, 62, 65, 66, 67, 69], "therein": 30, "thereof": 59, "thermophili": 65, "thi": [2, 4, 5, 7, 8, 9, 10, 11, 12, 14, 15, 16, 17, 18, 21, 24, 26, 27, 28, 29, 30, 31, 32, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 51, 52, 53, 55, 56, 57, 58, 59, 60, 62, 63, 64, 65, 67, 68, 69, 70, 71, 72, 73], "thing": [7, 11, 15, 16, 26, 28, 30, 36, 43, 48, 51, 56, 59, 64, 65, 66, 67, 68, 69, 72], "think": [12, 16, 28, 49, 63, 65, 66], "third": [28, 67], "thoma": [0, 2], "thorough": 23, "those": [11, 15, 23, 27, 34, 35, 37, 40, 41, 48, 49, 51, 58, 62, 63, 65, 66, 67, 68, 69, 71, 72], "though": [8, 10, 16, 18, 23, 28, 31, 39, 43, 45, 64, 65, 69, 71], "thought": 58, "thread": [39, 58, 68], "three": [8, 11, 15, 24, 28, 48, 59, 65, 66], "three_tabl": 48, "through": [2, 11, 15, 23, 26, 28, 29, 30, 34, 35, 37, 41, 44, 45, 46, 48, 51, 64, 65, 66, 67, 68, 69, 71, 72, 73], "throughout": [23, 66], "throw": 72, "thu": [24, 34, 62], "ti": 46, "tie": 12, "time": [7, 8, 9, 10, 15, 18, 26, 27, 28, 29, 30, 37, 41, 42, 43, 45, 49, 51, 56, 59, 63, 64, 65, 66, 68, 69, 73], "timestamp": 15, "tini": [41, 67], "tip": [35, 67], "titl": [15, 56, 64, 66, 72], "tl": 2, "to_ast": [16, 21], "to_datafram": [49, 62, 72], "to_html": 72, "to_import": 59, "to_list": 72, "to_seri": 62, "to_typ": [57, 59, 60, 66], "togeth": [2, 9, 11, 16, 18, 30, 32, 65, 67, 68], "toggl": 68, "toi": [30, 67], "told": 28, "toler": 42, "too": [2, 11, 15, 49, 51, 65], "tool": [0, 2, 4, 10, 15, 18, 26, 28, 40, 41, 42, 46, 50, 65, 66, 67, 68, 69], "top": [8, 15, 26, 30, 35, 36, 64, 65, 66, 67, 68, 69, 71], "topic": [7, 23, 38, 43, 66], "total": [32, 41, 60], "touch": [15, 66], "toward": [65, 69], "traceback": 16, "track": [9, 10, 13, 17, 18, 51, 52, 53, 62], "tracker": [44, 46, 70], "trade": 65, "train": 30, "trait": 18, "tranch": 73, "tranform": 57, "transfer": 16, "transform": [2, 15, 18, 25, 40, 42, 47, 49, 50, 56, 57, 59, 60, 66, 67, 68, 73], "transform_format": [57, 65], "transit": [7, 28, 65], "translat": [8, 69], "transpar": 15, "travers": 15, "treat": [26, 28, 58, 62], "treatment": [62, 66], "tree": [9, 21, 26, 28, 65], "treenod": 27, "tri": [39, 51, 65], "trick": 16, "tricker": 64, "trigger": 30, "trip": 63, "trivial": [58, 63], "troubleshoot": [30, 37, 41], "true": [16, 21, 57, 58, 59, 62, 66, 67, 72], "truli": 43, "trust": [10, 65, 66], "try": [11, 16, 39, 43, 46, 58, 59, 63, 64, 65, 67, 68, 69, 71, 72], "tsv": [11, 15, 34, 48, 59, 62, 72], "tt": 66, "ttt": 66, "tupl": [21, 31, 32, 56, 58, 62, 68], "ture": 16, "turn": [8, 29, 66, 69], "tutori": [7, 23, 26, 35, 39, 40, 43, 45, 49, 50, 62, 65, 68, 70, 71], "twice": 9, "two": [0, 8, 11, 15, 16, 28, 30, 33, 34, 37, 42, 48, 49, 51, 58, 59, 63, 65, 66, 67, 68, 69, 71, 72], "tx": 63, "txt": [7, 51, 59], "type": [2, 5, 8, 9, 13, 15, 17, 18, 21, 25, 27, 29, 31, 32, 33, 34, 41, 42, 45, 47, 48, 49, 50, 51, 52, 53, 55, 56, 57, 59, 60, 61, 62, 63, 64, 66, 67, 68, 69, 72, 73], "type_frag": 56, "type_from_ast": 21, "typeerror": [11, 16, 21, 59], "typeexpress": 21, "typemap": 58, "typematch": 58, "typevarexp": 58, "typic": [2, 11, 26, 27, 28, 30, 35, 42, 49, 58, 59, 65, 66, 67, 68], "u": [15, 16, 23, 26, 29, 36, 37, 41, 43, 48, 51, 63, 64, 65, 66, 67, 68, 69], "ubiquit": [9, 67], "ubuntu": 45, "ui": [8, 16], "ultim": [16, 26, 41, 43, 46, 69, 71, 73], "ultipl": 66, "uml": 8, "unabl": [5, 16], "unadorn": 16, "unambigu": [51, 65, 68], "unbound": 58, "uncommon": [15, 51], "under": [18, 23, 26, 30, 37, 43, 45, 46, 51, 59, 63, 66, 67, 69], "underli": [11, 16, 32, 33, 48, 60, 64, 66, 67, 68], "underscor": [26, 44, 48], "understand": [8, 10, 12, 15, 16, 23, 28, 30, 63, 66], "understood": 9, "unexpect": 68, "unfamilar": 16, "unfortun": [30, 43], "unicod": [16, 58], "unifi": 49, "unimport": 56, "uninitializedpluginmanagererror": [21, 59], "uninterest": 16, "union": [56, 58], "uniqu": [2, 9, 32, 42, 43, 48, 49, 58, 62, 65], "unit": [2, 26, 30, 43, 44, 48, 67, 68, 69, 70, 71], "unitl": 38, "unittest": [48, 57], "univers": [2, 28, 63], "unix": 2, "unkown": 12, "unless": [16, 18, 32, 44, 45, 58, 71], "unlik": [11, 15, 16, 23, 44, 56, 60, 65, 68, 72], "unnecessari": [65, 67, 72], "unnecessarili": 48, "unpack": [48, 58, 59], "unrecognizedformaterror": 65, "unrel": 16, "unreli": 51, "unroot": [28, 65], "unshred": 16, "unspecifi": [66, 71], "until": [7, 16, 28, 64, 66, 67, 68, 69], "unus": 66, "unusu": 66, "unweighted_unifrac_emperor": 15, "unzip": [10, 15], "up": [9, 12, 16, 18, 26, 29, 30, 36, 40, 46, 48, 49, 50, 57, 63, 64, 65, 67, 68, 72], "upcom": 30, "upda": 48, "updat": [9, 10, 15, 16, 23, 30, 35, 43, 45, 69], "upfront": 51, "upload": 51, "upon": [8, 35], "uppercas": 44, "upstream": [30, 67, 72], "url": [0, 23, 36, 37, 44, 56, 59], "us": [2, 4, 7, 8, 9, 10, 11, 12, 14, 15, 16, 18, 21, 23, 24, 26, 28, 31, 32, 33, 34, 35, 36, 40, 41, 42, 43, 44, 45, 47, 48, 50, 51, 53, 55, 56, 57, 58, 59, 60, 62, 63, 64, 66, 68, 69, 71, 72, 73], "usabl": 30, "usag": [2, 7, 28, 40, 50, 55, 56, 57, 61, 63, 66, 67, 68, 70, 71, 73], "usage_vari": 59, "usageact": [48, 59, 69], "usagedriv": 69, "usageexampletest": 69, "usageinput": [48, 59, 69], "usageoutput": [48, 59], "usageoutputnam": [48, 59, 69], "usagevari": [48, 59], "user": [2, 4, 6, 8, 10, 12, 15, 16, 18, 21, 23, 26, 28, 30, 31, 33, 34, 35, 36, 40, 41, 42, 43, 44, 45, 48, 49, 50, 51, 52, 55, 56, 58, 61, 63, 64, 65, 66, 67, 68, 69, 71, 72, 73], "user_support_text": [44, 56], "usual": [7, 8, 16, 30, 37, 44, 51, 56, 58, 59], "utensil": 16, "utf": 64, "util": [10, 14, 15, 30, 37, 49, 50, 55, 57, 59, 61, 65, 66, 67], "utlit": 49, "uuid": [2, 9, 15, 18, 51, 71], "v": [0, 30, 56, 62], "v0": 18, "v1": [11, 18], "v2": 18, "v4": [15, 18], "v5": 18, "val": [11, 48], "valid": [2, 8, 15, 16, 29, 40, 49, 50, 56, 57, 58, 59, 62, 65, 66, 69], "validate_someth": 56, "validation_level_to_n_char": 65, "validation_seq": 65, "validation_seq_len": 65, "validationerror": [11, 21, 54, 56, 65], "vallei": 23, "valu": [2, 11, 15, 16, 21, 29, 30, 31, 32, 34, 36, 37, 39, 44, 45, 48, 49, 51, 52, 58, 59, 62, 64, 66, 67, 68, 69, 71], "valuabl": 15, "valueerror": [11, 57, 62, 65], "vaniti": 59, "var": 45, "var_typ": 59, "varfield": 16, "vari": [31, 44, 51, 65], "variabl": [16, 18, 21, 26, 56, 58, 59, 64, 66, 67, 68, 69], "variad": 18, "variadic_input_simpl": 48, "varianc": 62, "variant": [16, 28, 56, 58], "variant1": 56, "variant2": 56, "variant_of": [16, 58], "variantfield": 58, "variat": 66, "varieti": 9, "variou": [15, 16, 17, 23, 62], "varriabl": 66, "vastli": 7, "ve": [16, 30, 31, 35, 40, 43, 48, 65, 66, 67, 68, 71, 72], "vector": [32, 34, 48], "verb": [2, 42], "verbos": [66, 71], "veri": [8, 9, 11, 16, 23, 28, 29, 30, 31, 32, 34, 43, 44, 56, 64, 65, 66, 67, 68, 69], "verif": 49, "verifi": [33, 64], "version": [2, 7, 8, 9, 10, 15, 17, 19, 30, 37, 43, 44, 48, 51, 56, 65, 66, 71, 72], "versu": 68, "vertic": 8, "via": [2, 5, 8, 31, 35, 36, 44, 48, 49, 52, 56, 57, 63, 67], "video": 28, "view": [2, 7, 10, 12, 15, 26, 28, 29, 32, 49, 51, 53, 56, 57, 58, 59, 63, 64, 65, 66, 67, 69, 71], "view_as_metadata": 59, "view_typ": [32, 53, 59, 63, 67], "viewer": [15, 64, 72], "viewport": 64, "violat": 68, "virtu": 16, "virtual": 15, "visibl": [15, 43], "visit": [45, 56], "visual": [2, 9, 10, 13, 15, 17, 18, 21, 24, 31, 32, 40, 44, 50, 56, 65, 66, 67, 68, 69, 70, 72, 73], "viusal": 64, "vizual": 64, "vm": 15, "vocabulari": [16, 62], "volatil": 49, "volum": 66, "w": [0, 23, 51, 54, 64, 72], "wa": [2, 9, 10, 11, 15, 16, 18, 23, 26, 28, 30, 31, 34, 35, 45, 48, 51, 56, 62, 63, 65, 66, 67, 68, 72], "wai": [4, 7, 10, 11, 12, 15, 16, 21, 26, 28, 29, 30, 35, 36, 37, 41, 43, 45, 48, 51, 58, 59, 62, 64, 65, 66, 67, 68, 69, 70, 71], "wait": [8, 39, 67], "walk": [35, 51, 59, 73], "want": [15, 16, 23, 26, 28, 29, 34, 35, 37, 39, 41, 42, 43, 45, 48, 49, 64, 65, 66, 67, 68, 69, 71, 72, 73], "warn": [12, 29, 65, 66, 68, 69], "wast": 28, "watch": 11, "waterman": [0, 66, 67, 68], "we": [4, 5, 7, 8, 9, 10, 11, 12, 15, 16, 18, 23, 26, 27, 28, 29, 30, 31, 32, 35, 36, 37, 39, 41, 42, 43, 45, 46, 48, 49, 51, 56, 63, 64, 65, 66, 67, 68, 69, 71, 72], "web": [2, 7, 15, 35, 51], "websit": [9, 15, 18, 43, 44, 56, 66], "wednesdai": 30, "weekend": 28, "weird": 51, "welcom": 5, "well": [2, 7, 9, 10, 11, 15, 16, 28, 30, 41, 42, 43, 49, 62, 63, 64, 65, 66, 73], "went": [28, 64], "were": [2, 9, 15, 16, 18, 39, 51, 56, 58, 64, 65, 67, 69, 71, 72], "weren": 65, "weslei": 0, "what": [2, 8, 9, 10, 16, 26, 28, 30, 31, 33, 35, 36, 37, 43, 48, 51, 56, 58, 59, 63, 64, 65, 67, 68, 69, 71, 72], "whatev": [8, 15, 26, 29, 34, 64, 65, 71], "whatsoev": 65, "when": [2, 7, 8, 9, 10, 11, 12, 15, 16, 18, 21, 26, 27, 28, 29, 30, 34, 36, 39, 41, 42, 43, 44, 48, 49, 51, 56, 57, 58, 60, 62, 63, 64, 65, 66, 67, 68, 69, 71, 72, 73], "whenev": [15, 18, 41, 56, 58], "where": [2, 7, 8, 9, 10, 15, 16, 23, 26, 29, 30, 31, 35, 43, 44, 46, 47, 51, 56, 58, 62, 63, 64, 65, 66, 67, 68, 69, 72], "where_values_miss": 62, "wherev": [5, 16], "whether": [16, 28, 56, 58, 62, 65, 66, 68, 71], "which": [2, 7, 8, 9, 10, 11, 12, 14, 15, 16, 18, 23, 26, 27, 28, 29, 31, 32, 35, 37, 43, 44, 45, 48, 49, 51, 56, 58, 59, 62, 64, 65, 66, 67, 68, 69, 71, 72, 73], "whichev": 41, "while": [2, 5, 9, 10, 11, 15, 16, 28, 30, 37, 41, 43, 44, 57, 64, 66, 68, 69, 73], "who": [15, 23, 41, 45, 51, 65, 69, 73], "whole": [18, 41, 51, 66, 67], "whose": [8, 15, 18, 26, 48], "why": [7, 10, 16, 51, 68, 69], "wide": [10, 44], "widespread": 2, "width": 64, "wikipedia": [2, 51], "wild": 18, "window": 45, "winzip": 10, "wise": 58, "wish": [37, 48, 65], "witcombe2006sword": 56, "within": [2, 7, 8, 9, 11, 15, 16, 18, 21, 27, 29, 30, 37, 42, 44, 46, 48, 49, 58, 59, 62, 68], "without": [2, 9, 10, 15, 16, 26, 28, 29, 56, 58, 64, 65, 66, 67, 73], "won": [15, 36, 46, 51, 64, 65, 66, 67, 71], "wonder": 48, "wood": 0, "word": [2, 10, 15, 16, 26, 43, 66], "work": [2, 3, 4, 7, 8, 10, 11, 15, 16, 23, 27, 28, 29, 30, 35, 36, 37, 41, 42, 43, 44, 45, 48, 49, 51, 57, 58, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73], "workaround": 66, "workflow": [26, 30, 51, 67, 68, 72, 73], "workflow_dispatch": 30, "working_set": 15, "workspac": 16, "world": [16, 58, 73], "worri": [10, 16, 48], "wors": 28, "worst": 67, "worth": [43, 51, 66, 73], "would": [2, 9, 10, 12, 15, 16, 23, 28, 29, 30, 34, 35, 37, 40, 43, 44, 48, 51, 56, 58, 59, 62, 64, 66, 68, 69, 72], "wouldn": [16, 51, 66, 67], "wrap": [15, 31, 32, 42, 72], "wrapper": [29, 59], "write": [2, 4, 7, 8, 11, 16, 18, 23, 28, 33, 34, 35, 40, 44, 50, 63, 65, 67, 68, 70, 71, 72, 73], "write_csv": 56, "written": [18, 29, 34, 36, 42, 44, 51, 62, 64, 65, 69], "wrong": [15, 28, 64, 65, 72], "wrote": [48, 63, 64, 65, 67, 68, 72], "wsl": 45, "wunsch": [0, 66, 68], "x": 58, "x86_64": 15, "xopen": 15, "y": [51, 58, 68], "yaml": [10, 18, 26, 30, 35, 36, 45], "year": [10, 43, 66], "yet": [9, 10, 16, 29, 30, 48, 56, 65, 66, 67], "yield": 67, "yml": [26, 30, 36, 37, 45], "you": [4, 5, 7, 9, 10, 12, 15, 16, 21, 23, 26, 27, 28, 29, 30, 31, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 51, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73], "your": [0, 4, 7, 16, 26, 28, 29, 31, 34, 39, 40, 42, 48, 49, 50, 51, 56, 58, 63, 65, 66, 67, 68, 70, 72], "yourself": [2, 23, 29, 44, 49, 51, 67, 72], "zero": [2, 16, 58, 62, 66], "zip": [10, 15, 16, 48], "zipfil": 9, "zipp": 15, "zuckerberg": 23}, "titles": ["List of works cited", "Index", "Glossary", "Back matter", "Distribution Development", "Developer documentation", "Docs Development", "User documentation", "QIIME 2 architecture overview", "Anatomy of an Archive", "How Data is Stored", "File Formats and Directory Formats", "Garbage Collection", "Explanations", "Metaprogramming", "Decentralized retrospective provenance tracking", "Semantic Types, Primitives, and Visualizations", "Framework Development", "Archive versions", "References", "Interface Development", "Interface developer API reference", "References", "Developing with QIIME 2", "Types of QIIME 2 Actions", "Explanations", "The structure of QIIME 2 plugin packages", "Transformers", "Semantic types, data types, file formats, and artifact classes", "Use Artifact Collections as Action inputs or outputs", "Automate testing of your plugin", "Create and register a Method", "Create and register a pipeline", "Creating and registering a Transformer", "Create and register a visualizer", "Distribute plugins on GitHub", "Distribute plugins on QIIME 2 Library", "Facilitating installation of your plugin for users", "Defining different Format validation levels", "Handling exceptions in parallel Pipelines", "How-To Guides", "Maximize compatibility between your plugin(s) and existing QIIME 2 distribution(s)", "How to play nicely with other plugins", "Publicize your QIIME 2 plugins (or other QIIME 2-based tools)", "Register a QIIME 2 plugin", "Set up your development environment", "Provide technical support for your users", "How to test QIIME 2 plugins", "Writing Usage Examples", "How to use Metadata", "Plugin Development", "Plugin development anti-patterns", "Citations", "Pipeline Context Object", "Formats", "Plugin Development API", "Plugin & Registration", "Testing", "Types", "Usage Examples", "Utilities", "References", "User Metadata API", "Add a second transformer", "Add a first Visualizer", "Add a new Artifact Class", "Add a first (real) Method", "Add a Pipeline with parallel computing support", "Add a first Pipeline", "Add a Usage Example", "Conclusion", "Create your plugin from a template", "Integrate metadata in Actions", "Tutorial: A step-by-step guide to building your first QIIME 2 plugin"], "titleterms": {"": 41, "0": 18, "1": 18, "2": [8, 10, 18, 23, 24, 26, 36, 37, 41, 43, 44, 45, 47, 73], "3": [18, 66, 69], "4": 18, "5": 18, "6": 18, "7": 18, "A": [8, 49, 66, 73], "In": 9, "The": [9, 15, 21, 26, 29, 62, 72], "To": 40, "__init__": 26, "_method": 26, "_pipelin": 68, "_version": 26, "access": 10, "acknowledg": 23, "action": [15, 21, 24, 29, 30, 56, 59, 64, 66, 68, 72], "activ": 45, "add": [63, 64, 65, 66, 67, 68, 69, 72], "addit": [36, 55, 66], "advanc": 49, "agnost": 18, "align": [65, 66, 67, 69], "amplicon": 45, "an": [9, 16, 29, 37, 44, 64, 65, 66, 68, 72], "analogi": 16, "anatomi": 9, "ani": 37, "annot": 59, "anti": 51, "api": [21, 29, 49, 55, 62, 66, 69], "appli": 67, "ar": 27, "architectur": 8, "archiv": [9, 18], "artifact": [28, 29, 49, 65], "assert": 59, "associ": 11, "autom": [30, 69], "avoid": 68, "awai": 15, "back": 3, "base": 43, "basic": 58, "befor": 36, "between": 41, "bib": 26, "binari": 11, "block": 15, "build": [45, 73], "call": 66, "can": [48, 49], "captur": 15, "categor": 49, "cfg": 26, "check": 10, "choic": 16, "ci": [26, 30], "citat": [26, 52, 66], "cite": 0, "class": [28, 62, 65], "cli": 29, "collect": [12, 29, 58, 59], "column": [49, 62], "combin": 67, "command": [8, 29, 69], "comment": 48, "commun": 43, "compar": 67, "compat": 41, "compon": 8, "comput": 67, "conclus": 70, "conda": 45, "configur": 30, "content": [23, 73], "context": [48, 53], "continu": 30, "contribut": [7, 23, 43, 45], "cookiecutt": 71, "creat": [31, 32, 33, 34, 67, 68, 71], "current": 7, "custom": 37, "data": [9, 10, 15, 26, 28, 48, 69], "decentr": 15, "defin": [16, 38, 44, 48, 63, 65, 66, 67, 69], "depend": 58, "detail": 8, "develop": [4, 5, 6, 16, 17, 20, 21, 23, 45, 50, 51, 55, 65], "diagram": 8, "differ": 38, "directori": [11, 65], "discov": 65, "displai": 69, "distribut": [4, 35, 36, 37, 41, 45], "dna": 63, "doc": 6, "docstr": 5, "document": [5, 7, 68], "dr": [63, 64, 65, 66, 67, 68, 69, 72], "drop": 49, "duplic": 68, "dure": 71, "dwq2": 26, "each": 67, "empti": 49, "entri": 44, "environ": [15, 23, 45], "exampl": [15, 47, 48, 59, 69, 72], "except": [21, 39, 62], "execut": 15, "exercis": [64, 65, 66, 68, 69], "exist": [37, 41, 45], "expand": 35, "explan": [13, 25], "extend": 16, "extens": 10, "facilit": 37, "factori": 48, "feedback": 41, "few": 66, "file": [9, 11, 15, 28, 49, 65], "filepath": 51, "filter": 49, "find": 5, "first": [45, 64, 66, 68, 73], "fix": 11, "flowchart": 67, "follow": 8, "format": [11, 18, 28, 38, 51, 54, 65], "forum": 43, "framework": 17, "free": 49, "from": [49, 63, 71], "function": [21, 31, 32, 34, 64, 66], "fund": 23, "garbag": 12, "gener": [49, 60], "get": [23, 41], "gha": 30, "git": [26, 71], "github": [26, 30, 35], "gitignor": 26, "glossari": 2, "goal": 10, "goe": 9, "guarante": 18, "guid": [40, 73], "handl": 39, "help": [23, 43, 49], "hint": 68, "how": [10, 27, 40, 42, 43, 47, 49], "i": [10, 15], "id": 15, "identifi": 9, "import": [9, 59, 65], "index": 1, "individu": 55, "inform": 68, "init": 29, "initi": [59, 71], "input": [10, 21, 29, 51, 67, 69, 72], "instal": [35, 37, 45, 71], "instanti": 44, "instruct": 35, "integr": [30, 72], "interfac": [16, 20, 21, 29, 69], "interoper": 10, "intersect": 16, "latest": 45, "layout": 11, "level": 38, "librari": [36, 43], "licens": [23, 26], "line": [29, 69], "list": [0, 55], "load": 29, "local": 67, "make": [49, 65], "makefil": 26, "manifest": 26, "matter": 3, "maxim": 41, "md": 26, "me": 49, "merg": 49, "metadata": [9, 10, 49, 58, 59, 62, 72], "metagenom": 45, "metaprogram": 14, "method": [31, 66, 67], "most": 9, "need": 71, "new": [63, 65, 66, 71], "next": 45, "nice": 42, "normal": 49, "note": 16, "number": 67, "numer": 49, "nw": [65, 69], "nw_align": 68, "object": [21, 28, 29, 44, 53, 55, 59], "option": [64, 65, 66, 68, 69, 71, 72], "other": [42, 43, 45], "our": [66, 67], "out": 48, "output": [21, 29, 49, 51], "overview": [8, 44], "packag": 26, "pairwis": 66, "parallel": [39, 67], "paramet": [51, 59], "pattern": 51, "pipelin": [15, 32, 39, 53, 67, 68], "plai": 42, "plan": 7, "plugin": [26, 27, 30, 35, 36, 37, 41, 42, 43, 44, 45, 47, 50, 51, 55, 56, 60, 64, 66, 71, 73], "plugin_setup": [26, 66, 72], "pluginmanag": 21, "point": 44, "post": 43, "pre": 43, "predic": 58, "prerequisit": 45, "primit": [16, 58], "print": 43, "properti": 16, "proven": [9, 10, 15], "provid": [46, 48, 51], "public": 43, "publicli": 65, "put": 28, "py": [26, 66, 68, 72], "python": [29, 64, 66, 69], "q2": 26, "q2_dwq2": [26, 63], "q2cli": 66, "qiim": [8, 10, 23, 24, 26, 36, 37, 41, 43, 44, 45, 47, 62, 73], "rang": 16, "readm": 26, "real": 66, "recommend": 37, "refactor": 7, "refer": [19, 21, 22, 61], "refin": 16, "regist": [29, 31, 32, 33, 34, 44, 48, 64, 65, 66, 67, 68, 69], "registr": 56, "repositori": 71, "request": 36, "requir": [36, 37], "result": 59, "resultcollect": 29, "resumpt": 67, "retrospect": 15, "return": 29, "rule": 9, "run": [67, 71], "save": 29, "search": [67, 72], "search_and_summar": 67, "second": [63, 66], "semant": [16, 28, 58, 65], "sequenc": [66, 67], "serial": 67, "set": [23, 45], "setup": 26, "share": 35, "should": 67, "singl": 11, "singlerecorddnafastaformat": 63, "size": 67, "skbio": 63, "skip": 51, "sourc": 5, "split": 67, "split_sequ": 67, "splitter": 67, "sql": 49, "statu": 23, "step": [45, 73], "storag": 10, "store": 10, "structur": 26, "subtyp": 16, "summar": [67, 72], "summari": 8, "support": [46, 67], "tabl": 73, "tabulate_las_result": 72, "take": [15, 29, 67], "technic": 46, "templat": [35, 71], "test": [26, 30, 47, 48, 57, 63, 64, 65, 66, 67, 68, 69, 71, 72], "test_method": 26, "text": 11, "them": 43, "thi": [23, 66], "through": 8, "time": 67, "tini": [37, 45], "tl": [63, 64, 65, 66, 67, 68, 69, 72], "togeth": 28, "tool": [43, 71], "top": 37, "topic": 55, "track": 15, "transfer": 10, "transfom": 63, "transform": [27, 33, 63, 65], "try": [48, 66], "tsv": 49, "tutori": [69, 73], "type": [10, 11, 16, 24, 28, 58, 65], "understand": 43, "union": 16, "uniqu": 15, "unit": [63, 64, 65, 66, 72], "up": [23, 45, 66], "updat": [65, 67, 68, 72], "us": [27, 29, 30, 37, 49, 65, 67], "usag": [48, 59, 69, 72], "user": [7, 37, 46, 62], "util": [21, 60], "valid": [10, 11, 38, 51], "variabl": 11, "version": [18, 26, 45], "versu": 67, "viewabl": 49, "visual": [16, 34, 49, 58, 64], "weekli": 30, "what": [15, 66], "why": [9, 15], "work": 0, "wrap": 66, "wrapper": 66, "write": [48, 64, 66, 69], "yaml": [9, 15], "your": [23, 30, 35, 36, 37, 41, 43, 44, 45, 46, 64, 69, 71, 73], "zip": 9}}) \ No newline at end of file