Developing with QIIME 2 is being authored by Greg Caporaso and Evan Bolyen.
-This book will migrate to https://dev.qiime2.org shortly - until that time, URLs may not be stable.
Contributions from others are welcomed and acknowledged via the project’s GitHub contributors page in Acknowledgements. At the moment, while we’re still laying the groundwork, we’re accepting only specific contributions.
If you have suggestions or feedback we’d love to hear from you.
diff --git a/intro.html b/intro.html index ea1d4ad..7d2051e 100644 --- a/intro.html +++ b/intro.html @@ -434,11 +434,13 @@Development status of this content
-Developing with QIIME 2 remains in very active development between March and April of 2024. +
Developing with QIIME 2 remains in very active development, and as a result some URLs may change. It should be getting more complete by the day. 🚀
-As of 13 March 2024, most of the content from the old QIIME 2 Developer Documentation has been transitioned to Developing with QIIME 2. -This book will migrate to https://dev.qiime2.org shortly - until that time, URLs may not be stable.
-The Tutorial: A step-by-step guide to building your first QIIME 2 plugin chapter is where the focus is at the moment, and it’ll stay there for the near future, though all of the Plugin Development chapters have useful and up-to-date content in them. +
The canonical URL for this project is now https://develop.qiime2.org.
+The “old developer documentation”, which was previously hosted at https://dev.qiime2.org is now deprecated.
+All content that is still relevant has been ported from that documentation to Developing with QIIME 2.
+If you do want to access that archival content, you can find it in the project’s GitHub repository.
The Tutorial: A step-by-step guide to building your first QIIME 2 plugin chapter is where the focus is for the near future, though all of the Plugin Development chapters have useful and up-to-date content in them. You’ll also find content in Framework explanations and various other chapters throughout, but those are currently less thorough and generally need some updates. Please let us know if you find anything that is inaccurate or outdated.
diff --git a/plugins/tutorials/add-nw-align-method.html b/plugins/tutorials/add-nw-align-method.html index a33eb1b..ce0c657 100644 --- a/plugins/tutorials/add-nw-align-method.html +++ b/plugins/tutorials/add-nw-align-method.html @@ -678,7 +678,7 @@qiime2.Metadata API", "Add a second transformer", "Add a first Visualizer", "Add a new Artifact Class", "Add a first (real) Method", "Add a first Pipeline", "Add a Usage Example", "Conclusion", "Create your plugin from a template", "Tutorial: A step-by-step guide to building your first QIIME 2 plugin"], "terms": {"1": [0, 11, 15, 16, 18, 26, 31, 32, 33, 42, 49, 50, 51, 52, 54], "daniel": [0, 57], "procida": [0, 57], "di\u00e1taxi": [0, 26, 57], "document": [0, 6, 8, 10, 15, 16, 18, 19, 20, 21, 26, 30, 31, 37, 39, 41, 42, 45, 48, 52, 54, 56, 57], "framework": [0, 2, 8, 9, 11, 14, 15, 16, 21, 26, 29, 36, 38, 39, 40, 42, 43, 45, 46, 52, 54], "url": [0, 5, 26, 39], "http": [0, 5, 7, 15, 21, 26, 39, 40, 48, 52], "diataxi": [0, 54], "fr": 0, "2": [0, 2, 5, 7, 9, 11, 12, 13, 15, 16, 17, 20, 24, 28, 29, 30, 31, 32, 33, 35, 36, 37, 38, 42, 43, 44, 45, 46, 48, 49, 50, 51, 52, 53, 54, 55, 56], "s": [0, 2, 5, 8, 9, 10, 11, 15, 16, 18, 19, 21, 26, 29, 30, 31, 32, 33, 34, 35, 38, 39, 42, 43, 45, 46, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57], "b": [0, 16, 52], "needleman": [0, 52], "c": [0, 16, 18, 45, 52], "d": [0, 5, 26, 32, 39, 50, 51, 52, 54, 56], "wunsch": [0, 52], "A": [0, 2, 9, 10, 11, 15, 16, 18, 21, 24, 26, 27, 31, 32, 33, 35, 39, 40, 42, 44, 46, 48, 49, 51, 55], "gener": [0, 2, 7, 8, 9, 10, 11, 15, 16, 18, 19, 24, 26, 27, 29, 30, 32, 35, 38, 42, 45, 49, 50, 51, 52, 54, 55, 57], "method": [0, 2, 11, 14, 15, 16, 21, 24, 27, 29, 31, 33, 35, 37, 38, 42, 43, 44, 45, 46, 48, 50, 51, 53, 54, 55, 56, 57], "applic": [0, 18, 32, 40, 48, 52, 54, 57], "search": [0, 51, 52], "similar": [0, 16, 24, 27, 33, 35, 50, 52, 54], "amino": [0, 52], "acid": [0, 52], "sequenc": [0, 2, 8, 10, 11, 30, 49, 50, 51, 54], "two": [0, 8, 11, 15, 16, 18, 30, 34, 35, 38, 42, 43, 45, 49, 51, 52, 54], "protein": [0, 2, 51, 52], "j": 0, "mol": 0, "biol": 0, "48": [0, 52], "3": [0, 2, 11, 15, 16, 32, 39, 40, 42, 48, 57], "443": [0, 52], "453": [0, 52], "march": [0, 2, 11, 26], "1970": [0, 52], "gregori": 0, "caporaso": [0, 5, 26, 52, 56], "an": [0, 2, 8, 10, 11, 12, 13, 15, 18, 19, 20, 21, 24, 26, 29, 30, 32, 33, 34, 35, 37, 38, 41, 42, 43, 45, 48, 49, 54, 56], "introduct": [0, 2, 42, 52], "appli": [0, 2, 30, 32, 33, 45, 48, 49, 52, 57], "bioinformat": [0, 2, 51, 52, 57], "2nd": 0, "edit": [0, 7, 45, 51, 52], "2021": [0, 15], "readiab": 0, "org": [0, 5, 7, 15, 21, 26, 40, 48, 52], "4": [0, 2, 9, 15, 18, 26, 51, 52], "david": 0, "thoma": 0, "andrew": 0, "hunt": 0, "The": [0, 2, 7, 8, 10, 11, 12, 14, 16, 19, 21, 26, 29, 30, 32, 33, 34, 35, 38, 39, 40, 42, 43, 45, 49, 50, 51, 52, 53, 54, 55, 56, 57], "pragmat": [0, 52], "programm": [0, 30, 52], "your": [0, 7, 16, 18, 19, 30, 31, 32, 35, 37, 38, 42, 43, 44, 45, 49, 51, 52, 53, 55], "journei": [0, 52], "masteri": [0, 52], "20th": [0, 52], "anniversari": [0, 52], "addison": 0, "weslei": 0, "profession": 0, "septemb": 0, "2019": [0, 21], "5": [0, 2, 11, 15, 16, 45, 51, 52], "christoph": 0, "r": [0, 7, 11, 16, 32, 45, 50, 51], "keef": 0, "matthew": 0, "dillon": 0, "elizabeth": 0, "gehret": 0, "chloe": 0, "herman": 0, "mari": 0, "jewel": 0, "colin": 0, "v": 0, "wood": 0, "evan": [0, 5, 16, 26], "bolyen": [0, 5, 26], "facilit": [0, 7, 10, 52], "reproduc": [0, 10, 15, 45], "qiim": [0, 2, 5, 7, 9, 11, 12, 13, 15, 16, 17, 20, 21, 24, 28, 29, 30, 31, 32, 33, 35, 36, 37, 38, 42, 43, 44, 45, 46, 49, 50, 51, 52, 53, 54, 55, 56], "proven": [0, 2, 7, 8, 13, 20, 21, 33, 45, 50, 56, 57], "replai": [0, 2, 7, 15, 45, 57], "plo": 0, "comput": [0, 2, 7, 10, 15, 16, 18, 30, 32, 33, 42, 43, 45, 51, 53, 54, 57], "19": 0, "11": [0, 15, 21, 40, 45], "e1011676": 0, "novemb": 0, "2023": [0, 7, 40, 45], "action": [2, 7, 8, 9, 10, 11, 14, 16, 18, 19, 21, 28, 29, 30, 33, 37, 38, 39, 42, 43, 44, 45, 48, 51, 53, 54, 56, 57], "term": [2, 10, 15, 27, 30, 48, 51, 52, 54], "describ": [2, 8, 9, 10, 11, 15, 16, 18, 21, 30, 32, 33, 35, 39, 40, 42, 45, 48, 49, 50, 51, 52, 54], "concret": [2, 16, 43, 46, 48], "visual": [2, 9, 10, 13, 15, 20, 21, 24, 27, 32, 33, 37, 39, 44, 46, 51, 52, 53, 54, 55, 57], "pipelin": [2, 17, 20, 21, 24, 27, 29, 37, 44, 57], "accept": [2, 5, 16, 27, 32, 33, 35, 42, 52, 56], "paramet": [2, 8, 10, 15, 16, 18, 19, 24, 27, 29, 31, 32, 33, 35, 39, 40, 42, 43, 46, 48, 50, 51, 52, 54, 56], "file": [2, 8, 10, 13, 16, 20, 21, 27, 28, 31, 32, 34, 35, 39, 40, 42, 44, 45, 46, 48, 49, 50, 52, 54, 56], "artifact": [2, 8, 9, 10, 11, 12, 14, 15, 16, 21, 24, 27, 28, 29, 32, 33, 34, 35, 37, 38, 42, 44, 45, 49, 50, 52, 53, 54, 56, 57], "metadata": [2, 15, 16, 21, 27, 33, 35, 37, 39, 42, 44, 47, 49, 50, 51, 54], "input": [2, 8, 9, 11, 12, 15, 16, 19, 21, 27, 29, 30, 32, 33, 34, 35, 37, 42, 43, 44, 50, 51, 52, 53, 56], "some": [2, 8, 9, 10, 11, 14, 15, 16, 18, 19, 21, 26, 27, 30, 32, 33, 35, 38, 39, 41, 42, 43, 45, 49, 50, 51, 52, 53, 54, 56, 57], "kind": [2, 8, 11, 16, 30, 43, 51], "output": [2, 11, 15, 16, 21, 27, 29, 30, 32, 33, 34, 35, 37, 42, 44, 50, 51, 52, 53, 54, 56], "archiv": [2, 8, 10, 11, 13, 15, 20, 22, 30], "directori": [2, 9, 10, 12, 13, 15, 18, 20, 21, 30, 31, 40, 42, 50, 52, 54, 56], "structur": [2, 9, 10, 12, 15, 16, 21, 30, 32, 54, 56], "result": [2, 7, 8, 9, 15, 18, 19, 21, 24, 30, 31, 32, 33, 35, 42, 43, 45, 49, 50, 51, 52, 54, 56], "contain": [2, 8, 9, 10, 11, 15, 16, 18, 26, 30, 31, 32, 33, 35, 39, 43, 45, 48, 51, 52, 54, 57], "least": [2, 11, 18, 30, 31, 35, 45, 48, 51], "root": [2, 9, 15, 21, 29, 30, 32, 42, 51], "name": [2, 8, 9, 10, 11, 15, 16, 18, 19, 21, 24, 31, 32, 33, 34, 35, 38, 39, 40, 42, 45, 46, 48, 50, 51, 52, 54], "uuid": [2, 9, 15, 21, 45, 56], "version": [2, 7, 8, 9, 10, 15, 20, 22, 39, 42, 45, 46, 51, 52], "within": [2, 7, 8, 9, 11, 15, 16, 21, 24, 29, 31, 38, 39, 42, 43, 48], "data": [2, 7, 8, 11, 12, 13, 16, 20, 21, 28, 29, 32, 34, 43, 44, 45, 46, 48, 50, 51, 52, 56, 57], "oper": [2, 10, 15, 16, 27, 30, 43, 45], "class": [2, 10, 11, 15, 16, 18, 21, 24, 28, 29, 31, 32, 34, 38, 41, 42, 43, 44, 45, 46, 49, 50, 52, 54, 57], "can": [2, 7, 8, 9, 10, 11, 12, 15, 16, 18, 19, 21, 26, 27, 29, 30, 31, 32, 33, 35, 36, 39, 40, 41, 45, 46, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57], "exist": [2, 10, 11, 15, 16, 18, 19, 30, 31, 32, 38, 43, 45, 51, 52], "thi": [2, 5, 7, 8, 9, 10, 11, 12, 14, 15, 16, 18, 19, 20, 21, 24, 27, 29, 30, 31, 32, 33, 35, 36, 37, 38, 39, 40, 41, 42, 43, 45, 46, 48, 49, 50, 51, 53, 54, 55, 56, 57], "defin": [2, 8, 10, 11, 15, 18, 21, 24, 27, 29, 30, 31, 32, 33, 34, 35, 37, 40, 43, 44, 45, 46, 48, 50, 53, 57], "plugin": [2, 7, 8, 10, 11, 14, 15, 16, 19, 21, 26, 27, 30, 31, 32, 33, 34, 35, 37, 42, 43, 47, 48, 49, 51, 53, 54, 55], "develop": [2, 7, 8, 10, 11, 15, 21, 25, 30, 34, 36, 37, 38, 39, 42, 43, 47, 48, 49, 50, 52, 53, 54, 55, 56, 57], "associ": [2, 7, 15, 16, 21, 29, 30, 39, 45, 48, 49, 51, 52, 54, 56], "semant": [2, 8, 10, 11, 13, 20, 21, 24, 28, 32, 34, 38, 41, 44, 46, 57], "type": [2, 8, 9, 13, 15, 20, 21, 24, 28, 29, 31, 32, 33, 34, 35, 38, 40, 41, 42, 43, 44, 45, 48, 49, 50, 52, 54, 57], "format": [2, 8, 9, 10, 13, 15, 16, 20, 28, 29, 32, 34, 37, 38, 39, 41, 42, 43, 44, 48, 49, 50, 52, 54, 57], "when": [2, 7, 8, 9, 10, 11, 12, 15, 16, 18, 19, 21, 24, 29, 30, 31, 35, 38, 39, 42, 43, 45, 46, 48, 49, 50, 51, 52, 54, 56, 57], "regist": [2, 8, 10, 11, 15, 16, 21, 27, 29, 30, 37, 38, 43, 44, 45, 46, 49, 53], "api": [2, 8, 14, 15, 16, 23, 25, 26, 32, 33, 39, 42, 44, 45, 47, 49, 50, 51, 57], "see": [2, 8, 9, 10, 11, 15, 16, 21, 26, 29, 30, 32, 33, 35, 39, 40, 41, 42, 48, 49, 50, 51, 52, 54, 55, 56], "python": [2, 7, 8, 12, 14, 15, 16, 32, 34, 39, 40, 42, 45, 48, 51, 56, 57], "deploy": [2, 30, 38, 49], "instal": [2, 7, 10, 38, 39, 42, 49, 51, 54, 56], "well": [2, 7, 9, 10, 11, 15, 16, 30, 38, 43, 48, 49, 50, 51, 52, 57], "zero": [2, 16, 48, 52, 53], "more": [2, 8, 9, 10, 11, 12, 15, 16, 18, 19, 21, 26, 27, 30, 32, 33, 36, 37, 39, 41, 42, 43, 45, 46, 48, 49, 50, 51, 52, 53, 54, 55, 57], "interfac": [2, 7, 8, 10, 11, 15, 21, 25, 26, 27, 32, 39, 40, 42, 43, 45, 51, 52, 56, 57], "collect": [2, 13, 15, 16, 20, 21, 24, 33, 37, 42, 44, 46, 48, 51, 52], "distribut": [2, 7, 15, 18, 26, 39, 43, 45, 52], "object": [2, 8, 12, 14, 15, 16, 18, 29, 32, 33, 34, 35, 43, 48, 49, 50, 51, 52, 54], "subclass": [2, 21, 42, 48, 51, 54], "qiime2": [2, 5, 7, 9, 11, 12, 14, 15, 16, 18, 19, 21, 24, 26, 32, 35, 39, 40, 41, 42, 43, 44, 45, 46, 47, 49, 50, 51, 52, 54, 56], "directoryformat": [2, 11, 46, 51], "repres": [2, 9, 10, 11, 15, 16, 21, 24, 30, 43, 48, 51, 52], "particular": [2, 8, 9, 10, 18, 43], "layout": [2, 10], "arbitrarili": 2, "nest": [2, 8, 15, 16], "sub": [2, 8, 33, 51], "how": [2, 7, 8, 9, 11, 13, 15, 16, 18, 20, 26, 30, 32, 34, 36, 39, 40, 42, 44, 45, 48, 50, 51, 52, 53, 54, 56, 57], "content": [2, 7, 9, 15, 30, 31, 42, 50, 51, 52, 55], "must": [2, 8, 11, 15, 16, 18, 21, 29, 31, 32, 33, 35, 39, 42, 46, 48, 51, 52], "ar": [2, 5, 7, 8, 9, 10, 11, 12, 14, 15, 16, 18, 19, 21, 24, 26, 27, 30, 31, 32, 33, 34, 35, 37, 38, 39, 40, 41, 42, 43, 45, 46, 48, 49, 50, 51, 52, 53, 54, 57], "design": [2, 9, 10, 29, 48, 49], "togeth": [2, 9, 11, 16, 21, 33, 51, 53], "These": [2, 7, 8, 9, 10, 11, 15, 16, 18, 21, 27, 29, 31, 32, 34, 39, 42, 45, 46, 48, 52, 54], "group": [2, 8, 16, 35, 54], "theme": 2, "For": [2, 10, 11, 12, 15, 16, 18, 21, 26, 27, 29, 30, 31, 32, 38, 39, 40, 42, 43, 45, 46, 48, 50, 51, 52, 54, 56], "exampl": [2, 7, 8, 9, 11, 12, 16, 21, 26, 27, 29, 30, 31, 32, 33, 34, 35, 37, 38, 39, 40, 43, 44, 45, 46, 48, 49, 50, 51, 52, 55, 56, 57], "amplicon": [2, 7, 43], "provid": [2, 8, 9, 10, 11, 12, 15, 16, 18, 19, 24, 26, 27, 29, 30, 31, 32, 33, 34, 35, 36, 37, 39, 40, 41, 43, 46, 48, 49, 50, 51, 52, 53, 54, 56, 57], "analysi": [2, 10, 15, 27, 32, 35, 52], "microbiom": [2, 7], "while": [2, 5, 9, 10, 11, 15, 16, 18, 30, 39, 40, 46, 50, 52, 53, 54, 57], "shotgun": [2, 40], "metagenom": 2, "which": [2, 7, 8, 9, 10, 11, 12, 14, 15, 16, 18, 21, 26, 29, 30, 31, 32, 33, 39, 40, 42, 43, 45, 46, 48, 50, 51, 52, 53, 54, 56, 57], "either": [2, 8, 16, 19, 30, 45, 48, 51, 52, 56], "textfileformat": [2, 11, 45, 46, 51], "binaryfileformat": [2, 11, 46], "process": [2, 7, 8, 12, 16, 18, 39, 42, 45, 51, 52], "valid": [2, 8, 15, 16, 31, 37, 43, 44, 46, 48, 51, 52, 54], "engin": [2, 45, 52], "orchestr": 2, "enabl": [2, 9, 10, 15, 19, 42, 43, 49, 50, 51, 52, 54], "function": [2, 8, 9, 11, 15, 16, 29, 30, 31, 34, 36, 39, 40, 42, 43, 45, 49, 51, 54, 57], "cohes": 2, "unit": [2, 39, 42, 54, 55, 56], "galaxi": [2, 45, 52, 54, 57], "browser": [2, 7, 45], "base": [2, 10, 11, 14, 18, 19, 24, 29, 30, 43, 45, 46, 48, 50, 51, 52, 54], "graphic": [2, 10, 16, 35, 45, 52], "us": [2, 7, 8, 9, 10, 11, 12, 14, 15, 16, 19, 21, 24, 26, 27, 30, 32, 33, 34, 35, 37, 38, 39, 40, 41, 42, 44, 45, 46, 48, 49, 50, 52, 53, 54, 56, 57], "access": [2, 9, 15, 24, 32, 39, 45, 46, 48, 49, 50, 51, 52, 57], "other": [2, 5, 8, 9, 10, 11, 15, 16, 26, 27, 30, 31, 32, 35, 37, 39, 44, 45, 46, 48, 50, 51, 52, 53, 54, 57], "scienc": [2, 26], "tool": [2, 10, 15, 21, 30, 38, 51, 52, 54], "without": [2, 9, 10, 15, 16, 18, 30, 31, 50, 51, 52, 57], "have": [2, 5, 8, 9, 10, 11, 12, 15, 16, 18, 21, 26, 29, 30, 31, 32, 33, 38, 40, 42, 43, 45, 48, 49, 50, 51, 52, 54, 55, 56, 57], "write": [2, 7, 8, 11, 16, 18, 21, 26, 30, 34, 35, 37, 39, 44, 49, 51, 55, 56, 57], "command": [2, 7, 15, 16, 27, 30, 32, 39, 40, 42, 45, 51, 52, 53, 56, 57], "line": [2, 7, 11, 15, 16, 21, 29, 30, 32, 39, 40, 45, 50, 51, 52, 56], "code": [2, 7, 8, 9, 11, 15, 21, 24, 29, 39, 42, 43, 49, 50, 51, 52, 53, 54, 55, 56, 57], "support": [2, 7, 9, 10, 11, 15, 18, 21, 26, 39, 40, 42, 43, 45, 48, 51, 52, 53, 54, 57], "through": [2, 11, 15, 26, 30, 31, 35, 39, 40, 42, 45, 50, 51, 52, 54, 56, 57], "web": [2, 7, 15, 45], "identifi": [2, 8, 15, 29, 42, 43, 45, 48, 51, 52], "uniqu": [2, 9, 33, 38, 42, 43, 51], "valu": [2, 11, 15, 16, 18, 24, 31, 32, 33, 35, 39, 40, 42, 43, 45, 48, 50, 52, 54, 56], "denot": [2, 8], "individu": [2, 15, 39, 42, 48, 52], "sampl": [2, 10, 11, 15, 21, 27, 30, 33, 35, 39, 48], "featur": [2, 10, 27, 30, 33, 42, 43, 45, 48, 51, 54, 56], "ident": [2, 9, 21, 51, 52], "distinguish": [2, 10, 16], "piec": [2, 9, 10, 16], "doe": [2, 8, 9, 10, 12, 15, 16, 19, 26, 27, 31, 32, 35, 42, 51, 52, 54], "consid": [2, 10, 11, 15, 16, 21, 45, 48, 51, 52], "renam": 2, "like": [2, 7, 8, 9, 10, 11, 15, 16, 18, 19, 21, 26, 30, 31, 32, 33, 35, 37, 38, 39, 40, 42, 43, 45, 49, 50, 51, 52, 53, 54, 56], "unix": 2, "mv": 2, "chang": [2, 7, 8, 18, 19, 21, 31, 38, 40, 42, 45, 50, 51, 52, 54, 56, 57], "howev": [2, 8, 10, 16, 19, 43, 45, 51, 53], "re": [2, 5, 7, 10, 15, 16, 18, 26, 32, 37, 38, 40, 42, 45, 49, 50, 51, 52, 54, 56, 57], "run": [2, 7, 11, 15, 18, 19, 21, 30, 40, 42, 45, 46, 49, 50, 51, 52, 53, 54, 56, 57], "would": [2, 9, 10, 12, 15, 16, 18, 19, 26, 30, 31, 35, 37, 39, 42, 45, 48, 50, 52, 54], "user": [2, 6, 8, 10, 12, 15, 16, 18, 19, 21, 24, 26, 30, 32, 34, 35, 38, 39, 40, 42, 43, 45, 48, 49, 50, 51, 52, 53, 54, 56, 57], "respons": [2, 8, 9, 12, 45], "coordin": [2, 8, 32], "specifi": [2, 15, 18, 19, 31, 32, 43, 46, 50, 51, 52], "intent": [2, 8, 30], "driven": [2, 52], "columnar": 2, "annot": [2, 16, 29, 31, 32, 33, 34, 35, 42, 43, 52], "addit": [2, 9, 10, 12, 15, 16, 18, 35, 40, 42, 43, 48, 50, 51, 54, 57], "along": [2, 29, 31, 56], "id": [2, 42, 43, 48, 49, 51, 54], "combin": [2, 10, 11, 15, 16, 27, 32, 33, 35, 42, 46], "produc": [2, 12, 15, 16, 21, 24, 27, 29, 32, 33, 35, 42, 45, 46, 52, 53, 54, 56], "one": [2, 8, 9, 10, 11, 15, 16, 18, 21, 27, 30, 31, 32, 33, 34, 35, 38, 39, 41, 42, 43, 45, 46, 48, 50, 51, 52, 53, 54, 56], "return": [2, 8, 11, 16, 18, 21, 24, 30, 32, 33, 34, 35, 42, 43, 45, 46, 49, 50, 51, 52, 54], "pairwis": [2, 43, 50], "align": [2, 15, 21, 50, 53], "noun": 2, "hypothesi": [2, 52], "about": [2, 7, 8, 10, 11, 15, 16, 18, 30, 39, 41, 42, 43, 45, 48, 49, 52, 54, 56, 57], "posit": [2, 50, 51, 52], "pair": [2, 10, 29, 33, 43, 52], "biolog": [2, 11], "i": [2, 7, 10, 11, 15, 19, 30, 31, 32, 42, 43, 45, 48, 49, 50, 51, 52, 54, 56, 57], "e": [2, 7, 9, 10, 11, 12, 15, 19, 21, 24, 26, 30, 32, 33, 35, 38, 39, 42, 43, 45, 48, 50, 51, 52, 54, 56, 57], "dna": [2, 11, 50, 51, 52, 54], "rna": [2, 51, 52], "were": [2, 9, 15, 16, 18, 19, 21, 45, 50, 51, 54], "deriv": [2, 26, 52], "from": [2, 5, 7, 8, 9, 10, 11, 12, 15, 16, 18, 19, 21, 24, 26, 29, 30, 31, 32, 33, 34, 38, 39, 40, 42, 44, 45, 46, 48, 50, 51, 52, 53, 54, 55, 57], "common": [2, 9, 10, 11, 15, 16, 21, 24, 29, 42, 45, 46, 48, 51, 52, 53], "ancestr": [2, 9, 52], "verb": [2, 38], "detail": [2, 9, 10, 15, 16, 18, 21, 31, 32, 34, 36, 39, 42, 43, 48, 51, 52], "chapter": [2, 26, 31, 37, 52, 53], "alter": 2, "behavior": [2, 8, 33, 42, 43, 52], "payload": [2, 9, 10, 11], "meant": 2, "primari": [2, 15], "consumpt": [2, 52], "interpret": [2, 9, 15, 21, 27, 45, 48, 54], "contrast": [2, 9, 15, 27], "mai": [2, 5, 7, 8, 10, 15, 16, 18, 19, 21, 26, 30, 31, 32, 37, 42, 43, 45, 46, 48, 51, 52, 54, 57], "retrospect": [2, 10, 13, 20], "primarili": [2, 15, 26], "discret": 2, "modul": [2, 16, 50, 51, 52, 54], "form": [2, 8, 15, 16, 31, 45, 51, 52], "includ": [2, 7, 9, 10, 11, 15, 16, 26, 32, 33, 35, 39, 42, 43, 45, 48, 51, 52, 54, 56, 57], "new": [2, 7, 9, 10, 11, 12, 15, 16, 18, 19, 21, 26, 30, 31, 32, 36, 38, 39, 40, 44, 45, 46, 50, 53, 54, 55, 56, 57], "transform": [2, 15, 21, 28, 37, 38, 41, 43, 44, 46, 52, 57], "primit": [2, 10, 13, 20, 24, 31, 32, 42, 52], "commun": [2, 8, 26, 39, 54], "predefin": 2, "cannot": [2, 8, 16, 27, 35, 48], "extend": [2, 10, 31, 46, 52], "In": [2, 8, 10, 11, 15, 16, 19, 21, 27, 31, 32, 35, 39, 42, 43, 45, 48, 49, 50, 51, 52, 53, 54], "context": [2, 12, 15, 16, 18, 19, 24, 39, 40, 51, 54], "refer": [2, 7, 9, 15, 20, 23, 26, 30, 31, 32, 36, 39, 41, 42, 43, 44, 49, 50, 51, 52, 54], "histori": [2, 10, 15, 21], "given": [2, 10, 15, 16, 24, 30, 42, 50, 51, 52], "wa": [2, 9, 10, 11, 15, 16, 19, 21, 26, 30, 32, 35, 40, 42, 45, 49, 51, 52], "inform": [2, 8, 9, 10, 11, 12, 14, 15, 16, 18, 21, 26, 30, 32, 34, 39, 43, 50, 51, 52, 56], "host": [2, 7, 15], "system": [2, 10, 15, 16, 18, 19, 21, 30, 31, 32, 39, 40, 45], "environ": [2, 7, 10, 18, 21, 37, 42, 44, 51, 52, 54, 56], "perform": [2, 8, 9, 10, 11, 15, 16, 30, 36, 43, 45, 49, 50, 51, 52, 53], "pass": [2, 10, 11, 15, 19, 21, 30, 31, 39, 40, 42, 43, 45, 50, 51, 52, 54, 56], "sourc": [2, 7, 15, 21, 24, 29, 32, 33, 35, 38, 40, 45, 46, 48, 52, 57], "cite": [2, 3, 9, 15, 21, 52], "execut": [2, 8, 18, 19, 32, 42, 52, 54, 56, 57], "allow": [2, 8, 9, 10, 11, 15, 16, 18, 21, 24, 30, 39, 42, 43, 45, 46, 51, 52, 53, 54], "work": [2, 3, 7, 8, 10, 11, 15, 16, 19, 26, 29, 30, 31, 38, 39, 40, 42, 43, 45, 46, 48, 49, 50, 51, 52, 54, 55, 56, 57], "nativ": 2, "jupyt": [2, 26, 54], "notebook": [2, 15], "formerli": 2, "q2cli": [2, 15, 40, 42, 51, 54, 57], "origin": [2, 9, 10, 21, 31, 32, 33, 35], "still": [2, 5, 10, 16, 19, 30, 31, 49, 50, 52, 55], "2024": [2, 11, 26, 45, 51, 52, 55], "what": [2, 8, 9, 10, 16, 18, 19, 30, 32, 34, 42, 45, 49, 50, 51, 54, 56], "intend": [2, 8, 24, 26, 30, 40, 42, 43, 51, 52, 54, 57], "where": [2, 7, 8, 9, 10, 15, 16, 18, 26, 31, 32, 39, 41, 45, 46, 49, 50, 51, 52, 53, 54], "thei": [2, 8, 10, 11, 15, 16, 18, 21, 29, 30, 31, 34, 43, 45, 49, 50, 51, 52, 54], "tl": 2, "dr": 2, "too": [2, 11, 15, 43, 45, 51], "long": [2, 8, 10, 11, 29, 30, 32, 50, 51, 52], "didn": [2, 16, 50, 52], "t": [2, 7, 9, 10, 11, 15, 16, 18, 19, 21, 30, 32, 34, 40, 41, 42, 45, 46, 49, 50, 51, 52, 54, 55, 56], "read": [2, 8, 9, 11, 16, 18, 26, 31, 34, 45, 49, 50, 51, 52, 54, 55, 57], "word": [2, 10, 15, 16, 52], "quick": [2, 11, 50, 51], "summari": [2, 35, 50, 51, 53], "follow": [2, 9, 10, 16, 18, 19, 21, 31, 32, 33, 35, 39, 40, 42, 48, 49, 50, 51, 52, 54, 56], "capabl": [2, 11], "convert": [2, 8, 10, 24, 29, 34, 46, 48, 49, 51], "anoth": [2, 9, 10, 11, 12, 16, 18, 27, 34, 43, 50, 51, 54], "sever": [2, 18, 35, 38, 39, 46], "differ": [2, 7, 9, 10, 11, 15, 16, 18, 19, 21, 24, 26, 30, 32, 35, 37, 39, 40, 44, 45, 48, 49, 50, 51, 52, 54], "idea": [2, 7, 8, 9, 10, 16, 30, 51, 52, 54], "therefor": [2, 9, 15, 48, 51, 52, 54], "ambigu": [2, 51], "its": [2, 7, 8, 10, 11, 15, 16, 19, 21, 29, 30, 31, 32, 35, 36, 39, 42, 43, 48, 50, 51, 52, 54, 56], "own": [2, 7, 11, 15, 16, 18, 29, 37, 42, 45, 49, 52, 54, 55, 57], "specif": [2, 5, 7, 8, 10, 15, 16, 18, 19, 21, 26, 32, 37, 39, 40, 42, 43, 48, 51, 52, 54, 56, 57], "univers": [2, 30, 49], "almost": [2, 16], "certainli": 2, "randomli": 2, "rfc": 2, "wikipedia": [2, 45], "entri": [2, 8, 45], "view": [2, 7, 10, 12, 15, 30, 31, 33, 43, 45, 46, 49, 50, 51, 52, 54, 56], "represent": [2, 9, 11, 15, 16, 21, 30, 35, 43, 50], "disk": [2, 10, 11, 30, 31, 48, 51], "memori": [2, 10, 12, 30, 48], "interact": [2, 8, 9, 16, 24, 31, 39, 43, 45, 52], "There": [2, 9, 10, 15, 16, 18, 30, 38, 39, 42, 45, 46, 51, 52], "subtyp": 2, "relat": [2, 8, 9, 10, 15, 16, 18, 51, 52, 57], "between": [2, 7, 8, 9, 10, 11, 15, 16, 21, 24, 26, 29, 30, 32, 33, 45, 49, 51], "ani": [2, 7, 8, 9, 10, 11, 12, 15, 16, 18, 19, 27, 29, 31, 32, 39, 40, 42, 43, 46, 48, 49, 50, 51, 52, 54, 56], "singleton": 2, "becaus": [2, 8, 9, 10, 11, 12, 15, 16, 18, 21, 30, 42, 45, 48, 49, 50, 51, 52, 54], "exactli": [2, 10, 15, 27, 35, 42, 48, 49, 51, 52], "glossari": 3, "list": [3, 7, 11, 14, 15, 16, 18, 21, 30, 31, 32, 33, 35, 39, 40, 42, 46, 51, 52, 55, 56], "index": [3, 9, 35, 48, 50], "being": [5, 10, 12, 15, 16, 18, 21, 30, 32, 38, 43, 45, 48, 51, 52], "author": [5, 26, 52], "greg": [5, 26, 52], "book": [5, 26, 33, 52, 54], "migrat": [5, 26], "dev": [5, 26, 40, 42, 50, 51, 52, 56], "shortli": [5, 26, 52, 57], "until": [5, 7, 16, 26, 30, 50, 52, 54], "time": [5, 7, 8, 9, 10, 15, 18, 21, 26, 29, 30, 31, 38, 40, 43, 45, 49, 50, 51, 52, 54, 57], "stabl": [5, 26], "contribut": [5, 15], "welcom": 5, "acknowledg": 5, "via": [5, 8, 32, 39, 42, 43, 46, 49], "project": [5, 10, 32, 39, 40, 45], "github": [5, 7, 15, 21, 39, 40, 51, 54, 56], "contributor": 5, "page": [5, 7, 12, 39, 45, 50, 52], "At": [5, 8, 40, 43, 49, 51, 52], "moment": [5, 7, 18, 26, 41, 52], "we": [5, 7, 8, 9, 10, 11, 12, 15, 16, 18, 21, 26, 29, 30, 31, 32, 33, 38, 40, 42, 43, 45, 49, 50, 51, 52, 53, 54, 56], "lai": 5, "groundwork": 5, "onli": [5, 8, 9, 11, 15, 16, 18, 21, 26, 27, 30, 32, 33, 35, 39, 40, 43, 45, 48, 49, 50, 51, 52, 56, 57], "If": [5, 9, 10, 12, 15, 16, 18, 19, 26, 30, 31, 32, 35, 37, 38, 39, 40, 42, 43, 45, 46, 48, 49, 50, 51, 52, 54, 56, 57], "you": [5, 7, 9, 10, 12, 15, 16, 18, 19, 24, 26, 29, 30, 31, 32, 35, 36, 37, 38, 39, 40, 41, 42, 43, 45, 46, 49, 50, 51, 52, 54, 55, 56, 57], "suggest": [5, 16], "feedback": [5, 55], "love": [5, 12], "hear": [5, 12, 30], "As": [7, 9, 11, 15, 16, 21, 26, 31, 32, 33, 42, 45, 49, 50, 51, 52, 54, 55], "12": [7, 11, 15, 21, 40], "januari": [7, 45], "state": [7, 8, 10, 12], "transit": [7, 26, 30, 51], "present": [7, 9, 11, 15, 21, 31, 32, 35, 42, 46, 48, 50, 51, 52, 54], "go": [7, 16, 42, 45, 50, 51, 52, 54, 55, 56], "futur": [7, 10, 11, 18, 19, 26, 31, 45, 54], "cover": [7, 26, 39, 42], "doc": [7, 26, 48, 54], "move": [7, 8, 9, 10, 18, 19, 31, 40, 49, 51, 52, 57], "singl": [7, 9, 10, 15, 16, 21, 27, 30, 31, 33, 35, 38, 39, 42, 43, 46, 48, 50, 51, 52, 53, 54], "resourc": [7, 12, 18, 53], "cross": [7, 15, 45], "materi": [7, 43, 46, 54], "set": [7, 8, 9, 11, 16, 18, 21, 31, 32, 37, 43, 44, 46, 50, 51, 52, 54, 56], "usag": [7, 17, 19, 20, 30, 37, 44, 49, 52, 55, 56, 57], "expect": [7, 10, 11, 16, 18, 24, 26, 30, 31, 32, 35, 40, 42, 45, 46, 49, 50, 51, 52, 54, 56], "topic": [7, 26, 36, 52, 53], "build": [7, 16, 26, 37, 44, 45, 51, 52, 56], "cach": [7, 19, 42, 50, 51, 52, 56], "expand": [7, 15, 18, 50, 57], "here": [7, 8, 11, 15, 16, 19, 21, 26, 29, 30, 32, 33, 34, 35, 39, 40, 41, 42, 43, 49, 50, 51, 52, 53, 54, 55, 56], "parallel": [7, 8, 17, 20, 24, 53, 57], "recycl": [7, 19], "old": [7, 16, 26], "why": [7, 10, 16, 45, 54], "discuss": [7, 10, 15, 16, 26, 30, 36, 45, 51, 52, 54, 55], "multipl": [7, 8, 10, 11, 15, 16, 18, 21, 24, 26, 30, 31, 45, 46, 50, 51, 52, 57], "deal": [7, 16, 49], "import": [7, 8, 10, 14, 15, 16, 18, 19, 21, 30, 32, 34, 38, 39, 42, 45, 49, 50, 52, 53, 54], "export": [7, 43, 50, 52, 54], "qzv": [7, 10, 15], "equival": [7, 24], "our": [7, 10, 15, 16, 18, 26, 30, 42, 45, 49, 50, 51, 53, 54, 55, 56], "render": [7, 42, 43, 54], "all": [7, 8, 9, 10, 11, 15, 16, 18, 19, 21, 24, 26, 29, 30, 31, 32, 39, 41, 42, 43, 45, 46, 48, 50, 51, 52, 54, 56, 57], "avoid": [7, 16, 19, 30, 38, 39, 42, 45, 51, 52, 54, 57], "need": [7, 8, 9, 10, 11, 16, 18, 24, 26, 30, 31, 33, 39, 40, 42, 43, 45, 46, 49, 50, 51, 52, 54, 55], "thing": [7, 11, 15, 16, 30, 42, 45, 50, 51, 52, 54], "filter": [7, 48], "tutori": [7, 26, 37, 40, 43, 44, 48, 51, 55], "isn": [7, 11, 16, 46, 51, 52, 54], "realli": [7, 12, 14, 54], "rather": [7, 15, 16, 18, 30, 38, 45, 50, 51, 52, 54], "approach": [7, 10, 15, 26, 38, 45, 51, 57], "ideal": [7, 16, 51, 52, 54], "fulli": [7, 15, 18, 45], "autom": [7, 42, 51, 57], "built": [7, 8, 10, 16, 26, 37, 45, 50, 51, 52], "pluginmanag": 7, "pictur": [7, 8], "dataset": [7, 32], "cancer": [7, 26], "intervent": 7, "help": [7, 10, 15, 16, 30, 35, 39, 40, 42, 45, 51, 52, 54, 55, 56], "blur": 7, "over": [7, 8, 9, 11, 15, 16, 21, 30, 33, 39, 51, 52], "To": [7, 8, 10, 11, 16, 18, 26, 30, 40, 42, 44, 45, 48, 50, 51, 52, 54, 56, 57], "add": [7, 16, 18, 21, 44, 56, 57], "driver": [7, 42, 54], "select": [7, 15, 16, 45], "sdk": [7, 8, 12, 14, 18, 24, 42, 52], "multi": 7, "so": [7, 10, 11, 15, 16, 21, 27, 30, 31, 32, 34, 35, 38, 39, 42, 43, 45, 46, 49, 50, 51, 52, 53, 54, 57], "templat": [7, 26, 44, 50, 55, 57], "instruct": [7, 10, 18, 26, 32, 37, 40, 54, 57], "littl": [7, 16, 39, 50, 51, 52], "spars": 7, "don": [7, 10, 16, 19, 34, 42, 45, 49, 50, 51, 52, 54, 55, 56], "fork": [7, 16], "branch": 7, "do": [7, 10, 15, 16, 18, 19, 21, 26, 29, 31, 32, 33, 34, 35, 39, 42, 43, 45, 49, 50, 51, 52, 54, 55, 57], "recommend": [7, 11, 16, 40, 43, 51, 52, 54, 56], "first": [7, 8, 11, 16, 18, 19, 26, 29, 33, 35, 37, 42, 44, 45, 49, 51, 54, 55, 56], "most": [7, 8, 10, 15, 16, 18, 26, 30, 38, 43, 45, 50, 51, 52, 54, 57], "recent": [7, 10, 16, 30, 51], "releas": [7, 21, 31, 40, 42], "creat": [7, 9, 11, 12, 15, 16, 18, 19, 26, 30, 31, 37, 38, 39, 40, 42, 43, 44, 45, 46, 49, 50, 51, 52, 53, 54, 55, 57], "switch": [7, 18], "Then": [7, 8, 9, 50, 51, 52, 54, 56], "clone": [7, 40], "repositori": [7, 40, 42, 52, 56], "requir": [7, 8, 11, 15, 16, 18, 29, 31, 33, 35, 39, 40, 41, 42, 45, 48, 50, 51, 52, 54, 56], "git": [7, 40, 52], "com": [7, 15, 21, 39, 40], "cd": [7, 40], "pip": [7, 42, 56], "txt": [7, 45], "preview": 7, "mode": [7, 8, 11, 40, 46, 51, 56], "confirm": [7, 42, 49, 51, 52, 54, 56], "befor": [7, 8, 16, 18, 19, 30, 37, 38, 39, 42, 43, 49, 50, 51, 52, 54, 57], "make": [7, 9, 10, 11, 15, 16, 18, 21, 30, 31, 32, 35, 38, 40, 42, 45, 46, 48, 49, 50, 52, 54, 56, 57], "step": [7, 8, 10, 15, 18, 26, 37, 39, 44, 46, 49, 50, 51, 52, 53, 54, 55, 56], "dure": [7, 15, 19, 39, 42, 45, 51, 52, 56], "vastli": 7, "faster": [7, 8, 18], "than": [7, 8, 11, 15, 16, 30, 31, 40, 42, 43, 45, 46, 48, 49, 50, 51, 52, 54], "complet": [7, 8, 10, 15, 16, 26, 30, 34, 39, 50, 51, 52, 54, 57], "html": [7, 9, 35, 50], "them": [7, 8, 10, 12, 15, 16, 18, 21, 26, 31, 32, 42, 45, 49, 50, 51, 52, 54, 57], "iter": [7, 31, 46, 52], "done": [7, 8, 15, 18, 30, 32, 39, 51, 52, 54], "m": [7, 42, 50, 51, 52, 54, 56], "server": [7, 45, 50], "abov": [7, 8, 15, 16, 18, 21, 32, 39, 40, 42, 50, 51, 52, 54, 56], "launch": 7, "open": [7, 10, 11, 15, 34, 40, 43, 45, 50, 51, 52, 54, 56], "localhost": 7, "8000": 7, "local": [7, 40, 42, 46, 52], "readi": [7, 8, 32, 49, 51, 52, 54, 56], "submit": 7, "pull": [7, 9, 21], "request": [7, 8, 10, 21, 30, 43, 46, 51, 52, 56], "usual": [7, 8, 16, 18, 39, 45], "wai": [7, 10, 11, 12, 15, 16, 18, 24, 30, 31, 40, 42, 45, 50, 51, 52, 54, 55, 56], "goal": [8, 16, 26, 30, 37, 45, 49, 50, 52, 54], "give": [8, 15, 16, 39, 42, 51, 54], "reader": [8, 26, 52], "high": [8, 15, 39, 51, 52, 53], "level": [8, 11, 15, 18, 37, 39, 43, 44, 45, 48, 50, 51, 52, 54, 56], "understand": [8, 10, 12, 15, 16, 26, 30, 49, 52], "inter": [8, 16, 52], "highest": 8, "three": [8, 11, 15, 27, 30, 42, 51, 52], "translat": [8, 54], "whose": [8, 15, 21, 42], "purpos": [8, 10, 16, 18, 19, 26, 43, 50, 52, 54, 56], "further": [8, 12, 15, 16, 18, 48], "below": [8, 9, 15, 18, 21, 31, 39, 48, 51], "domain": [8, 16, 38], "box": [8, 15, 21, 45], "arrow": [8, 21], "invok": [8, 12, 42, 46], "solid": 8, "direct": [8, 15, 16, 57], "depend": [8, 9, 15, 18, 19, 21, 30, 39, 40, 42, 43, 51], "dash": [8, 39], "dot": 8, "defer": 8, "point": [8, 9, 15, 19, 35, 48, 49, 51, 52], "illustr": [8, 9, 16, 21, 29, 52, 53], "restrict": [8, 40, 43, 48], "should": [8, 10, 11, 12, 15, 16, 18, 19, 24, 26, 30, 32, 33, 35, 39, 40, 42, 43, 45, 46, 48, 50, 51, 52, 54, 56, 57], "knowledg": [8, 52], "ahead": [8, 42], "instead": [8, 12, 16, 24, 30, 33, 39, 45, 48, 50, 52], "descript": [8, 9, 10, 15, 31, 32, 33, 35, 39, 45, 46, 48, 49, 50, 51, 52], "avail": [8, 9, 11, 18, 30, 38, 42, 43, 46, 51, 52, 53, 54, 56], "softwar": [8, 9, 10, 11, 15, 30, 32, 45, 46, 52, 57], "kit": 8, "glanc": [8, 10], "seem": [8, 16, 30, 52], "oner": 8, "directli": [8, 10, 12, 15, 18, 21, 24, 29, 30, 31, 32, 34, 42, 43, 49, 51, 52], "also": [8, 9, 11, 15, 16, 18, 21, 24, 26, 30, 31, 42, 43, 45, 46, 48, 49, 50, 51, 52, 53, 54, 57], "never": [8, 16, 34, 37, 45, 51, 52], "mean": [8, 9, 10, 12, 15, 16, 18, 26, 30, 38, 39, 46, 51, 52], "entir": [8, 9, 11, 12, 16, 43, 50], "decoupl": 8, "importantli": [8, 15, 52, 54], "alwai": [8, 9, 11, 12, 15, 16, 43, 48, 49, 50, 51, 52], "concern": [8, 15, 26, 30, 32, 51, 52, 56], "themselv": [8, 15, 42, 52], "both": [8, 11, 15, 16, 30, 38, 39, 42, 51, 52, 54, 56], "itself": [8, 9, 10, 15, 18, 31, 51, 52], "kei": [8, 15, 21, 31, 32, 39, 42, 45, 52, 54], "constraint": [8, 10], "coupl": [8, 45, 49, 51, 52], "rich": [8, 10, 16, 54], "dynam": [8, 12], "adapt": [8, 26, 49, 51, 54], "ui": [8, 16], "audienc": 8, "task": [8, 16, 37, 50, 57], "hand": [8, 15, 16, 30, 43, 45, 51], "figur": [8, 35, 45, 50, 51], "found": [8, 15, 18, 21, 46, 49, 50, 51, 52, 53, 56], "round": [8, 49], "surround": 8, "indic": [8, 15, 18, 30, 31, 32, 39, 40, 42, 46, 48, 50, 51, 52], "larger": 8, "grai": 8, "text": [8, 9, 10, 15, 33, 35, 39, 45, 48, 49, 50, 52, 53, 54, 56], "angl": 8, "bracket": 8, "packag": [8, 14, 15, 32, 39, 40, 46, 50, 51, 52, 54, 56], "observ": [8, 11, 16, 33, 45, 49, 50, 51, 52], "call": [8, 9, 10, 11, 12, 16, 18, 24, 29, 30, 31, 32, 33, 34, 35, 39, 42, 43, 45, 46, 50, 51, 53, 54, 56], "privileg": 8, "compar": [8, 35, 50, 51, 52], "none": [8, 11, 18, 24, 32, 33, 35, 42, 43, 46, 48, 50, 51, 52], "look": [8, 9, 11, 16, 18, 21, 30, 31, 33, 35, 37, 39, 42, 43, 46, 49, 50, 51, 52, 54, 56, 57], "now": [8, 10, 11, 16, 18, 21, 40, 42, 49, 50, 51, 52, 54, 55, 56], "construct": [8, 11, 14, 16, 18, 24, 48], "relev": [8, 15, 21, 30, 39, 40, 43, 51, 52, 54], "rough": 8, "seen": [8, 9, 11], "load": [8, 11, 18, 21, 30, 32, 39, 42, 43, 45, 46, 48, 50, 51, 52, 54, 56], "later": [8, 10, 51, 52], "turn": [8, 31, 52, 54], "caus": [8, 46], "introspect": 8, "manipul": [8, 9, 10, 48], "number": [8, 11, 15, 16, 18, 29, 32, 39, 40, 43, 46, 48, 52], "get": [8, 10, 15, 16, 18, 31, 34, 39, 40, 42, 45, 46, 50, 51, 52, 54, 56, 57], "better": [8, 10, 12, 15, 16, 30, 40, 49, 51], "start": [8, 15, 16, 30, 35, 39, 40, 46, 49, 50, 51, 52, 54, 55, 56, 57], "end": [8, 15, 31, 39, 46, 50, 51, 52, 55, 56, 57], "uml": 8, "top": [8, 15, 18, 50, 51, 52, 54, 56], "bottom": [8, 15, 51, 52, 54], "passag": 8, "non": [8, 10, 15, 18, 24, 32, 33, 42, 43, 46, 48, 51, 52], "amount": [8, 14], "vertic": 8, "column": [8, 16], "activ": [8, 15, 26, 30, 52, 56], "narrow": 8, "upon": 8, "actor": 8, "question": [8, 9, 11, 39, 42, 43, 51], "label": [8, 16, 18, 42], "parenthesi": 8, "argument": [8, 16, 21, 31, 42, 45, 51], "Not": [8, 16], "enumer": [8, 11, 31], "breviti": 8, "ha": [8, 9, 10, 11, 15, 16, 18, 21, 26, 30, 33, 39, 42, 43, 45, 48, 50, 51, 52, 56, 57], "four": [8, 52], "receiv": [8, 16, 33, 45, 51, 57], "It": [8, 9, 11, 12, 15, 16, 19, 21, 24, 26, 27, 30, 31, 33, 39, 42, 45, 49, 50, 51, 52, 54, 57], "locat": [8, 12, 18, 45], "shown": [8, 15, 18, 21, 31, 39], "much": [8, 10, 11, 16, 30, 31, 40, 42, 51, 52], "check": [8, 9, 11, 18, 21, 30, 40, 42, 43, 46, 49, 50, 51, 52, 54], "fail": [8, 18, 19, 30, 45, 46, 50, 51], "halfwai": 8, "veri": [8, 9, 11, 16, 18, 26, 30, 31, 32, 33, 35, 39, 50, 51, 52, 54], "though": [8, 10, 16, 21, 26, 30, 32, 40, 50, 51, 54], "necessarili": [8, 16, 19, 30], "same": [8, 10, 15, 16, 18, 21, 24, 30, 31, 33, 35, 38, 39, 42, 45, 48, 49, 50, 51, 53, 54], "final": [8, 15, 16, 18, 35, 39, 42, 43, 51, 52, 54, 57], "compat": [8, 9, 10, 24, 39, 45], "whatev": [8, 15, 31, 35, 50, 51, 56], "onc": [8, 10, 11, 16, 18, 32, 42, 49, 51], "finish": 8, "again": [8, 31, 38, 48, 49, 50, 52], "storag": [8, 51], "record": [8, 10, 11, 15, 21, 51, 52, 56, 57], "just": [8, 14, 15, 16, 18, 26, 30, 31, 40, 42, 43, 45, 49, 50, 51, 52, 54], "occur": [8, 11, 12, 15, 42, 52], "decid": [8, 45, 52], "save": [8, 9, 10, 11, 15, 19, 21, 43, 45, 48, 50, 52, 54], "each": [8, 9, 10, 15, 16, 21, 26, 30, 32, 33, 42, 43, 48, 50, 51, 52, 54, 57], "strictli": 8, "sort": [8, 30, 50], "onion": 8, "layer": 8, "note": [8, 15, 31, 41, 42, 49, 51, 52], "wait": [8, 18], "becom": [8, 11, 12, 16, 29, 51, 54], "inact": 8, "asynchron": 8, "case": [8, 9, 11, 12, 15, 16, 30, 31, 32, 40, 42, 43, 45, 48, 50, 51, 52, 54], "success": [8, 51, 52, 56], "less": [8, 26, 30, 46, 51], "right": [8, 16, 42, 45, 51, 52, 56, 57], "care": [8, 15, 29, 30, 42], "effect": [8, 15], "overal": [8, 21], "effort": [8, 15, 45], "store": [9, 11, 13, 19, 20, 21, 30, 46, 48, 50, 51, 52], "simpl": [9, 15, 16, 31, 39, 42, 50, 51, 52, 53, 56], "conveni": [9, 10, 16, 21, 43, 45, 46, 49, 50, 51], "serv": [9, 12, 26, 42], "repeat": [9, 16], "45c12936": 9, "4b60": 9, "484d": 9, "bbe1": 9, "98ff96bad145": 9, "featuret": [9, 29, 30, 32, 33, 42, 45, 56], "frequenc": [9, 29, 30, 32, 33, 42, 45, 56], "biomv210dirfmt": 9, "possibl": [9, 10, 15, 16, 19, 21, 30, 42, 45, 46, 49, 50, 51, 52, 54], "null": [9, 15], "impli": [9, 18, 51, 52], "schema": 9, "aptli": 9, "subdirectori": [9, 10, 15, 51], "implement": [9, 16, 31, 42, 45, 48, 51, 52, 57], "small": [9, 11, 49, 52, 54], "static": [9, 12], "websit": [9, 15, 21, 39, 46, 52], "asset": [9, 39, 40, 46], "determin": [9, 10, 15, 16, 29, 32, 43, 48, 50, 52], "current": [9, 11, 12, 15, 16, 21, 26, 31, 40, 42, 46, 48, 53], "public": [9, 11, 24, 42, 45, 51], "self": [9, 10, 11, 15, 16, 45, 49, 50, 51, 52, 54], "referenti": 9, "duplic": [9, 15, 19, 54, 56], "simplifi": [9, 15, 39, 41, 46, 49, 51, 53], "track": [9, 10, 13, 20, 21, 45], "fig": [9, 15, 21], "close": [9, 10, 16, 48, 51], "previous": [9, 21, 51, 53], "up": [9, 12, 16, 18, 21, 31, 37, 42, 43, 44, 46, 49, 50, 51, 56], "simpli": [9, 15, 16, 18, 31, 43, 45, 52], "ad": [9, 11, 16, 21, 30, 32, 33, 35, 38, 42, 46, 49, 50, 51, 52, 54, 55], "merg": [9, 42, 48], "know": [9, 11, 16, 26, 30, 42, 45, 50, 51, 52, 54], "ancestor": [9, 21], "twice": 9, "ignor": [9, 10, 45, 52], "problem": [9, 10, 30, 45, 51], "captur": [9, 21, 42, 57], "tree": [9, 24, 30, 51], "ubiquit": 9, "understood": 9, "huge": [9, 30, 52], "varieti": 9, "additon": 9, "random": 9, "extract": [9, 10, 15], "linear": 9, "tar": 9, "out": [9, 11, 14, 16, 30, 43, 45, 50, 51, 52, 54, 56], "larg": [9, 15, 30, 32, 51, 52, 57], "mani": [9, 10, 11, 15, 16, 21, 30, 32, 35, 38, 42, 43, 51, 52], "core": [9, 12, 14, 15, 16, 19, 21, 33, 43, 46, 52], "_ziparch": 9, "manag": [9, 12, 15, 18, 19, 40, 45, 46, 51, 52], "zipfil": 9, "everi": [9, 10, 11, 15, 35, 52, 54, 57], "standard": [9, 10, 52], "enough": [9, 16, 42], "pars": [9, 21, 30], "rest": [9, 18], "intention": [9, 50], "ini": 9, "serial": [9, 48, 51], "configur": [9, 11, 17, 20, 53], "discourag": 9, "situat": [9, 11, 16, 19], "reformat": 9, "updat": [9, 10, 15, 16, 26, 40, 54], "g": [9, 10, 11, 12, 15, 21, 24, 26, 30, 33, 35, 38, 39, 42, 43, 45, 48, 51, 54, 56, 57], "consist": [9, 21, 43], "break": [9, 11, 16, 18, 54], "backward": [9, 31, 38, 57], "integ": [9, 11, 16, 31, 48], "string": [9, 10, 16, 21, 24, 32, 39, 43, 45, 46, 48, 50, 51, 52, 54], "evolv": [9, 21], "dispatch": [9, 16, 18, 21], "appropri": [9, 12, 21, 29, 30, 33, 39, 42, 52], "logic": [9, 11, 46], "histor": [9, 21], "0": [9, 11, 15, 16, 26, 31, 33, 40, 42, 46, 50, 51, 52], "had": [9, 16, 30, 50, 51], "hadn": 9, "yet": [9, 10, 16, 31, 42, 51, 52, 56], "been": [9, 16, 21, 26, 29, 31, 45, 48, 51, 52, 56, 57], "parser": [9, 21], "doen": 9, "easi": [9, 16, 42, 51, 52], "runtim": [9, 14, 15, 51], "scheme": [9, 15, 19, 48], "complex": [9, 15, 16, 39, 42, 50], "ensur": [9, 11, 12, 18, 40, 42, 43, 45, 46, 50, 51, 52, 54], "abl": [9, 10, 11, 15, 16, 21, 38, 40, 50, 51, 52, 54, 57], "older": [9, 15, 30], "encod": [9, 10, 48], "_archiv": [9, 21], "section": [10, 15, 16, 18, 21, 26, 45, 48, 49, 50, 51, 52, 54, 55], "synonym": [10, 16, 30], "clarifi": [10, 16], "languag": [10, 14, 15, 16, 30], "haven": [10, 16, 45, 51, 52], "review": [10, 15, 16, 49, 50, 51, 52], "persist": [10, 11, 15], "accomplish": [10, 26, 33], "impact": [10, 15, 30, 32, 52], "facet": 10, "order": [10, 11, 15, 16, 18, 24, 31, 42, 46, 48, 52], "demonstr": [10, 52, 56], "certain": [10, 48], "aspect": [10, 14, 15, 20, 41, 51, 52], "highlight": 10, "achiev": [10, 14, 30, 37, 45, 52, 57], "motiv": [10, 30], "contraint": 10, "20": [10, 15, 30], "year": [10, 52], "proof": 10, "eas": [10, 15], "trust": [10, 51, 52], "decis": [10, 16, 30], "made": [10, 18, 21, 30, 42, 43, 51, 52], "solut": 10, "seek": [10, 12], "address": [10, 30, 50, 51, 52], "solv": [10, 30], "lift": 10, "choos": [10, 12, 15, 30, 38, 43], "believ": 10, "scientist": 10, "compos": [10, 11, 48, 53], "reus": [10, 19, 24], "advanc": [10, 18, 19, 31], "art": 10, "fair": [10, 52], "principl": 10, "insid": [10, 16, 18, 21, 32, 42, 51], "zip": [10, 15, 16, 42], "permit": [10, 16], "alongsid": [10, 21], "fasta": [10, 11, 30, 51, 52], "plain": [10, 16], "person": [10, 16, 54], "might": [10, 11, 16, 30, 31, 39, 40, 42, 43, 46, 51, 52], "roughli": 10, "assum": [10, 18, 45, 48, 52], "sens": [10, 16, 30, 50], "entiti": [10, 51], "per": [10, 11, 15, 18, 30, 50], "fastq": [10, 11, 30, 51], "sometim": [10, 45, 52], "altern": [10, 18, 52], "could": [10, 15, 16, 27, 30, 31, 32, 39, 42, 45, 50, 51, 52, 54], "invent": 10, "rule": [10, 15, 16, 31], "difficult": [10, 12, 30], "reason": [10, 15, 18, 30, 45, 51], "newick": [10, 30, 51], "deliv": 10, "qza": [10, 15, 30, 31, 42, 51, 52, 54], "intern": [10, 18, 30, 31, 43, 51, 54], "unzip": [10, 15], "util": [10, 14, 15, 43, 51, 52], "winzip": 10, "7zip": 10, "even": [10, 15, 16, 30, 33, 42, 45, 50, 51, 52], "challeng": [10, 51], "inconveni": 10, "fix": [10, 16, 45, 51], "destin": [10, 29, 31], "addition": [10, 12, 16, 30, 43, 54], "advantag": 10, "incred": 10, "wide": [10, 39], "arrai": [10, 42], "often": [10, 15, 16, 18, 30, 34, 45, 50, 52, 54, 57], "back": [10, 15, 16, 45, 49, 50, 51, 52, 54, 55, 57], "docx": 10, "epub": 10, "maintain": [10, 42], "anatomi": [10, 13, 15, 20], "yaml": [10, 21, 40], "around": [10, 31, 52], "prevent": [10, 11, 15, 38, 51], "error": [10, 11, 30, 45, 48, 51, 52], "due": [10, 31], "accident": [10, 15, 30], "misus": 10, "confus": [10, 18, 30], "place": [10, 11, 31, 41, 46, 51, 52], "worri": [10, 16, 42, 56], "filenam": [10, 11, 15, 21, 46, 51], "conflict": 10, "anyth": [10, 12, 16, 18, 19, 26, 30, 31, 32, 35, 42, 46, 50, 51, 52, 54], "els": [10, 30, 31, 42, 51], "known": [10, 12, 16, 30, 32, 46], "carri": [10, 16, 30], "abstract": [10, 15, 16, 24, 48, 54], "composit": [10, 15, 16, 46], "adequ": 10, "share": [10, 15, 21, 24, 57], "necessari": [10, 11, 16, 18, 43], "learn": [10, 26, 29, 41, 52, 54, 57], "notabl": [10, 15], "prior": [10, 15, 19, 21, 31, 33, 43], "involv": [10, 16], "creation": [10, 15, 56], "citat": [10, 15, 21, 32, 33, 35, 39, 45, 50, 54, 56], "decentr": [10, 13, 20, 21], "doesn": [11, 15, 16, 30, 32, 40, 41, 50, 51, 52, 54], "opinion": 11, "simplest": 11, "fileformat": 11, "typic": [11, 29, 30, 38, 43, 51, 52], "bit": [11, 16, 18, 39, 50, 51, 52], "initi": [11, 19, 26, 30, 42, 50, 51, 52, 57], "declar": [11, 30], "fly": 11, "goe": [11, 15], "corrupt": 11, "invalid": [11, 30, 45, 51, 52], "gotcha": 11, "keep": [11, 15, 16, 33, 38, 50], "minim": [11, 36, 40, 45, 51], "limit": [11, 15, 16, 38], "subset": 11, "10": [11, 15, 21, 26, 46, 52], "snif": 11, "min": [11, 51], "max": [11, 18, 51], "definit": [11, 16, 27, 31, 35, 42, 46, 51, 52, 54], "focu": [11, 15, 26, 40, 42, 51], "_validate_": [11, 36, 45, 51], "intsequenceformat": 11, "interest": [11, 15, 16, 26, 43, 55], "equal": [11, 16], "previou": [11, 15, 39, 49, 50, 51, 52], "plu": 11, "def": [11, 29, 31, 32, 33, 34, 35, 42, 43, 45, 49, 50, 51, 52, 54], "_validate_n_int": 11, "n": [11, 40], "fh": [11, 34, 46, 50, 51], "previous_v": 11, "idx": 11, "bail": 11, "try": [11, 16, 18, 19, 49, 50, 51, 54, 56], "val": [11, 42], "int": [11, 16, 31, 32, 33, 46, 48], "rstrip": 11, "except": [11, 12, 15, 16, 18, 33, 35, 50, 51, 52], "typeerror": [11, 16, 24], "valueerror": [11, 51], "rais": [11, 16, 18, 24, 51], "validationerror": [11, 24, 46, 51], "f": [11, 42, 51], "expos": [11, 42, 43], "record_map": 11, "format_inst": 11, "temp_dir": [11, 50], "shouldn": [11, 30, 51, 52], "otherwis": [11, 18, 31, 43, 46, 48], "astut": 11, "notic": [11, 18, 30, 32, 51], "option": [11, 15, 18, 19, 24, 39, 42, 46, 48, 56], "although": [11, 43], "highli": [11, 45, 52, 54], "skip": [11, 42, 51], "anti": [11, 44, 47, 51], "pattern": [11, 44, 47, 51], "hoc": [11, 46], "presenc": [11, 46], "part": [11, 12, 18, 20, 26, 31, 36, 41, 45, 50, 51, 52, 54, 55], "aim": [11, 15], "basic": [11, 15, 16, 18, 31, 42, 51, 52], "special": [11, 15, 16, 52], "busi": [11, 45], "tsv": [11, 15, 35, 42, 48], "etc": [11, 15, 16, 18, 21, 32, 39, 43], "dnafastaformat": [11, 52], "biom": [11, 29, 30, 42, 52], "gzip": 11, "fastqgzformat": 11, "accur": [11, 15], "member": [11, 16, 24, 46], "emppairedenddirfmt": 11, "forward": [11, 52, 54, 57], "gz": 11, "revers": 11, "barcod": [11, 43], "underli": [11, 16, 33, 34, 42, 46, 50, 52], "semat": [11, 51], "unlik": [11, 15, 16, 39, 51, 53], "differenti": [11, 16, 21], "model": [11, 14, 15, 16, 45, 51], "compon": [11, 21, 26], "demultiplex": [11, 30], "One": [11, 16, 30, 51, 52, 57], "studi": [11, 15, 43, 48], "5000": 11, "watch": 11, "casavaoneeightsinglelanepersampledirfmt": 11, "illumina": 11, "casava": 11, "v1": [11, 21], "8": [11, 15, 21, 40, 46, 50, 52], "filecollect": 11, "_": [11, 18, 19, 32, 39, 51, 52], "_l": 11, "9": [11, 15, 21], "_r": 11, "_001": 11, "set_path_mak": 11, "sequences_path_mak": 11, "sample_id": [11, 42], "barcode_id": 11, "lane_numb": 11, "read_numb": 11, "s_": 11, "s_l": 11, "03d_r": 11, "d_001": 11, "those": [11, 15, 26, 29, 35, 37, 42, 43, 45, 46, 48, 49, 51, 52, 54], "factori": [11, 16, 24, 46, 49, 54], "quickli": [11, 30, 51, 54], "remov": [11, 18, 19, 43, 51, 52], "evil": 11, "extra": [11, 16, 45, 46, 52], "dnasequencesdirectoryformat": [11, 21], "singlefiledirectoryformat": [11, 51], "aren": [11, 16, 21, 45, 52], "registr": [11, 15, 29, 31, 39, 41, 42, 43, 52, 54], "sampledata": [11, 30, 33, 35, 42], "pairedendsequenceswithqu": 11, "offer": [12, 21, 43], "particularli": 12, "deep": [12, 15, 16], "answer": 12, "warn": [12, 31, 51, 52, 54, 56], "think": [12, 16, 30, 43, 49, 51, 52], "robust": [12, 16], "alloc": 12, "synchron": 12, "filesystem": 12, "excacerb": 12, "lifetim": 12, "unkown": 12, "tie": 12, "automat": [12, 15, 16, 32, 33, 35, 51, 54], "destroi": 12, "raii": 12, "handl": [12, 15, 29, 31, 43, 45, 48, 49], "collector": 12, "destructor": 12, "clean": 12, "push": 12, "issu": [12, 15, 30, 39, 42, 51, 55], "off": [12, 16, 45, 51], "destruct": 12, "path": [12, 18, 30, 31, 35, 39, 42, 45, 46, 49, 50, 52, 54, 56], "multiprocess": 12, "sy": [12, 15], "_exit": 12, "exit": [12, 18, 24, 30, 46, 48, 52, 56], "child": 12, "normal": [12, 15, 16, 33, 48, 51, 52], "cleanup": 12, "confound": 12, "fortun": [12, 31], "juggl": 12, "architectur": [13, 20], "overview": [13, 20], "garbag": [13, 20, 45], "metaprogram": [13, 20], "signific": [14, 21], "properti": [14, 43, 46, 50, 51], "swap": [14, 16], "last": [14, 16, 45, 50, 51], "minut": [14, 30, 49, 50, 51, 52], "show": [14, 16, 21, 42, 52, 56, 57], "decor": [14, 16, 34, 51], "everywher": 14, "descriptor": [14, 16, 38], "protocol": 14, "latebindingattribut": 14, "hook": [14, 46, 50], "metaclass": 14, "directory_format": 14, "eval": 14, "skd": 14, "parse_typ": [14, 24], "signatur": [14, 24, 32, 35, 51, 52], "rewrit": 14, "integr": [15, 42], "notion": 15, "central": [15, 43, 49], "whenev": [15, 21], "hold": [15, 16], "disassoci": 15, "simpler": [15, 16], "outcom": [15, 30, 42, 43, 45, 52], "png": [15, 35], "graph": 15, "email": 15, "colleagu": 15, "mi": 15, "wrong": [15, 30, 50, 51], "inaccur": [15, 26], "outdat": [15, 26, 30], "script": 15, "inadvertantli": 15, "subsequ": [15, 27, 32, 43, 52, 53], "viewer": [15, 50], "actual": [15, 16, 18, 30, 31, 42, 43, 50, 51, 52, 54], "With": [15, 21, 49, 51], "prospect": 15, "plan": [15, 21, 30, 42, 45, 51, 55], "paragraph": 15, "recreat": 15, "alreadi": [15, 16, 19, 30, 37, 42, 45, 51, 52, 56, 57], "forget": [15, 16, 52, 55], "download": [15, 40, 45, 56], "won": [15, 45, 50, 51, 52], "hard": [15, 16, 18, 30, 38, 51], "imposs": [15, 30], "discov": [15, 30, 52, 54], "reliabl": 15, "manual": [15, 31, 42, 51], "want": [15, 16, 18, 19, 26, 30, 31, 35, 38, 40, 42, 43, 50, 51, 52, 54, 56, 57], "intermedi": [15, 19, 27, 51], "reduc": [15, 32, 45, 51], "o": [15, 42, 52, 54, 56], "cli": 15, "team": [15, 26, 40], "manuscript": 15, "research": [15, 26], "consumm": [15, 52], "valuabl": 15, "reproduct": 15, "transpar": 15, "mainten": 15, "repair": 15, "technic": [15, 18, 39, 50, 52], "among": [15, 51], "benefit": [15, 45, 51, 54], "analys": [15, 54], "relianc": 15, "incomplet": [15, 45, 53], "incomprehens": 15, "who": [15, 26, 40, 45, 51, 54, 57], "ran": [15, 50, 54], "q2view": 15, "bring": [15, 16, 52], "theoret": 15, "pleas": [15, 26, 42, 45, 51, 52], "feel": [15, 45, 51, 54], "free": [15, 39, 45, 51, 52], "touch": [15, 52], "llm": 15, "easier": [15, 16, 21, 49, 51, 52], "ever": [15, 16, 35, 49], "event": [15, 52], "bug": [15, 45], "problemat": [15, 45], "hardwar": 15, "investig": 15, "programat": 15, "correct": [15, 42, 45], "By": [15, 19, 32, 42, 43, 52], "agnost": 15, "across": [15, 18, 21, 32, 45, 52, 53], "variou": [15, 16, 20, 26, 48], "prefer": [15, 16, 30, 39, 42, 51, 56], "compromis": [15, 16], "rel": [15, 45, 51, 52], "outer": 15, "few": [15, 16, 29, 30, 33, 35, 38, 41, 46, 50, 51, 57], "cleric": 15, "parent": [15, 24], "massiv": 15, "size": [15, 52], "blue": [15, 21], "icon": [15, 21], "appear": [15, 16, 45, 52], "remain": [15, 16, 21, 26], "hous": 15, "respect": [15, 19, 21, 30, 46, 48, 52], "abbrevi": 15, "live": [15, 39, 51], "titl": [15, 50, 52], "6": [15, 52], "That": [15, 16, 18, 30, 45, 50, 51, 52, 54, 55], "bib": [15, 21, 32, 39, 52], "bibtex": [15, 32, 39, 52], "passthrough": 15, "regardless": [15, 30, 48], "stuff": 15, "ll": [15, 16, 26, 30, 37, 40, 42, 45, 49, 50, 51, 52, 53, 54, 56, 57], "dive": [15, 16], "broken": [15, 26, 54], "link": [15, 35, 42, 48, 51, 52], "tab": [15, 50], "click": [15, 52], "squar": 15, "circl": [15, 16, 49], "3611a0c1": 15, "e5c5": 15, "4308": 15, "ac92": 15, "ebb5968ebafb": 15, "04": 15, "21t14": 15, "42": 15, "16": 15, "469998": 15, "07": 15, "00": 15, "21": 15, "080381": 15, "durat": 15, "second": [15, 16, 18, 33, 44, 50, 51, 54, 57], "610383": 15, "microsecond": 15, "datetim": 15, "iso": 15, "8601": 15, "timestamp": 15, "field": [15, 16, 24, 45, 46, 51, 52], "v4": [15, 21], "element": [15, 16, 18, 39, 43], "separ": [15, 32, 39], "alia": [15, 21], "displai": [15, 39, 42, 50, 52, 56], "inner": 15, "reflect": [15, 30], "experi": [15, 40, 54], "full": [15, 18, 21, 26, 41, 50, 52, 54], "chain": [15, 49, 51, 53], "termin": [15, 27, 35, 40], "redund": 15, "alias": 15, "real": [15, 16, 42, 44, 56, 57], "unweighted_unifrac_emperor": 15, "metric": [15, 29, 32, 33, 39], "phylogenet": [15, 30, 32, 33, 51, 52], "rememb": [15, 16, 24, 46, 52], "chose": [15, 52], "noth": 15, "couldn": [15, 45], "ref": [15, 21], "divers": [15, 27, 32, 33, 35, 38, 39, 42, 53], "core_metrics_phylogenet": 15, "tabl": [15, 27, 29, 30, 32, 33, 35, 42, 43, 45, 46, 51, 52, 56], "34b07e56": 15, "27a5": 15, "4f03": 15, "ae57": 15, "ff427b50aaa1": 15, "phylogeni": [15, 29, 30, 32, 51], "a10d5d44": 15, "62c7": 15, "4322": 15, "afb": 15, "c9811bcaa3e6": 15, "sampling_depth": [15, 33], "1103": 15, "n_jobs_or_thread": 15, "2adb9f00": 15, "a692": 15, "411d": 15, "8dd3": 15, "a6d07fc80a01": 15, "custom": [15, 18, 21], "tag": [15, 21, 39], "express": [15, 16, 24, 42, 54], "easili": [15, 18, 30, 54], "distinct": [15, 16, 33, 52], "default": [15, 18, 19, 32, 43, 48, 51, 52, 54, 56], "assign": [15, 16, 21, 30, 42, 43, 46, 52, 54], "uncommon": [15, 45], "log": [15, 33], "characterist": [15, 21], "platform": 15, "virtual": 15, "machin": [15, 16, 45, 51], "vm": 15, "client": 15, "site": [15, 43, 52], "global": [15, 38, 52], "working_set": 15, "pkg_resourc": 15, "587": 15, "macosx": 15, "x86_64": 15, "conda": [15, 18, 42], "forg": 15, "feb": 15, "38": 15, "clang": 15, "q2": [15, 21, 27, 29, 30, 34, 38, 39, 40, 41, 42, 43, 50, 51, 52, 54, 56], "zipp": 15, "xopen": 15, "dada2": [15, 38], "alabast": 15, "7": [15, 18, 56], "wrap": [15, 32, 33, 38], "fine": [15, 40, 45, 56], "grain": 15, "mind": [15, 16, 38, 51, 54], "hide": 15, "ten": 15, "behind": [15, 16, 49], "five": 15, "fifteen": 15, "scope": [15, 24, 42, 54], "dag": 15, "tell": [15, 18, 39, 51, 52, 56], "87058ae3": 15, "e168": 15, "4e2f": 15, "a416": 15, "81b130d538c3": 15, "next": [15, 18, 35, 39, 45, 51, 52, 54, 55, 56, 57], "let": [15, 16, 18, 26, 33, 42, 45, 49, 50, 51, 52, 54, 56, 57], "drill": 15, "down": [15, 16, 18, 51], "2adb9": 15, "find": [15, 16, 18, 26, 30, 33, 35, 37, 39, 45, 46, 49, 52, 54, 57], "neither": [15, 16], "node": [15, 51], "nor": 15, "pcoa": [15, 32, 33], "visibl": 15, "emperor": [15, 33, 39], "plot": [15, 33, 35], "93224813": 15, "ed5d": 15, "42b5": 15, "a983": 15, "cd4015db31da": 15, "custom_ax": 15, "ignore_missing_sampl": 15, "fals": [15, 24, 34, 46, 51, 52], "ignore_pcoa_featur": 15, "mirror": 15, "arbitrari": [15, 45, 51], "travers": 15, "algorithm": [15, 30, 32, 52, 57], "port": 15, "happen": [15, 16, 30, 32, 51], "unfamilar": 16, "suppos": [16, 50, 52], "utensil": 16, "imagin": [16, 31, 42], "mine": [16, 51, 54], "intellig": 16, "grasp": 16, "consider": [16, 38, 48], "ask": 16, "blith": 16, "tear": 16, "paper": [16, 52], "shred": 16, "mission": 16, "pencil": 16, "formal": [16, 53], "sai": [16, 30], "unshred": 16, "blank": [16, 48], "pen": 16, "accord": [16, 42], "refus": 16, "mismatch": [16, 50, 52], "constrain": 16, "fundament": [16, 52, 57], "lot": [16, 30, 39, 42, 45, 49, 50, 51, 54], "aris": [16, 30, 51], "freedom": [16, 51], "strict": 16, "power": [16, 42, 51, 52, 54], "great": [16, 42, 51, 54], "ture": 16, "cost": [16, 45], "ultim": [16, 54, 56, 57], "awai": [16, 45, 51], "imped": 16, "comprehens": 16, "good": [16, 39, 43, 50, 51, 52, 54, 55], "fuzzi": 16, "indistinct": 16, "world": [16, 57], "peopl": 16, "grammar": 16, "semantictyp": [16, 31, 46, 51], "spoon": 16, "chalk": 16, "register_semantic_typ": [16, 51], "awar": [16, 30, 45, 51], "dozen": 16, "straight": [16, 52, 54], "talk": 16, "broad": 16, "categori": 16, "far": [16, 32], "dine": 16, "field_nam": [16, 46], "field_memb": [16, 46], "And": [16, 43, 51, 54, 57], "cours": [16, 52], "explain": 16, "sinc": [16, 30, 35, 38, 45, 49, 50, 51, 52, 57], "silli": [16, 51, 56], "mix": [16, 57], "gross": 16, "traceback": 16, "stdin": 16, "home": [16, 18], "workspac": 16, "py": [16, 21, 39, 42, 49, 50, 51, 54], "68": 16, "__getitem__": 16, "_validate_field_": 16, "arg": [16, 18, 51, 52], "184": 16, "variant": [16, 30, 46], "varfield": 16, "menu": 16, "print": [16, 18, 42, 54], "combinator": 16, "satisfi": 16, "vocabulari": [16, 48], "ourselv": [16, 52], "obvious": 16, "true": [16, 19, 24, 46, 48, 52], "organ": [16, 26, 40, 51], "hierarchi": 16, "seper": 16, "someth": [16, 18, 30, 40, 43, 45, 50, 51, 52, 54, 57], "knife": 16, "variant_of": [16, 46], "earlier": [16, 31, 51, 52, 53], "invoc": 16, "ve": [16, 32, 37, 42, 51, 52, 56], "knive": 16, "belong": [16, 18], "kitchen": 16, "wouldn": [16, 18, 45, 52], "cook": 16, "steak": 16, "eat": 16, "chef": 16, "stori": 16, "spatula": 16, "pastrybag": 16, "pastri": 16, "bag": 16, "me": [16, 45, 50, 51, 52, 54, 56], "happi": [16, 54, 55], "birthdai": 16, "cake": 16, "suit": [16, 41, 54], "frost": 16, "flower": 16, "other_plugin": 16, "main": [16, 18, 48, 50, 51], "match": [16, 21, 38, 39, 40, 46, 48, 50, 52], "trick": 16, "sleev": 16, "bool": [16, 31, 46], "float": [16, 46, 48, 51, 52], "str": [16, 24, 29, 33, 34, 35, 43, 45, 46, 48, 49, 50, 51, 54], "essenti": [16, 31, 39, 45, 51], "unicod": 16, "capit": 16, "counterpart": 16, "metadatacolumn": [16, 43, 46, 48], "numer": [16, 46, 48], "categor": [16, 46, 48], "Of": 16, "unless": [16, 18, 21, 33, 39, 40], "assert": [16, 42, 46], "banana": 16, "bound": 16, "possess": 16, "predic": 16, "Thats": 16, "anywai": 16, "boolean": [16, 52], "whether": [16, 30, 51, 52], "instanc": [16, 31, 32, 39, 42, 43, 51, 52], "dropdown": 16, "predetermin": 16, "variabl": [16, 18, 21, 24, 46, 50, 52, 54], "appl": [16, 40], "pear": 16, "grape": 16, "modulo": 16, "head": [16, 46, 50], "inspect": 16, "harder": 16, "checkbox": [16, 52], "mouth": 16, "best": [16, 45, 51, 52], "dialog": [16, 45], "programmat": 16, "transfer": 16, "to_ast": [16, 24], "json": [16, 24], "friendli": [16, 39, 52], "dump": 16, "indent": 16, "sort_kei": 16, "proport": 16, "inclusive_end": [16, 52], "leav": [16, 30, 50], "attach": 16, "cut": 16, "fillet": 16, "fish": 16, "pare": 16, "fruit": 16, "cutleri": 16, "uninterest": 16, "nomenclatur": 16, "lack": 16, "granular": 16, "perfect": 16, "extol": 16, "virtu": 16, "adopt": [16, 45, 51, 52], "consensu": 16, "slow": [16, 30, 32, 51, 52], "anyon": [16, 51], "recogn": [16, 52], "explicitli": [16, 31, 45], "sharp": 16, "exclud": [16, 39], "dull": 16, "substitut": 16, "supertyp": 16, "anywher": [16, 39, 43], "suffic": [16, 50], "test": [16, 26, 37, 39, 40, 44, 45, 55, 56, 57], "inequ": 16, "wherev": 16, "obviou": 16, "soup": 16, "come": [16, 27, 29, 30, 45, 49, 51, 52, 53, 54, 55, 57], "relationship": [16, 30], "unrel": 16, "mechan": [16, 45], "reserv": 16, "hash": 16, "evalu": [16, 18], "sophist": 16, "concis": 16, "extension": 16, "matter": [16, 32], "lengthi": 16, "sharp_fillet": 16, "dull_par": 16, "fanci": 16, "unabl": 16, "smaller": 16, "sharpen": 16, "intuit": [16, 52], "enforc": [16, 48], "consequ": 16, "unadorn": 16, "practic": [16, 45, 50, 51], "probabl": [16, 30, 42, 45, 51], "everyon": [16, 45], "simultan": [16, 18], "spork": 16, "nonetheless": 16, "somedai": 16, "invert": 16, "syntax": [16, 24, 31, 32, 52], "compound": 16, "bundl": 16, "nice": [16, 37, 44, 54], "resumpt": [17, 20], "administr": [18, 19], "slate": [18, 19, 26], "parsl": 18, "basi": [18, 30, 52], "suppli": 18, "vendor": 18, "toml": 18, "attempt": [18, 19, 42, 43, 51, 52], "psutil": 18, "cpu_count": 18, "written": [18, 21, 31, 35, 38, 39, 45, 48, 50, 51, 54], "strategi": [18, 38], "executor": 18, "threadpoolexecutor": 18, "max_thread": 18, "highthroughputexecutor": 18, "htex": 18, "max_work": 18, "localprovid": 18, "executor_map": 18, "some_act": 18, "parsel": 18, "adhoc": 18, "cluster": [18, 30], "setup": [18, 39, 46], "scale": [18, 50], "map": [18, 24, 32, 46, 48, 52, 54], "briefli": [18, 41, 51, 52], "job": [18, 30, 46], "thread": [18, 46], "ground": 18, "worker": 18, "tomlkit": 18, "dictionari": [18, 24, 31, 32, 39, 42, 46, 54], "middl": 18, "under": [18, 21, 26, 40, 45, 49, 52, 54], "beneath": 18, "unmap": 18, "instanti": [18, 24, 31, 32, 43, 51, 52, 54], "flag": [18, 19], "prioriti": [18, 45], "qiime2_config": 18, "filepath": [18, 46, 51], "conda_prefix": 18, "after": [18, 30, 40, 51, 52, 54, 56, 57], "referenc": [18, 31, 52], "overrid": [18, 46], "On": [18, 31, 51], "linux": [18, 40], "maco": [18, 40], "librari": [18, 32, 39, 42, 51, 52], "appdir": 18, "xdg": 18, "vari": [18, 32, 39, 45, 51], "take": [18, 21, 29, 30, 32, 33, 35, 38, 48, 49, 50, 51, 52, 53, 54], "parallel_config": 18, "get_config_from_fil": 18, "Or": [18, 52, 56], "elsewher": [18, 45], "path_to_config": 18, "parallelconfig": 18, "liter": [18, 42], "action_executor_map": 18, "your_qiime2_act": 18, "sure": [18, 30, 40, 42, 49, 51, 56], "_result": 18, "result1": 18, "result2": 18, "someexcept": 18, "block": [18, 42, 51], "eventu": 18, "resolv": 18, "proceed": 18, "lead": [18, 30, 45, 51], "caught": 18, "outsid": [18, 52], "tri": [18, 45, 51], "did": [18, 49, 51, 52], "concess": 18, "rerun": 19, "calcul": [19, 27, 39], "pool": 19, "poll": 19, "recycle_": 19, "sha1": 19, "plugin_act": 19, "succe": 19, "wish": [19, 42, 51], "past": [19, 49, 52], "guarante": [19, 45], "usabl": 19, "statement": [19, 42, 51, 52], "cache_path": 19, "create_pool": 19, "guid": [20, 26, 36, 40, 42, 44, 53, 54], "explan": [20, 26, 30, 36, 44, 51], "trait": 21, "diagram": 21, "v0": 21, "wild": 21, "alpha": [21, 27, 33, 35, 39, 42], "supersed": 21, "24": 21, "octob": 21, "2016": 21, "archiveformat": 21, "commit": [21, 38, 51, 54, 56], "bdc8a": 21, "introduc": [21, 30], "inherit": [21, 52], "modifi": [21, 52], "__init__": [21, 51], "predecessor": 21, "human": [21, 32, 50, 51, 52], "whole": [21, 45, 52], "root_uuid": 21, "ancestor_uuid": 21, "greater": [21, 52], "2017": 21, "changelog": 21, "4389a0b": 21, "alon": 21, "e072706": 21, "684b8b7": 21, "v2": 21, "variad": 21, "2018": 21, "00a294c": 21, "some_plugin": 21, "demultiplexed_seq": 21, "singlelanepersamplepairedendfastqdirfmt": 21, "q2_type": [21, 32, 52], "feature_data": [21, 52], "_transform": [21, 49, 51], "dnaiter": [21, 51, 52], "software_entri": 21, "fragment": 21, "insert": [21, 24, 46, 50, 52], "f95f324": 21, "checksum": 21, "md5sum": 21, "md5": 21, "414": 21, "md": [21, 43], "5a7118c14fd1bacc957ddf01e61491b7": 21, "333fd63a2b4a102e58e364f37cd98b74": 21, "4373b96f26689f78889caeb1fbb94090": 21, "faith_pd": 21, "cat1": 21, "jsonp": 21, "7a40cff7855daffa28d4082194bdf60": 21, "f6105891": 21, "2c00": 21, "4886": 21, "b733": 21, "6dada99d0c81": 21, "ae0d0e26da5b84a6c0722148789c51e0": 21, "v5": 21, "pend": [21, 41, 51], "submodul": [24, 46, 52], "add_plugin": 24, "act": [24, 54], "namespac": [24, 38], "tupl": [24, 32, 33], "namedtupl": 24, "attribut": [24, 31], "resultcollect": 24, "typeexpress": 24, "Will": 24, "parse_format": 24, "format_str": 24, "type_from_ast": 24, "ast": 24, "dict": [24, 31, 48, 52], "implementationerror": 24, "uninitializedpluginmanagererror": 24, "april": [26, 51, 55], "dai": 26, "13": [26, 55], "stai": 26, "date": 26, "throughout": [26, 52], "thorough": 26, "evelop": 26, "w": [26, 45, 46, 50], "ith": 26, "q": 26, "iim": 26, "dwq2": [26, 30, 39, 50, 51, 52, 54, 56], "split": [26, 30, 42], "yourself": [26, 31, 39, 43, 45, 56], "similarli": [26, 30, 51, 52], "target": [26, 37, 46, 54, 57], "lab": [26, 52, 56], "explor": [26, 35, 39, 50, 53, 54], "aid": 26, "scratch": 26, "seri": [26, 35, 48, 54], "thank": [26, 55], "misialq": 26, "nih": 26, "nation": 26, "institut": 26, "informat": 26, "technolog": 26, "grant": 26, "1u24ca248454": 26, "01": [26, 52], "daf2019": 26, "207342": 26, "chan": 26, "zuckerberg": 26, "czi": 26, "daf": 26, "advis": 26, "silicon": [26, 40], "vallei": 26, "foundat": 26, "doi": 26, "37921": 26, "862772dbrrej": 26, "funder": 26, "13039": 26, "100014989": 26, "myst": 26, "markdown": 26, "alfr": 26, "p": [26, 42, 50, 52], "sloan": 26, "cc": 26, "BY": 26, "nc": 26, "nd": 26, "flavor": 27, "rarefi": [27, 33, 51], "depth": 27, "thu": [27, 35], "incorpor": 27, "q2_divers": [29, 32, 33, 35, 39], "beta_phylogenet": [29, 32], "skbio": [29, 32, 34, 50, 51, 52, 54], "treenod": 29, "distancematrix": [29, 32, 33, 34, 51], "examin": 29, "register_funct": [29, 31, 32, 33, 35, 42, 43, 45, 50, 51, 52, 54], "choic": [29, 30, 32, 46, 56], "beta": [29, 32, 33, 39], "phylogenetic_metr": 29, "distance_matrix": [29, 32, 33], "begin": [29, 48, 51, 52, 57], "life": 29, "coerc": 29, "convers": 29, "overload": 30, "concept": [30, 52], "articl": [30, 51, 52, 54], "disambigu": 30, "commonli": [30, 43, 52], "third": 30, "frequent": [30, 54], "conclud": 30, "phrase": 30, "ram": 30, "unroot": [30, 51], "iq": 30, "effici": [30, 51], "familiar": [30, 39, 42, 43, 51, 56], "successfulli": [30, 42, 54], "independ": [30, 51], "regard": [30, 32], "program": 30, "delai": 30, "notif": [30, 57], "frustrat": [30, 45], "miss": [30, 43, 45, 48], "my": [30, 42, 45, 49, 50, 51, 52, 54, 56, 57], "weekend": 30, "ok": [30, 45, 50, 51], "hope": 30, "mondai": 30, "morn": 30, "left": 30, "fridai": 30, "wors": 30, "inappropri": 30, "messag": [30, 45, 48, 52, 56], "loudli": 30, "went": [30, 50], "told": 30, "quietli": 30, "realiz": [30, 46], "misinterpret": 30, "incorrect": 30, "quiet": [30, 52, 56], "failur": [30, 45, 51, 52], "detect": [30, 51], "everyth": [30, 40, 42, 45, 49, 50, 51, 52, 56], "wast": 30, "hour": 30, "publish": [30, 52, 57], "exemplifi": 30, "qualiti": [30, 52], "qual": 30, "sequenceswithqu": 30, "count": [30, 32, 50], "bacteri": 30, "genera": 30, "panda": [30, 35, 43, 48], "datafram": [30, 43, 45, 48], "duplicate_t": [30, 52], "pd": [30, 35, 43, 45, 48], "discoveri": [30, 45], "potenti": 30, "treat": [30, 48], "especi": 30, "video": 30, "sorri": 30, "singlednasequ": [30, 49, 51, 54], "singular": 31, "es": 31, "dummy_plugin": 31, "example_funct": 31, "int_list": 31, "singleint": 31, "int_dict": 31, "bool_list": 31, "bool_dict": 31, "NOT": 31, "fact": [31, 52], "reach": [31, 42, 45, 51], "incompat": [31, 57], "forum": [31, 39, 45, 51, 52, 54, 55], "wrapper": 31, "de": 31, "facto": 31, "correspond": [31, 32, 48, 51, 52], "foo": 31, "bar": 31, "strip": 31, "gave": 31, "empti": [31, 45], "os": [31, 50], "item": [31, 52], "mypi": 32, "ordinationresult": 32, "number_of_dimens": 32, "adher": 32, "contract": 32, "pcoaresult": [32, 33], "rang": [32, 33, 46, 51, 52], "input_descript": [32, 33, 35, 45, 50, 52], "distanc": [32, 33, 43, 51], "matrix": [32, 33, 51], "parameter_descript": [32, 33, 35, 43, 45, 50, 52], "dimens": 32, "eigenvector": 32, "eigenvalu": 32, "influenc": 32, "eigendecomposit": 32, "scipi": 32, "eigh": 32, "exact": 32, "manner": [32, 43], "matric": 32, "fast": 32, "heurist": 32, "fsvd": 32, "suffer": 32, "degre": 32, "accuraci": 32, "loss": 32, "magnitud": 32, "output_descript": [32, 33, 35, 45, 52], "princip": 32, "legendrelegendr": 32, "halko2011": 32, "readabl": [32, 50], "stitch": 33, "ctx": 33, "get_act": 33, "make_artifact": 33, "view_typ": [33, 49], "import_data": [33, 42, 49, 54], "core_metr": 33, "n_job": 33, "feature_t": [33, 42, 45], "emperor_plot": 33, "rarefied_t": 33, "append": 33, "observed_otu": 33, "shannon": 33, "pielou_": 33, "dm": 33, "jaccard": 33, "braycurti": 33, "beta_result": 33, "pcoa_result": 33, "jaccard_emperor": 33, "observed_otus_vector": 33, "alphadivers": [33, 35, 42], "shannon_vector": 33, "evenness_vector": 33, "jaccard_distance_matrix": 33, "bray_curtis_distance_matrix": 33, "jaccard_pcoa_result": 33, "bray_curtis_pcoa_result": 33, "bray_curtis_emperor": 33, "total": [33, 46], "sklearn_n_jobs_descript": 33, "vector": [33, 35, 42], "otu": 33, "pielou": 33, "brai": 33, "curti": 33, "short": [34, 50], "convent": [34, 39, 42, 51, 52, 54], "plugin_setup": [34, 39, 42, 50, 51, 54], "lsmatformat": 34, "register_transform": [34, 43, 49, 51], "_1": [34, 43, 51], "ff": [34, 49, 51, 54], "lsmat": 34, "_2": [34, 49, 51], "verifi": [34, 50], "analyt": [35, 51], "statist": [35, 39], "output_dir": [35, 43, 50], "extens": [35, 36, 51], "textual": 35, "alpha_group_signific": 35, "alpha_divers": 35, "comparison": 35, "kruskal1952us": 35, "abil": [36, 51], "unitl": 36, "comfort": [37, 40, 56, 57], "plai": [37, 44, 53], "collis": 38, "toler": 38, "deploi": [38, 54], "offend": 38, "concurr": 38, "emploi": [38, 50], "circular": 38, "3rd": 38, "parti": 38, "establish": 38, "compabl": 38, "cutadapt": [38, 43], "taxa": 38, "subcommand": 38, "exclus": [38, 42, 46, 53], "setuptool": 39, "anaconda": 39, "pypi": 39, "straightforward": 39, "connect": 39, "100": 39, "standalon": 39, "quit": 39, "bigger": [39, 50], "__version__": [39, 52], "short_descript": [39, 46], "space": 39, "punctuat": 39, "uppercas": 39, "charact": [39, 48, 50, 51, 52], "underscor": [39, 42], "brief": [39, 51, 52], "user_support_text": [39, 46], "tracker": [39, 55], "stackoverflow": 39, "mail": 39, "habit": 39, "monitor": 39, "entry_point": 39, "suitabl": 40, "window": 40, "subsystem": 40, "wsl": 40, "assit": 40, "miniconda": 40, "copi": [40, 49, 52, 56], "wget": 40, "raw": [40, 51], "githubusercont": 40, "yml": 40, "env": [40, 52], "q2dev": 40, "rm": [40, 52], "ubuntu": 40, "conda_subdir": 40, "osx": 40, "64": 40, "config": 40, "subdir": 40, "info": [40, 56], "18": 40, "dev0": 40, "15": [40, 54], "g8ac7e3": 40, "g7cf7a7a": 40, "g1827eab": 40, "gregcaporaso": 40, "miniconda3": [40, 52], "var": 40, "visit": 40, "oppos": [40, 51], "stage": [40, 51, 52], "hack": [40, 42], "sake": 40, "grab": 40, "ci": 40, "recip": 40, "meta": [40, 50], "blob": 40, "pytest": [40, 42], "flake8": 40, "okai": 40, "placehold": 41, "har": [41, 46], "repetit": 41, "testpluginbas": [41, 42, 46, 50, 51, 52, 54], "sapienn": 41, "upda": 42, "inject": 42, "executionusag": 42, "disregard": 42, "face": [42, 51, 54], "artifactapiusag": [42, 54], "side": [42, 46], "unnecessarili": 42, "numpi": 42, "np": [42, 48], "ft1_factori": 42, "o1": 42, "o2": 42, "s1": [42, 52], "s2": [42, 52], "s3": 42, "prefix": [42, 46], "reimplement": 42, "meet": [42, 54], "feature_table_merge_exampl": 42, "feature_table1": 42, "init_artifact": [42, 54], "feature_table2": 42, "ft2_factori": 42, "merged_t": 42, "usageact": [42, 54], "plugin_id": [42, 54], "action_id": [42, 54], "usageinput": [42, 54], "usageoutputnam": [42, 54], "proxi": 42, "beyond": 42, "meaning": [42, 45], "identity_with_metadata_column_get_mdc": 42, "variadic_input_simpl": 42, "feature_table_merge_three_tables_exampl": 42, "q2_feature_t": 42, "i_tabl": 42, "keyword": 42, "three_tabl": 42, "wonder": 42, "execute_exampl": [42, 54], "usagevari": 42, "smoke": 42, "observed_features_exampl": 42, "ft": 42, "unpack": 42, "usageoutput": 42, "a_div_vector": 42, "diversity_lib": 42, "observed_featur": 42, "obs_feat_vector": 42, "assert_output_typ": 42, "easiest": [42, 55, 56], "unittest": [42, 46], "dedic": 42, "flexilib": 42, "properli": 42, "clunki": [42, 50, 51, 52], "exp": 42, "assert_has_line_match": 42, "cleaner": 42, "pretend": 42, "wrote": [42, 49, 50, 51, 53], "came": 42, "latest": 42, "reinstal": 42, "refresh": [42, 50, 51, 52, 56], "curiou": 42, "overlap_method": 42, "feature_table3": 42, "overlap": 42, "sum": [42, 51], "clever": 42, "infer": [42, 43, 52], "ag": 43, "elev": 43, "bodi": [43, 50, 51], "ph": 43, "unifi": 43, "consum": [43, 45], "longitudin": 43, "volatil": 43, "tabul": 43, "regroup": 43, "partit": 43, "pivot": 43, "subject": 43, "verif": 43, "my_viz": 43, "df": [43, 51], "to_datafram": [43, 48], "demux": 43, "emp": 43, "numericmetadatacolumn": [43, 48], "categoricalmetadatacolumn": [43, 48], "cell": 43, "numeric_md_col": 43, "column_typ": 43, "categorical_md_col": 43, "euclidean": 43, "elig": 43, "cast": [43, 48, 54], "utlit": 43, "amongst": 43, "has_missing_valu": 43, "drop_missing_valu": 43, "filter_column": 43, "queri": 43, "get_id": 43, "excit": [43, 54], "opportun": [43, 45], "cool_project": 43, "interestingdataformat": 43, "searchabl": 43, "sortabl": 43, "cool": [43, 45, 49, 52], "immutablemetadata": 43, "obtain": [43, 48], "conclus": [44, 57], "recur": 45, "ineffect": 45, "risk": 45, "counterproduct": 45, "decemb": 45, "speak": 45, "pai": 45, "promis": 45, "somewher": 45, "y": 45, "replay": 45, "weird": 45, "continu": [45, 51], "prototyp": [45, 52], "extern": 45, "worth": [45, 52, 57], "my_act": 45, "taxonomi": [45, 52], "an_input_filepath": 45, "an_output_filepath": 45, "inf": 45, "outf": 45, "dummi": 45, "featuredata": [45, 50, 51, 52], "dummy_output": 45, "circumv": 45, "circumst": 45, "correctli": [45, 50], "upload": 45, "unreli": 45, "broadli": [45, 54], "downstream": 45, "unambigu": [45, 51], "confid": 45, "workflow": [45, 53, 57], "expertis": [45, 54], "upfront": 45, "mynewformat": 45, "remot": 45, "costli": 45, "crash": 45, "burn": 45, "obscur": [45, 49, 51], "gone": 45, "walk": [45, 57], "neg": [45, 52], "differec": 45, "bad": [45, 51], "phone": 45, "app": 45, "buggi": 45, "realiti": 45, "meaningless": 45, "misinform": 45, "major": [45, 50, 51], "repercuss": 45, "retract": [45, 52], "scientif": 45, "clinic": [45, 52], "misdiagnos": 45, "blame": 45, "big": [45, 54], "But": [45, 51, 52], "project_nam": 46, "citation_text": 46, "variantfield": 46, "privat": [46, 51, 52], "is_semantic_typ": 46, "inclus": 46, "typemap": 46, "typematch": 46, "citationrecord": 46, "get_available_cor": 46, "n_less": 46, "methodnam": 46, "runtest": 46, "testcas": 46, "helper": [46, 49, 51, 54], "test_dir_prefix": 46, "temporari": [46, 52], "dir": [46, 52, 56], "assertregisteredsemantictyp": [46, 51], "semantic_typ": 46, "assertsemantictyperegisteredtoformat": 46, "exp_format": 46, "get_data_path": [46, 51, 52], "get_transform": [46, 49], "from_typ": [46, 52], "to_typ": [46, 52], "deliber": 46, "machineri": [46, 51], "condit": [46, 52], "tranform": 46, "runner": 46, "__super__": 46, "overridden": 46, "teardown": 46, "transform_format": [46, 51], "source_format": 46, "mutual": 46, "ob": 46, "assert_no_nans_in_t": 46, "nan": [46, 48], "reset": 46, "column_missing_schem": 48, "default_missing_schem": 48, "tabular": 48, "natur": [48, 54, 57], "focus": [48, 52], "roundtripp": 48, "pound": 48, "comment": 48, "row": 48, "spec": 48, "retriev": 48, "gain": 48, "preserv": 48, "insdc": 48, "lower": 48, "header": 48, "dtype": 48, "vs": [48, 56], "omit": 48, "missing_schem": 48, "docstr": [48, 52], "treatment": [48, 52], "metadatafileerror": 48, "include_suffix": 48, "role": 49, "_exampl": [49, 54], "sentenc": 49, "_create_seq_artifact": [49, 54], "seq": [49, 51, 52, 54], "converst": 49, "scene": 49, "infrequ": 49, "refactor": 49, "trivial": 49, "tend": [49, 54], "recal": [49, 51], "aritfact": 49, "seq1_factori": [49, 54], "aaccggttggccaa": [49, 54], "seq1": [49, 51, 52, 54], "seq2_factori": [49, 54], "aaccgctggcgaa": [49, 54], "seq2": [49, 51, 52, 54], "hood": [49, 54], "singlerecorddnafastadirectoryformat": [49, 51], "delet": [49, 52, 56], "test_transform": [49, 51], "test_dna_to_single_record_fasta_simple1": 49, "in_": 49, "accggtggaaccggtaacacccac": [49, 51, 52], "tx": 49, "trip": 49, "assertequ": [49, 51, 52], "test_dna_to_single_record_fasta_simple2": 49, "accggtaaccggttaacacccac": [49, 51, 52], "lesson": [50, 52], "tabularmsa": [50, 51, 52], "minimum": 50, "flexibl": [50, 51, 54], "luckili": 50, "scikit": [50, 51, 52], "bio": [50, 51, 52], "__repr__": 50, "crude": 50, "vizual": 50, "_visual": 50, "q2_dwq2": [50, 51, 52, 54], "summarize_align": 50, "msa": [50, 51, 52, 54], "join": [50, 55], "_html_templat": 50, "repr": 50, "doctyp": 50, "lang": 50, "en": 50, "charset": 50, "utf": 50, "viewport": 50, "width": 50, "devic": 50, "style": 50, "pad": 50, "20px": 50, "font": 50, "famili": 50, "courier": 50, "monospac": 50, "pre": 50, "viusal": 50, "hint": [50, 51, 52, 54], "sweet": 50, "replac": [50, 52, 54], "test_visu": 50, "summarizealignmenttest": 50, "test_simple1": [50, 51, 52], "aligned_sequence1": [50, 52], "aaaaaaaaggtggcctttttttt": [50, 52], "aligned_sequence2": [50, 52], "aaaaaaaagg": [50, 52], "ggcctttttttt": [50, 52], "assertin": 50, "nw_align": [50, 51, 52, 54], "tricker": 50, "fragil": 50, "substr": 50, "bunch": [50, 52, 56], "stuck": [50, 51], "alignedsequ": [50, 52], "summar": [50, 53, 54], "nw": [50, 52, 53], "stat": 50, "25": [50, 54], "accggtggaaccgg": [50, 52], "taacacccac": [50, 52], "accggt": [50, 52], "aaccggttaacacccac": [50, 52], "mention": [50, 51, 52, 54], "longer": [50, 51, 52], "80": 50, "spend": 50, "nicer": 50, "mayb": 50, "color": 50, "nucleotid": [50, 52], "gap": [50, 52], "encount": 51, "ecosystem": 51, "suboptim": 51, "weren": 51, "ones": [51, 52], "nexu": 51, "inher": 51, "bowtie2index": 51, "No": 51, "brackendb": 51, "symmetr": 51, "alignedproteinsequ": 51, "identfii": 51, "alignedrnasequ": 51, "explanatori": 51, "opaqu": 51, "meantim": 51, "strug": 51, "background": [51, 52], "unnecessari": 51, "_types_and_format": 51, "singlerecorddnafastaformat": [51, 54], "succeed": 51, "whatsoev": 51, "extrem": 51, "maxim": 51, "trade": 51, "perciev": 51, "against": 51, "sneak": 51, "entireti": 51, "presum": 51, "creator": 51, "offens": 51, "tediou": 51, "prone": 51, "bore": 51, "mistak": 51, "digress": 51, "get_sequence_id": 51, "io": 51, "unrecognizedformaterror": 51, "_confirm_single_record": 51, "disabl": 51, "iupac": 51, "control": 51, "seq_num": 51, "_confirm_acgt_onli": 51, "n_char": 51, "validation_seq": 51, "validation_seq_len": 51, "len": 51, "non_definite_chars_count": 51, "acgt": 51, "validation_level_to_n_char": 51, "50": 51, "__all__": 51, "reorgan": 51, "register_format": 51, "artifactclass": 51, "register_artifact_class": 51, "toward": [51, 54], "modif": 51, "jargon": 51, "reciev": 51, "demutiplex": 51, "put": [51, 52], "global_pairwise_align_nucleotid": [51, 52], "_transform_singlerecorddnafastaformat_to_dna": 51, "_3": 51, "_4": 51, "importlib": 51, "import_modul": 51, "mostli": 51, "test_types_and_format": 51, "singlednasequencetest": 51, "test_semantic_type_registr": 51, "singlerecorddnafastaformattest": 51, "thermophili": 51, "rrna": 51, "fn": 51, "fp": 51, "test_invalid_default_valid": 51, "assertraisesregex": 51, "171": 51, "test_invalid_max_valid": 51, "test_invalid_min_valid": 51, "singlednasequencetransformertest": 51, "test_single_record_fasta_to_dna_simple1": 51, "test_single_record_fasta_to_dna_simple2": 51, "14": 51, "23": [51, 52], "51": 51, "hopefulli": 51, "conceptu": 51, "diff": 51, "test_method": [51, 52], "test_simple2": [51, 52], "oversight": 51, "_method": [51, 52], "gap_open_penalti": [51, 52], "gap_extend_penalti": [51, 52], "match_scor": [51, 52], "mismatch_scor": [51, 52], "biopython": 51, "blast": 52, "genom": 52, "assembl": 52, "molecular": 52, "environment": 52, "evolut": 52, "score": 52, "penalti": 52, "incur": 52, "counter": 52, "adjust": 52, "accordingli": 52, "convei": 52, "copyright": 52, "bsd": 52, "licens": 52, "ultipl": 52, "equenc": 52, "lignment": 52, "odd": 52, "stem": 52, "reassign": 52, "varriabl": 52, "unus": 52, "unusu": 52, "workaround": 52, "nearli": 52, "paperpil": 52, "endnot": 52, "googl": 52, "scholar": 52, "favorit": 52, "needleman1970gener": 52, "saul": 52, "christian": 52, "journal": 52, "biologi": 52, "volum": 52, "elsevi": 52, "bibtext": 52, "needleman1970": [52, 54], "inclusive_start": 52, "aligned_sequ": [52, 54], "fall": 52, "lookup": 52, "prompt": [52, 56], "cap": 52, "post": 52, "miscellan": [52, 56], "unspecifi": [52, 56], "verbos": [52, 56], "stdout": [52, 56], "stderr": [52, 56], "silenc": [52, 56], "golden": [52, 56], "ipython": [52, 54], "session": 52, "lib": 52, "python3": 52, "implic": 52, "angri": 52, "someon": 52, "medic": 52, "41": 52, "seriou": 52, "convinc": [52, 54], "reconsid": 52, "antipattern": 52, "nwaligntest": 52, "sequence1": 52, "sequence2": 52, "aaaaaaaaggggcctttttttt": 52, "clear": [52, 56], "game": 52, "hypothes": 52, "minor": 52, "variat": 52, "edg": 52, "boundari": 52, "increas": 52, "revis": 52, "17": 52, "report": 52, "said": 52, "pain": 52, "assertnotequ": 52, "test_alt_match_scor": 52, "aaaattt": 52, "aaaaggttt": 52, "aaaa": 52, "ttt": 52, "test_alt_gap_open_penalti": 52, "tt": 52, "aaaag": 52, "gttt": 52, "test_alt_gap_extend_penalti": 52, "001": 52, "test_alt_mismatch_scor": 52, "aaa": 52, "attt": 52, "shape": 52, "peek": [52, 54], "cat": 52, "smith": 52, "waterman": 52, "sw": 52, "local_pairwise_align_nucleotid": 52, "computation": 53, "expens": 53, "dissemin": 54, "abstractli": 54, "shell": 54, "q2galaxi": 54, "documentat": 54, "honor": 54, "tempfil": 54, "am": 54, "remind": 54, "myself": 54, "incident": 54, "bother": 54, "usagedriv": 54, "addion": 54, "nw_align_example_1": 54, "dwq2_action": 54, "assess": 54, "test_exampl": 54, "usageexampletest": 54, "06": 54, "guidelin": 54, "modestli": 54, "laptop": 54, "credit": 54, "popular": 54, "fun": 54, "folk": 54, "cookiecutt": [55, 56], "gh": 56, "fill": 56, "75": 56, "editor": 56, "poke": 56, "congratul": 56, "earli": 57, "quot": 57, "tranch": 57, "substanti": 57, "temptat": 57, "immedi": 57, "caveat": 57, "suffici": 57, "progress": 57, "necessit": 57, "guidanc": 57}, "objects": {"qiime2.metadata": [[48, 0, 1, "", "CategoricalMetadataColumn"], [48, 0, 1, "", "Metadata"], [48, 0, 1, "", "MetadataColumn"], [48, 0, 1, "", "MetadataFileError"], [48, 0, 1, "", "NumericMetadataColumn"]], "qiime2.plugin": [[46, 0, 1, "", "BinaryFileFormat"], [46, 0, 1, "", "Bool"], [46, 0, 1, "", "Categorical"], [46, 0, 1, "", "Choices"], [46, 0, 1, "", "CitationRecord"], [46, 0, 1, "", "Citations"], [46, 0, 1, "", "Collection"], [46, 0, 1, "", "DirectoryFormat"], [46, 0, 1, "", "End"], [46, 0, 1, "", "Float"], [46, 0, 1, "", "Int"], [46, 0, 1, "", "Jobs"], [46, 0, 1, "", "List"], [46, 0, 1, "", "Metadata"], [46, 0, 1, "", "MetadataColumn"], [46, 0, 1, "", "Numeric"], [46, 0, 1, "", "Plugin"], [46, 0, 1, "", "Properties"], [46, 0, 1, "", "Range"], [46, 0, 1, "", "SemanticType"], [46, 0, 1, "", "Set"], [46, 0, 1, "", "Start"], [46, 0, 1, "", "Str"], [46, 0, 1, "", "TextFileFormat"], [46, 0, 1, "", "Threads"], [46, 0, 1, "", "TypeMap"], [46, 0, 1, "", "TypeMatch"], [46, 0, 1, "", "ValidationError"], [46, 0, 1, "", "Visualization"], [46, 0, 1, "", "get_available_cores"], [46, 1, 0, "-", "testing"]], "qiime2.plugin.testing": [[46, 2, 1, "", "TestPluginBase"], [46, 0, 1, "", "assert_no_nans_in_tables"]], "qiime2.plugin.testing.TestPluginBase": [[46, 3, 1, "", "assertRegisteredSemanticType"], [46, 3, 1, "", "assertSemanticTypeRegisteredToFormat"], [46, 3, 1, "", "get_data_path"], [46, 3, 1, "", "get_transformer"], [46, 4, 1, "", "package"], [46, 3, 1, "", "setUp"], [46, 3, 1, "", "tearDown"], [46, 4, 1, "", "test_dir_prefix"], [46, 3, 1, "", "transform_format"]], "qiime2.sdk": [[24, 0, 1, "", "Action"], [24, 0, 1, "", "Artifact"], [24, 0, 1, "", "Citations"], [24, 0, 1, "", "Context"], [24, 0, 1, "", "ImplementationError"], [24, 0, 1, "", "Method"], [24, 0, 1, "", "Pipeline"], [24, 0, 1, "", "PluginManager"], [24, 0, 1, "", "Result"], [24, 0, 1, "", "ResultCollection"], [24, 0, 1, "", "Results"], [24, 0, 1, "", "UninitializedPluginManagerError"], [24, 0, 1, "", "ValidationError"], [24, 0, 1, "", "Visualization"], [24, 0, 1, "", "Visualizer"], [24, 0, 1, "", "parse_format"], [24, 0, 1, "", "parse_type"], [24, 0, 1, "", "type_from_ast"]]}, "objtypes": {"0": "py:function", "1": "py:module", "2": "py:class", "3": "py:method", "4": "py:attribute"}, "objnames": {"0": ["py", "function", "Python function"], "1": ["py", "module", "Python module"], "2": ["py", "class", "Python class"], "3": ["py", "method", "Python method"], "4": ["py", "attribute", "Python attribute"]}, "titleterms": {"list": 0, "work": 0, "cite": 0, "index": 1, "glossari": 2, "back": 3, "matter": 3, "distribut": [4, 40], "develop": [4, 5, 6, 16, 18, 20, 23, 24, 26, 40, 44, 45, 46, 51], "document": [5, 7], "doc": 6, "user": 7, "plan": 7, "refactor": 7, "contribut": [7, 26, 40], "current": 7, "qiim": [8, 10, 18, 19, 26, 27, 39, 40, 41, 48, 57], "2": [8, 10, 18, 19, 21, 26, 27, 39, 40, 41, 57], "architectur": 8, "overview": [8, 39], "detail": 8, "compon": 8, "diagram": 8, "follow": 8, "A": [8, 43, 52, 57], "command": [8, 18, 19, 31, 54], "through": [8, 18, 19], "summari": 8, "anatomi": 9, "an": [9, 16, 31, 39, 50, 51, 52], "archiv": [9, 21], "The": [9, 15, 18, 24, 31, 46, 48], "most": 9, "import": [9, 51], "file": [9, 11, 15, 18, 30, 43, 51], "metadata": [9, 10, 43, 46, 48], "yaml": [9, 15], "data": [9, 10, 15, 30, 42, 54], "goe": 9, "In": 9, "proven": [9, 10, 15], "why": [9, 15], "zip": 9, "rule": 9, "identifi": 9, "how": [10, 17, 29, 37, 38, 41, 43], "store": 10, "goal": 10, "storag": 10, "access": 10, "transfer": 10, "input": [10, 24, 31, 45, 46, 54], "valid": [10, 11, 36, 45], "type": [10, 11, 16, 27, 30, 46, 51], "check": 10, "interoper": 10, "extens": 10, "format": [11, 21, 30, 36, 45, 46, 51], "directori": [11, 51], "text": 11, "binari": 11, "fix": 11, "layout": 11, "variabl": 11, "singl": 11, "associ": 11, "garbag": 12, "collect": [12, 31], "framework": [13, 20], "explan": [13, 28], "metaprogram": 14, "decentr": 15, "retrospect": 15, "track": 15, "captur": 15, "what": [15, 52], "action": [15, 24, 27, 31, 46, 50, 52], "execut": 15, "block": 15, "uniqu": 15, "id": 15, "environ": [15, 26, 40], "pipelin": [15, 18, 19, 33, 53], "exampl": [15, 41, 42, 54], "take": [15, 31], "awai": 15, "semant": [16, 30, 51], "primit": [16, 46], "visual": [16, 35, 43, 50], "analog": 16, "defin": [16, 36, 39, 42, 49, 51, 52, 54], "extend": 16, "refin": 16, "choic": 16, "interfac": [16, 18, 19, 23, 24, 31, 54], "note": [16, 18], "rang": 16, "properti": 16, "subtyp": 16, "union": 16, "intersect": 16, "guid": [17, 37, 57], "parallel": 18, "configur": 18, "usag": [18, 42, 54], "config": 18, "us": [18, 29, 31, 43, 51], "line": [18, 19, 31, 54], "cli": [18, 19, 31], "user_config_dir": 18, "site_config_dir": 18, "python": [18, 19, 31, 50, 52, 54], "3": [18, 19, 21, 52, 54], "api": [18, 19, 24, 31, 43, 46, 48, 52, 54], "resumpt": 19, "version": [21, 40], "agnost": 21, "guarante": 21, "0": 21, "1": 21, "4": 21, "5": 21, "6": 21, "7": 21, "refer": [22, 24, 25, 47], "pluginmanag": 24, "object": [24, 30, 31, 39, 46], "output": [24, 31, 43, 45, 46], "util": [24, 46], "function": [24, 32, 33, 35, 46, 50, 52], "citat": [24, 46, 52], "except": [24, 46, 48], "set": [26, 40], "up": [26, 40, 52], "your": [26, 39, 40, 50, 54, 56, 57], "statu": 26, "thi": [26, 52], "content": [26, 57], "acknowledg": 26, "get": 26, "help": [26, 43], "fund": 26, "licens": 26, "transform": [29, 34, 49, 51], "ar": 29, "plugin": [29, 38, 39, 40, 41, 44, 45, 46, 50, 52, 56, 57], "artifact": [30, 31, 43, 51], "class": [30, 48, 51], "put": 30, "togeth": 30, "regist": [31, 32, 33, 34, 35, 39, 42, 50, 51, 52, 54], "return": 31, "resultcollect": 31, "init": 31, "load": 31, "save": 31, "creat": [32, 33, 34, 35, 56], "method": [32, 52], "differ": 36, "level": 36, "To": 37, "plai": 38, "nice": 38, "other": [38, 40], "instanti": 39, "entri": 39, "point": 39, "instal": 40, "prerequisit": 40, "latest": 40, "tini": 40, "activ": 40, "conda": 40, "next": 40, "step": [40, 57], "build": [40, 57], "first": [40, 50, 52, 53, 57], "exist": 40, "amplicon": 40, "metagenom": 40, "test": [41, 42, 46, 49, 50, 51, 52, 54], "write": [42, 50, 52, 54], "factori": 42, "try": [42, 52], "out": 42, "comment": 42, "can": [42, 43], "provid": [42, 45], "context": 42, "column": [43, 48], "numer": 43, "categor": 43, "me": 43, "merg": 43, "drop": 43, "empti": 43, "normal": 43, "tsv": 43, "advanc": 43, "filter": 43, "sql": 43, "make": [43, 51], "viewabl": 43, "free": 43, "gener": 43, "from": [43, 49, 56], "anti": 45, "pattern": 45, "filepath": 45, "paramet": 45, "skip": 45, "semat": 46, "modifi": 46, "support": 46, "qiime2": 48, "add": [49, 50, 51, 52, 53, 54], "second": [49, 52], "tl": [49, 50, 51, 52, 54], "dr": [49, 50, 51, 52, 54], "skbio": 49, "dna": 49, "q2_dwq2": 49, "singlerecorddnafastaformat": 49, "unit": [49, 50, 51, 52], "new": [49, 51, 52], "transfom": 49, "option": [50, 51, 52, 54], "exercis": [50, 51, 52, 54], "discov": 51, "publicli": 51, "updat": 51, "nw": [51, 54], "align": [51, 52, 54], "real": 52, "pairwis": 52, "sequenc": 52, "wrapper": 52, "plugin_setup": 52, "py": 52, "call": 52, "q2cli": 52, "our": 52, "few": 52, "addit": 52, "wrap": 52, "displai": 54, "autom": 54, "tutori": [54, 57], "conclus": 55, "templat": 56, "tabl": 57}, "envversion": {"sphinx.domains.c": 2, "sphinx.domains.changeset": 1, "sphinx.domains.citation": 1, "sphinx.domains.cpp": 6, "sphinx.domains.index": 1, "sphinx.domains.javascript": 2, "sphinx.domains.math": 2, "sphinx.domains.python": 3, "sphinx.domains.rst": 2, "sphinx.domains.std": 2, "sphinx.ext.intersphinx": 1, "sphinx.ext.viewcode": 1, "sphinxcontrib.bibtex": 9, "sphinx": 56}})
\ No newline at end of file
+Search.setIndex({"docnames": ["back-matter/bibliography", "back-matter/genindex", "back-matter/glossary", "back-matter/intro", "ci/intro", "docs/developer-documentation", "docs/intro", "docs/user-documentation", "framework/explanations/architecture", "framework/explanations/archives", "framework/explanations/data-storage", "framework/explanations/formats", "framework/explanations/garbage-collection", "framework/explanations/intro", "framework/explanations/metaprogramming", "framework/explanations/provenance", "framework/explanations/types", "framework/how-to-guides/intro", "framework/how-to-guides/parallel-configuration", "framework/how-to-guides/pipeline-resumption", "framework/intro", "framework/references/archive-versions", "framework/references/intro", "interfaces/intro", "interfaces/references/api", "interfaces/references/intro", "intro", "plugins/explanations/actions", "plugins/explanations/intro", "plugins/explanations/transformers", "plugins/explanations/types-of-types", "plugins/how-to-guides/artifact-collections-as-io", "plugins/how-to-guides/create-register-method", "plugins/how-to-guides/create-register-pipeline", "plugins/how-to-guides/create-register-transformer", "plugins/how-to-guides/create-register-visualizer", "plugins/how-to-guides/format-validation-levels", "plugins/how-to-guides/intro", "plugins/how-to-guides/play-nicely-with-others", "plugins/how-to-guides/register-a-plugin", "plugins/how-to-guides/set-up-development-environment", "plugins/how-to-guides/test-plugins", "plugins/how-to-guides/usage-examples", "plugins/how-to-guides/use-metadata", "plugins/intro", "plugins/references/antipatterns", "plugins/references/api", "plugins/references/intro", "plugins/references/metadata-api", "plugins/tutorials/add-2nd-transformer", "plugins/tutorials/add-alignment-visualizer", "plugins/tutorials/add-artifact-class", "plugins/tutorials/add-nw-align-method", "plugins/tutorials/add-pipeline", "plugins/tutorials/add-usage-examples", "plugins/tutorials/conclusion", "plugins/tutorials/create-from-template", "plugins/tutorials/intro"], "filenames": ["back-matter/bibliography.md", "back-matter/genindex.md", "back-matter/glossary.md", "back-matter/intro.md", "ci/intro.md", "docs/developer-documentation.md", "docs/intro.md", "docs/user-documentation.md", "framework/explanations/architecture.md", "framework/explanations/archives.md", "framework/explanations/data-storage.md", "framework/explanations/formats.md", "framework/explanations/garbage-collection.md", "framework/explanations/intro.md", "framework/explanations/metaprogramming.md", "framework/explanations/provenance.md", "framework/explanations/types.md", "framework/how-to-guides/intro.md", "framework/how-to-guides/parallel-configuration.md", "framework/how-to-guides/pipeline-resumption.md", "framework/intro.md", "framework/references/archive-versions.md", "framework/references/intro.md", "interfaces/intro.md", "interfaces/references/api.md", "interfaces/references/intro.md", "intro.md", "plugins/explanations/actions.md", "plugins/explanations/intro.md", "plugins/explanations/transformers.md", "plugins/explanations/types-of-types.md", "plugins/how-to-guides/artifact-collections-as-io.md", "plugins/how-to-guides/create-register-method.md", "plugins/how-to-guides/create-register-pipeline.md", "plugins/how-to-guides/create-register-transformer.md", "plugins/how-to-guides/create-register-visualizer.md", "plugins/how-to-guides/format-validation-levels.md", "plugins/how-to-guides/intro.md", "plugins/how-to-guides/play-nicely-with-others.md", "plugins/how-to-guides/register-a-plugin.md", "plugins/how-to-guides/set-up-development-environment.md", "plugins/how-to-guides/test-plugins.md", "plugins/how-to-guides/usage-examples.md", "plugins/how-to-guides/use-metadata.md", "plugins/intro.md", "plugins/references/antipatterns.md", "plugins/references/api.md", "plugins/references/intro.md", "plugins/references/metadata-api.md", "plugins/tutorials/add-2nd-transformer.md", "plugins/tutorials/add-alignment-visualizer.md", "plugins/tutorials/add-artifact-class.md", "plugins/tutorials/add-nw-align-method.md", "plugins/tutorials/add-pipeline.md", "plugins/tutorials/add-usage-examples.md", "plugins/tutorials/conclusion.md", "plugins/tutorials/create-from-template.md", "plugins/tutorials/intro.md"], "titles": ["List of works cited", "Index", "Glossary", "Back matter", "Distribution Development", "Developer documentation", "Docs Development", "User documentation", "QIIME 2 architecture overview", "Anatomy of an Archive", "How Data is Stored", "File Formats and Directory Formats", "Garbage Collection", "Framework explanations", "Metaprogramming", "Decentralized retrospective provenance tracking", "Semantic Types, Primitives, and Visualizations", "How-to guides", "Parallel configuration and usage in QIIME 2", "Pipeline Resumption in QIIME 2", "Framework Development", "Archive versions", "References", "Interface Development", "Interface developer API reference", "References", "Developing with QIIME 2", "Types of QIIME 2 Actions", "Explanations", "Transformers", "Semantic types, data types, file formats, and artifact classes", "Use Artifact Collections as Action inputs or outputs", "Create and register a Method", "Create and register a pipeline", "Creating and registering a Transformer", "Create and register a visualizer", "Defining different Format validation levels", "How-To Guides", "How to play nicely with other plugins", "Register a QIIME 2 plugin", "Set up your development environment", "How to test QIIME 2 plugins", "Writing Usage Examples", "How to use Metadata", "Plugin Development", "Plugin development anti-patterns", "Plugin developer API", "References", "qiime2.Metadata API", "Add a second transformer", "Add a first Visualizer", "Add a new Artifact Class", "Add a first (real) Method", "Add a first Pipeline", "Add a Usage Example", "Conclusion", "Create your plugin from a template", "Tutorial: A step-by-step guide to building your first QIIME 2 plugin"], "terms": {"1": [0, 11, 15, 16, 18, 26, 31, 32, 33, 42, 49, 50, 51, 52, 54], "daniel": [0, 57], "procida": [0, 57], "di\u00e1taxi": [0, 26, 57], "document": [0, 6, 8, 10, 15, 16, 18, 19, 20, 21, 26, 30, 31, 37, 39, 41, 42, 45, 48, 52, 54, 56, 57], "framework": [0, 2, 8, 9, 11, 14, 15, 16, 21, 26, 29, 36, 38, 39, 40, 42, 43, 45, 46, 52, 54], "url": [0, 26, 39], "http": [0, 7, 15, 21, 26, 39, 40, 48, 52], "diataxi": [0, 54], "fr": 0, "2": [0, 2, 5, 7, 9, 11, 12, 13, 15, 16, 17, 20, 24, 28, 29, 30, 31, 32, 33, 35, 36, 37, 38, 42, 43, 44, 45, 46, 48, 49, 50, 51, 52, 53, 54, 55, 56], "s": [0, 2, 5, 8, 9, 10, 11, 15, 16, 18, 19, 21, 26, 29, 30, 31, 32, 33, 34, 35, 38, 39, 42, 43, 45, 46, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57], "b": [0, 16, 52], "needleman": [0, 52], "c": [0, 16, 18, 45, 52], "d": [0, 5, 26, 32, 39, 50, 51, 52, 54, 56], "wunsch": [0, 52], "A": [0, 2, 9, 10, 11, 15, 16, 18, 21, 24, 26, 27, 31, 32, 33, 35, 39, 40, 42, 44, 46, 48, 49, 51, 55], "gener": [0, 2, 7, 8, 9, 10, 11, 15, 16, 18, 19, 24, 26, 27, 29, 30, 32, 35, 38, 42, 45, 49, 50, 51, 52, 54, 55, 57], "method": [0, 2, 11, 14, 15, 16, 21, 24, 27, 29, 31, 33, 35, 37, 38, 42, 43, 44, 45, 46, 48, 50, 51, 53, 54, 55, 56, 57], "applic": [0, 18, 32, 40, 48, 52, 54, 57], "search": [0, 51, 52], "similar": [0, 16, 24, 27, 33, 35, 50, 52, 54], "amino": [0, 52], "acid": [0, 52], "sequenc": [0, 2, 8, 10, 11, 30, 49, 50, 51, 54], "two": [0, 8, 11, 15, 16, 18, 30, 34, 35, 38, 42, 43, 45, 49, 51, 52, 54], "protein": [0, 2, 51, 52], "j": 0, "mol": 0, "biol": 0, "48": [0, 52], "3": [0, 2, 11, 15, 16, 32, 39, 40, 42, 48, 57], "443": [0, 52], "453": [0, 52], "march": [0, 2, 11], "1970": [0, 52], "gregori": 0, "caporaso": [0, 5, 26, 52, 56], "an": [0, 2, 8, 10, 11, 12, 13, 15, 18, 19, 20, 21, 24, 26, 29, 30, 32, 33, 34, 35, 37, 38, 41, 42, 43, 45, 48, 49, 54, 56], "introduct": [0, 2, 42, 52], "appli": [0, 2, 30, 32, 33, 45, 48, 49, 52, 57], "bioinformat": [0, 2, 51, 52, 57], "2nd": 0, "edit": [0, 7, 45, 51, 52], "2021": [0, 15], "readiab": 0, "org": [0, 7, 15, 21, 26, 40, 48, 52], "4": [0, 2, 9, 15, 18, 26, 51, 52], "david": 0, "thoma": 0, "andrew": 0, "hunt": 0, "The": [0, 2, 7, 8, 10, 11, 12, 14, 16, 19, 21, 26, 29, 30, 32, 33, 34, 35, 38, 39, 40, 42, 43, 45, 49, 50, 51, 52, 53, 54, 55, 56, 57], "pragmat": [0, 52], "programm": [0, 30, 52], "your": [0, 7, 16, 18, 19, 30, 31, 32, 35, 37, 38, 42, 43, 44, 45, 49, 51, 52, 53, 55], "journei": [0, 52], "masteri": [0, 52], "20th": [0, 52], "anniversari": [0, 52], "addison": 0, "weslei": 0, "profession": 0, "septemb": 0, "2019": [0, 21], "5": [0, 2, 11, 15, 16, 45, 51, 52], "christoph": 0, "r": [0, 7, 11, 16, 32, 45, 50, 51], "keef": 0, "matthew": 0, "dillon": 0, "elizabeth": 0, "gehret": 0, "chloe": 0, "herman": 0, "mari": 0, "jewel": 0, "colin": 0, "v": 0, "wood": 0, "evan": [0, 5, 16, 26], "bolyen": [0, 5, 26], "facilit": [0, 7, 10, 52], "reproduc": [0, 10, 15, 45], "qiim": [0, 2, 5, 7, 9, 11, 12, 13, 15, 16, 17, 20, 21, 24, 28, 29, 30, 31, 32, 33, 35, 36, 37, 38, 42, 43, 44, 45, 46, 49, 50, 51, 52, 53, 54, 55, 56], "proven": [0, 2, 7, 8, 13, 20, 21, 33, 45, 50, 56, 57], "replai": [0, 2, 7, 15, 45, 57], "plo": 0, "comput": [0, 2, 7, 10, 15, 16, 18, 30, 32, 33, 42, 43, 45, 51, 53, 54, 57], "19": 0, "11": [0, 15, 21, 40, 45], "e1011676": 0, "novemb": 0, "2023": [0, 7, 40, 45], "action": [2, 7, 8, 9, 10, 11, 14, 16, 18, 19, 21, 28, 29, 30, 33, 37, 38, 39, 42, 43, 44, 45, 48, 51, 53, 54, 56, 57], "term": [2, 10, 15, 27, 30, 48, 51, 52, 54], "describ": [2, 8, 9, 10, 11, 15, 16, 18, 21, 30, 32, 33, 35, 39, 40, 42, 45, 48, 49, 50, 51, 52, 54], "concret": [2, 16, 43, 46, 48], "visual": [2, 9, 10, 13, 15, 20, 21, 24, 27, 32, 33, 37, 39, 44, 46, 51, 52, 53, 54, 55, 57], "pipelin": [2, 17, 20, 21, 24, 27, 29, 37, 44, 57], "accept": [2, 5, 16, 27, 32, 33, 35, 42, 52, 56], "paramet": [2, 8, 10, 15, 16, 18, 19, 24, 27, 29, 31, 32, 33, 35, 39, 40, 42, 43, 46, 48, 50, 51, 52, 54, 56], "file": [2, 8, 10, 13, 16, 20, 21, 27, 28, 31, 32, 34, 35, 39, 40, 42, 44, 45, 46, 48, 49, 50, 52, 54, 56], "artifact": [2, 8, 9, 10, 11, 12, 14, 15, 16, 21, 24, 27, 28, 29, 32, 33, 34, 35, 37, 38, 42, 44, 45, 49, 50, 52, 53, 54, 56, 57], "metadata": [2, 15, 16, 21, 27, 33, 35, 37, 39, 42, 44, 47, 49, 50, 51, 54], "input": [2, 8, 9, 11, 12, 15, 16, 19, 21, 27, 29, 30, 32, 33, 34, 35, 37, 42, 43, 44, 50, 51, 52, 53, 56], "some": [2, 8, 9, 10, 11, 14, 15, 16, 18, 19, 21, 26, 27, 30, 32, 33, 35, 38, 39, 41, 42, 43, 45, 49, 50, 51, 52, 53, 54, 56, 57], "kind": [2, 8, 11, 16, 30, 43, 51], "output": [2, 11, 15, 16, 21, 27, 29, 30, 32, 33, 34, 35, 37, 42, 44, 50, 51, 52, 53, 54, 56], "archiv": [2, 8, 10, 11, 13, 15, 20, 22, 26, 30], "directori": [2, 9, 10, 12, 13, 15, 18, 20, 21, 30, 31, 40, 42, 50, 52, 54, 56], "structur": [2, 9, 10, 12, 15, 16, 21, 30, 32, 54, 56], "result": [2, 7, 8, 9, 15, 18, 19, 21, 24, 26, 30, 31, 32, 33, 35, 42, 43, 45, 49, 50, 51, 52, 54, 56], "contain": [2, 8, 9, 10, 11, 15, 16, 18, 26, 30, 31, 32, 33, 35, 39, 43, 45, 48, 51, 52, 54, 57], "least": [2, 11, 18, 30, 31, 35, 45, 48, 51], "root": [2, 9, 15, 21, 29, 30, 32, 42, 51], "name": [2, 8, 9, 10, 11, 15, 16, 18, 19, 21, 24, 31, 32, 33, 34, 35, 38, 39, 40, 42, 45, 46, 48, 50, 51, 52, 54], "uuid": [2, 9, 15, 21, 45, 56], "version": [2, 7, 8, 9, 10, 15, 20, 22, 39, 42, 45, 46, 51, 52], "within": [2, 7, 8, 9, 11, 15, 16, 21, 24, 29, 31, 38, 39, 42, 43, 48], "data": [2, 7, 8, 11, 12, 13, 16, 20, 21, 28, 29, 32, 34, 43, 44, 45, 46, 48, 50, 51, 52, 56, 57], "oper": [2, 10, 15, 16, 27, 30, 43, 45], "class": [2, 10, 11, 15, 16, 18, 21, 24, 28, 29, 31, 32, 34, 38, 41, 42, 43, 44, 45, 46, 49, 50, 52, 54, 57], "can": [2, 7, 8, 9, 10, 11, 12, 15, 16, 18, 19, 21, 26, 27, 29, 30, 31, 32, 33, 35, 36, 39, 40, 41, 45, 46, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57], "exist": [2, 10, 11, 15, 16, 18, 19, 30, 31, 32, 38, 43, 45, 51, 52], "thi": [2, 7, 8, 9, 10, 11, 12, 14, 15, 16, 18, 19, 20, 21, 24, 27, 29, 30, 31, 32, 33, 35, 36, 37, 38, 39, 40, 41, 42, 43, 45, 46, 48, 49, 50, 51, 53, 54, 55, 56, 57], "defin": [2, 8, 10, 11, 15, 18, 21, 24, 27, 29, 30, 31, 32, 33, 34, 35, 37, 40, 43, 44, 45, 46, 48, 50, 53, 57], "plugin": [2, 7, 8, 10, 11, 14, 15, 16, 19, 21, 26, 27, 30, 31, 32, 33, 34, 35, 37, 42, 43, 47, 48, 49, 51, 53, 54, 55], "develop": [2, 7, 8, 10, 11, 15, 21, 25, 30, 34, 36, 37, 38, 39, 42, 43, 47, 48, 49, 50, 52, 53, 54, 55, 56, 57], "associ": [2, 7, 15, 16, 21, 29, 30, 39, 45, 48, 49, 51, 52, 54, 56], "semant": [2, 8, 10, 11, 13, 20, 21, 24, 28, 32, 34, 38, 41, 44, 46, 57], "type": [2, 8, 9, 13, 15, 20, 21, 24, 28, 29, 31, 32, 33, 34, 35, 38, 40, 41, 42, 43, 44, 45, 48, 49, 50, 52, 54, 57], "format": [2, 8, 9, 10, 13, 15, 16, 20, 28, 29, 32, 34, 37, 38, 39, 41, 42, 43, 44, 48, 49, 50, 52, 54, 57], "when": [2, 7, 8, 9, 10, 11, 12, 15, 16, 18, 19, 21, 24, 29, 30, 31, 35, 38, 39, 42, 43, 45, 46, 48, 49, 50, 51, 52, 54, 56, 57], "regist": [2, 8, 10, 11, 15, 16, 21, 27, 29, 30, 37, 38, 43, 44, 45, 46, 49, 53], "api": [2, 8, 14, 15, 16, 23, 25, 26, 32, 33, 39, 42, 44, 45, 47, 49, 50, 51, 57], "see": [2, 8, 9, 10, 11, 15, 16, 21, 26, 29, 30, 32, 33, 35, 39, 40, 41, 42, 48, 49, 50, 51, 52, 54, 55, 56], "python": [2, 7, 8, 12, 14, 15, 16, 32, 34, 39, 40, 42, 45, 48, 51, 56, 57], "deploy": [2, 30, 38, 49], "instal": [2, 7, 10, 38, 39, 42, 49, 51, 54, 56], "well": [2, 7, 9, 10, 11, 15, 16, 30, 38, 43, 48, 49, 50, 51, 52, 57], "zero": [2, 16, 48, 52, 53], "more": [2, 8, 9, 10, 11, 12, 15, 16, 18, 19, 21, 26, 27, 30, 32, 33, 36, 37, 39, 41, 42, 43, 45, 46, 48, 49, 50, 51, 52, 53, 54, 55, 57], "interfac": [2, 7, 8, 10, 11, 15, 21, 25, 26, 27, 32, 39, 40, 42, 43, 45, 51, 52, 56, 57], "collect": [2, 13, 15, 16, 20, 21, 24, 33, 37, 42, 44, 46, 48, 51, 52], "distribut": [2, 7, 15, 18, 26, 39, 43, 45, 52], "object": [2, 8, 12, 14, 15, 16, 18, 29, 32, 33, 34, 35, 43, 48, 49, 50, 51, 52, 54], "subclass": [2, 21, 42, 48, 51, 54], "qiime2": [2, 7, 9, 11, 12, 14, 15, 16, 18, 19, 21, 24, 26, 32, 35, 39, 40, 41, 42, 43, 44, 45, 46, 47, 49, 50, 51, 52, 54, 56], "directoryformat": [2, 11, 46, 51], "repres": [2, 9, 10, 11, 15, 16, 21, 24, 30, 43, 48, 51, 52], "particular": [2, 8, 9, 10, 18, 43], "layout": [2, 10], "arbitrarili": 2, "nest": [2, 8, 15, 16], "sub": [2, 8, 33, 51], "how": [2, 7, 8, 9, 11, 13, 15, 16, 18, 20, 26, 30, 32, 34, 36, 39, 40, 42, 44, 45, 48, 50, 51, 52, 53, 54, 56, 57], "content": [2, 7, 9, 15, 30, 31, 42, 50, 51, 52, 55], "must": [2, 8, 11, 15, 16, 18, 21, 29, 31, 32, 33, 35, 39, 42, 46, 48, 51, 52], "ar": [2, 5, 7, 8, 9, 10, 11, 12, 14, 15, 16, 18, 19, 21, 24, 26, 27, 30, 31, 32, 33, 34, 35, 37, 38, 39, 40, 41, 42, 43, 45, 46, 48, 49, 50, 51, 52, 53, 54, 57], "design": [2, 9, 10, 29, 48, 49], "togeth": [2, 9, 11, 16, 21, 33, 51, 53], "These": [2, 7, 8, 9, 10, 11, 15, 16, 18, 21, 27, 29, 31, 32, 34, 39, 42, 45, 46, 48, 52, 54], "group": [2, 8, 16, 35, 54], "theme": 2, "For": [2, 10, 11, 12, 15, 16, 18, 21, 26, 27, 29, 30, 31, 32, 38, 39, 40, 42, 43, 45, 46, 48, 50, 51, 52, 54, 56], "exampl": [2, 7, 8, 9, 11, 12, 16, 21, 26, 27, 29, 30, 31, 32, 33, 34, 35, 37, 38, 39, 40, 43, 44, 45, 46, 48, 49, 50, 51, 52, 55, 56, 57], "amplicon": [2, 7, 43], "provid": [2, 8, 9, 10, 11, 12, 15, 16, 18, 19, 24, 26, 27, 29, 30, 31, 32, 33, 34, 35, 36, 37, 39, 40, 41, 43, 46, 48, 49, 50, 51, 52, 53, 54, 56, 57], "analysi": [2, 10, 15, 27, 32, 35, 52], "microbiom": [2, 7], "while": [2, 5, 9, 10, 11, 15, 16, 18, 30, 39, 40, 46, 50, 52, 53, 54, 57], "shotgun": [2, 40], "metagenom": 2, "which": [2, 7, 8, 9, 10, 11, 12, 14, 15, 16, 18, 21, 26, 29, 30, 31, 32, 33, 39, 40, 42, 43, 45, 46, 48, 50, 51, 52, 53, 54, 56, 57], "either": [2, 8, 16, 19, 30, 45, 48, 51, 52, 56], "textfileformat": [2, 11, 45, 46, 51], "binaryfileformat": [2, 11, 46], "process": [2, 7, 8, 12, 16, 18, 39, 42, 45, 51, 52], "valid": [2, 8, 15, 16, 31, 37, 43, 44, 46, 48, 51, 52, 54], "engin": [2, 45, 52], "orchestr": 2, "enabl": [2, 9, 10, 15, 19, 42, 43, 49, 50, 51, 52, 54], "function": [2, 8, 9, 11, 15, 16, 29, 30, 31, 34, 36, 39, 40, 42, 43, 45, 49, 51, 54, 57], "cohes": 2, "unit": [2, 39, 42, 54, 55, 56], "galaxi": [2, 45, 52, 54, 57], "browser": [2, 7, 45], "base": [2, 10, 11, 14, 18, 19, 24, 29, 30, 43, 45, 46, 48, 50, 51, 52, 54], "graphic": [2, 10, 16, 35, 45, 52], "us": [2, 7, 8, 9, 10, 11, 12, 14, 15, 16, 19, 21, 24, 26, 27, 30, 32, 33, 34, 35, 37, 38, 39, 40, 41, 42, 44, 45, 46, 48, 49, 50, 52, 53, 54, 56, 57], "access": [2, 9, 15, 24, 26, 32, 39, 45, 46, 48, 49, 50, 51, 52, 57], "other": [2, 5, 8, 9, 10, 11, 15, 16, 26, 27, 30, 31, 32, 35, 37, 39, 44, 45, 46, 48, 50, 51, 52, 53, 54, 57], "scienc": [2, 26], "tool": [2, 10, 15, 21, 30, 38, 51, 52, 54], "without": [2, 9, 10, 15, 16, 18, 30, 31, 50, 51, 52, 57], "have": [2, 5, 8, 9, 10, 11, 12, 15, 16, 18, 21, 26, 29, 30, 31, 32, 33, 38, 40, 42, 43, 45, 48, 49, 50, 51, 52, 54, 55, 56, 57], "write": [2, 7, 8, 11, 16, 18, 21, 26, 30, 34, 35, 37, 39, 44, 49, 51, 55, 56, 57], "command": [2, 7, 15, 16, 27, 30, 32, 39, 40, 42, 45, 51, 52, 53, 56, 57], "line": [2, 7, 11, 15, 16, 21, 29, 30, 32, 39, 40, 45, 50, 51, 52, 56], "code": [2, 7, 8, 9, 11, 15, 21, 24, 29, 39, 42, 43, 49, 50, 51, 52, 53, 54, 55, 56, 57], "support": [2, 7, 9, 10, 11, 15, 18, 21, 26, 39, 40, 42, 43, 45, 48, 51, 52, 53, 54, 57], "through": [2, 11, 15, 26, 30, 31, 35, 39, 40, 42, 45, 50, 51, 52, 54, 56, 57], "web": [2, 7, 15, 45], "identifi": [2, 8, 15, 29, 42, 43, 45, 48, 51, 52], "uniqu": [2, 9, 33, 38, 42, 43, 51], "valu": [2, 11, 15, 16, 18, 24, 31, 32, 33, 35, 39, 40, 42, 43, 45, 48, 50, 52, 54, 56], "denot": [2, 8], "individu": [2, 15, 39, 42, 48, 52], "sampl": [2, 10, 11, 15, 21, 27, 30, 33, 35, 39, 48], "featur": [2, 10, 27, 30, 33, 42, 43, 45, 48, 51, 54, 56], "ident": [2, 9, 21, 51, 52], "distinguish": [2, 10, 16], "piec": [2, 9, 10, 16], "doe": [2, 8, 9, 10, 12, 15, 16, 19, 26, 27, 31, 32, 35, 42, 51, 52, 54], "consid": [2, 10, 11, 15, 16, 21, 45, 48, 51, 52], "renam": 2, "like": [2, 7, 8, 9, 10, 11, 15, 16, 18, 19, 21, 26, 30, 31, 32, 33, 35, 37, 38, 39, 40, 42, 43, 45, 49, 50, 51, 52, 53, 54, 56], "unix": 2, "mv": 2, "chang": [2, 7, 8, 18, 19, 21, 26, 31, 38, 40, 42, 45, 50, 51, 52, 54, 56, 57], "howev": [2, 8, 10, 16, 19, 43, 45, 51, 53], "re": [2, 5, 7, 10, 15, 16, 18, 26, 32, 37, 38, 40, 42, 45, 49, 50, 51, 52, 54, 56, 57], "run": [2, 7, 11, 15, 18, 19, 21, 30, 40, 42, 45, 46, 49, 50, 51, 52, 53, 54, 56, 57], "would": [2, 9, 10, 12, 15, 16, 18, 19, 26, 30, 31, 35, 37, 39, 42, 45, 48, 50, 52, 54], "user": [2, 6, 8, 10, 12, 15, 16, 18, 19, 21, 24, 26, 30, 32, 34, 35, 38, 39, 40, 42, 43, 45, 48, 49, 50, 51, 52, 53, 54, 56, 57], "respons": [2, 8, 9, 12, 45], "coordin": [2, 8, 32], "specifi": [2, 15, 18, 19, 31, 32, 43, 46, 50, 51, 52], "intent": [2, 8, 30], "driven": [2, 52], "columnar": 2, "annot": [2, 16, 29, 31, 32, 33, 34, 35, 42, 43, 52], "addit": [2, 9, 10, 12, 15, 16, 18, 35, 40, 42, 43, 48, 50, 51, 54, 57], "along": [2, 29, 31, 56], "id": [2, 42, 43, 48, 49, 51, 54], "combin": [2, 10, 11, 15, 16, 27, 32, 33, 35, 42, 46], "produc": [2, 12, 15, 16, 21, 24, 27, 29, 32, 33, 35, 42, 45, 46, 52, 53, 54, 56], "one": [2, 8, 9, 10, 11, 15, 16, 18, 21, 27, 30, 31, 32, 33, 34, 35, 38, 39, 41, 42, 43, 45, 46, 48, 50, 51, 52, 53, 54, 56], "return": [2, 8, 11, 16, 18, 21, 24, 30, 32, 33, 34, 35, 42, 43, 45, 46, 49, 50, 51, 52, 54], "pairwis": [2, 43, 50], "align": [2, 15, 21, 50, 53], "noun": 2, "hypothesi": [2, 52], "about": [2, 7, 8, 10, 11, 15, 16, 18, 30, 39, 41, 42, 43, 45, 48, 49, 52, 54, 56, 57], "posit": [2, 50, 51, 52], "pair": [2, 10, 29, 33, 43, 52], "biolog": [2, 11], "i": [2, 7, 10, 11, 15, 19, 30, 31, 32, 42, 43, 45, 48, 49, 50, 51, 52, 54, 56, 57], "e": [2, 7, 9, 10, 11, 12, 15, 19, 21, 24, 26, 30, 32, 33, 35, 38, 39, 42, 43, 45, 48, 50, 51, 52, 54, 56, 57], "dna": [2, 11, 50, 51, 52, 54], "rna": [2, 51, 52], "were": [2, 9, 15, 16, 18, 19, 21, 45, 50, 51, 54], "deriv": [2, 26, 52], "from": [2, 5, 7, 8, 9, 10, 11, 12, 15, 16, 18, 19, 21, 24, 26, 29, 30, 31, 32, 33, 34, 38, 39, 40, 42, 44, 45, 46, 48, 50, 51, 52, 53, 54, 55, 57], "common": [2, 9, 10, 11, 15, 16, 21, 24, 29, 42, 45, 46, 48, 51, 52, 53], "ancestr": [2, 9, 52], "verb": [2, 38], "detail": [2, 9, 10, 15, 16, 18, 21, 31, 32, 34, 36, 39, 42, 43, 48, 51, 52], "chapter": [2, 26, 31, 37, 52, 53], "alter": 2, "behavior": [2, 8, 33, 42, 43, 52], "payload": [2, 9, 10, 11], "meant": 2, "primari": [2, 15], "consumpt": [2, 52], "interpret": [2, 9, 15, 21, 27, 45, 48, 54], "contrast": [2, 9, 15, 27], "mai": [2, 7, 8, 10, 15, 16, 18, 19, 21, 26, 30, 31, 32, 37, 42, 43, 45, 46, 48, 51, 52, 54, 57], "retrospect": [2, 10, 13, 20], "primarili": [2, 15, 26], "discret": 2, "modul": [2, 16, 50, 51, 52, 54], "form": [2, 8, 15, 16, 31, 45, 51, 52], "includ": [2, 7, 9, 10, 11, 15, 16, 26, 32, 33, 35, 39, 42, 43, 45, 48, 51, 52, 54, 56, 57], "new": [2, 7, 9, 10, 11, 12, 15, 16, 18, 19, 21, 26, 30, 31, 32, 36, 38, 39, 40, 44, 45, 46, 50, 53, 54, 55, 56, 57], "transform": [2, 15, 21, 28, 37, 38, 41, 43, 44, 46, 52, 57], "primit": [2, 10, 13, 20, 24, 31, 32, 42, 52], "commun": [2, 8, 26, 39, 54], "predefin": 2, "cannot": [2, 8, 16, 27, 35, 48], "extend": [2, 10, 31, 46, 52], "In": [2, 8, 10, 11, 15, 16, 19, 21, 27, 31, 32, 35, 39, 42, 43, 45, 48, 49, 50, 51, 52, 53, 54], "context": [2, 12, 15, 16, 18, 19, 24, 39, 40, 51, 54], "refer": [2, 7, 9, 15, 20, 23, 26, 30, 31, 32, 36, 39, 41, 42, 43, 44, 49, 50, 51, 52, 54], "histori": [2, 10, 15, 21], "given": [2, 10, 15, 16, 24, 30, 42, 50, 51, 52], "wa": [2, 9, 10, 11, 15, 16, 19, 21, 26, 30, 32, 35, 40, 42, 45, 49, 51, 52], "inform": [2, 8, 9, 10, 11, 12, 14, 15, 16, 18, 21, 26, 30, 32, 34, 39, 43, 50, 51, 52, 56], "host": [2, 7, 15, 26], "system": [2, 10, 15, 16, 18, 19, 21, 30, 31, 32, 39, 40, 45], "environ": [2, 7, 10, 18, 21, 37, 42, 44, 51, 52, 54, 56], "perform": [2, 8, 9, 10, 11, 15, 16, 30, 36, 43, 45, 49, 50, 51, 52, 53], "pass": [2, 10, 11, 15, 19, 21, 30, 31, 39, 40, 42, 43, 45, 50, 51, 52, 54, 56], "sourc": [2, 7, 15, 21, 24, 29, 32, 33, 35, 38, 40, 45, 46, 48, 52, 57], "cite": [2, 3, 9, 15, 21, 52], "execut": [2, 8, 18, 19, 32, 42, 52, 54, 56, 57], "allow": [2, 8, 9, 10, 11, 15, 16, 18, 21, 24, 30, 39, 42, 43, 45, 46, 51, 52, 53, 54], "work": [2, 3, 7, 8, 10, 11, 15, 16, 19, 26, 29, 30, 31, 38, 39, 40, 42, 43, 45, 46, 48, 49, 50, 51, 52, 54, 55, 56, 57], "nativ": 2, "jupyt": [2, 26, 54], "notebook": [2, 15], "formerli": 2, "q2cli": [2, 15, 40, 42, 51, 54, 57], "origin": [2, 9, 10, 21, 31, 32, 33, 35], "still": [2, 5, 10, 16, 19, 26, 30, 31, 49, 50, 52, 55], "2024": [2, 11, 45, 51, 52, 55], "what": [2, 8, 9, 10, 16, 18, 19, 30, 32, 34, 42, 45, 49, 50, 51, 54, 56], "intend": [2, 8, 24, 26, 30, 40, 42, 43, 51, 52, 54, 57], "where": [2, 7, 8, 9, 10, 15, 16, 18, 26, 31, 32, 39, 41, 45, 46, 49, 50, 51, 52, 53, 54], "thei": [2, 8, 10, 11, 15, 16, 18, 21, 29, 30, 31, 34, 43, 45, 49, 50, 51, 52, 54], "tl": 2, "dr": 2, "too": [2, 11, 15, 43, 45, 51], "long": [2, 8, 10, 11, 29, 30, 32, 50, 51, 52], "didn": [2, 16, 50, 52], "t": [2, 7, 9, 10, 11, 15, 16, 18, 19, 21, 30, 32, 34, 40, 41, 42, 45, 46, 49, 50, 51, 52, 54, 55, 56], "read": [2, 8, 9, 11, 16, 18, 26, 31, 34, 45, 49, 50, 51, 52, 54, 55, 57], "word": [2, 10, 15, 16, 52], "quick": [2, 11, 50, 51], "summari": [2, 35, 50, 51, 53], "follow": [2, 9, 10, 16, 18, 19, 21, 31, 32, 33, 35, 39, 40, 42, 48, 49, 50, 51, 52, 54, 56], "capabl": [2, 11], "convert": [2, 8, 10, 24, 29, 34, 46, 48, 49, 51], "anoth": [2, 9, 10, 11, 12, 16, 18, 27, 34, 43, 50, 51, 54], "sever": [2, 18, 35, 38, 39, 46], "differ": [2, 7, 9, 10, 11, 15, 16, 18, 19, 21, 24, 26, 30, 32, 35, 37, 39, 40, 44, 45, 48, 49, 50, 51, 52, 54], "idea": [2, 7, 8, 9, 10, 16, 30, 51, 52, 54], "therefor": [2, 9, 15, 48, 51, 52, 54], "ambigu": [2, 51], "its": [2, 7, 8, 10, 11, 15, 16, 19, 21, 29, 30, 31, 32, 35, 36, 39, 42, 43, 48, 50, 51, 52, 54, 56], "own": [2, 7, 11, 15, 16, 18, 29, 37, 42, 45, 49, 52, 54, 55, 57], "specif": [2, 5, 7, 8, 10, 15, 16, 18, 19, 21, 26, 32, 37, 39, 40, 42, 43, 48, 51, 52, 54, 56, 57], "univers": [2, 30, 49], "almost": [2, 16], "certainli": 2, "randomli": 2, "rfc": 2, "wikipedia": [2, 45], "entri": [2, 8, 45], "view": [2, 7, 10, 12, 15, 30, 31, 33, 43, 45, 46, 49, 50, 51, 52, 54, 56], "represent": [2, 9, 11, 15, 16, 21, 30, 35, 43, 50], "disk": [2, 10, 11, 30, 31, 48, 51], "memori": [2, 10, 12, 30, 48], "interact": [2, 8, 9, 16, 24, 31, 39, 43, 45, 52], "There": [2, 9, 10, 15, 16, 18, 30, 38, 39, 42, 45, 46, 51, 52], "subtyp": 2, "relat": [2, 8, 9, 10, 15, 16, 18, 51, 52, 57], "between": [2, 7, 8, 9, 10, 11, 15, 16, 21, 24, 29, 30, 32, 33, 45, 49, 51], "ani": [2, 7, 8, 9, 10, 11, 12, 15, 16, 18, 19, 27, 29, 31, 32, 39, 40, 42, 43, 46, 48, 49, 50, 51, 52, 54, 56], "singleton": 2, "becaus": [2, 8, 9, 10, 11, 12, 15, 16, 18, 21, 30, 42, 45, 48, 49, 50, 51, 52, 54], "exactli": [2, 10, 15, 27, 35, 42, 48, 49, 51, 52], "glossari": 3, "list": [3, 7, 11, 14, 15, 16, 18, 21, 30, 31, 32, 33, 35, 39, 40, 42, 46, 51, 52, 55, 56], "index": [3, 9, 35, 48, 50], "being": [5, 10, 12, 15, 16, 18, 21, 30, 32, 38, 43, 45, 48, 51, 52], "author": [5, 26, 52], "greg": [5, 26, 52], "contribut": [5, 15], "welcom": 5, "acknowledg": 5, "via": [5, 8, 32, 39, 42, 43, 46, 49], "project": [5, 10, 26, 32, 39, 40, 45], "github": [5, 7, 15, 21, 26, 39, 40, 51, 54, 56], "contributor": 5, "page": [5, 7, 12, 39, 45, 50, 52], "At": [5, 8, 40, 43, 49, 51, 52], "moment": [5, 7, 18, 41, 52], "we": [5, 7, 8, 9, 10, 11, 12, 15, 16, 18, 21, 26, 29, 30, 31, 32, 33, 38, 40, 42, 43, 45, 49, 50, 51, 52, 53, 54, 56], "lai": 5, "groundwork": 5, "onli": [5, 8, 9, 11, 15, 16, 18, 21, 26, 27, 30, 32, 33, 35, 39, 40, 43, 45, 48, 49, 50, 51, 52, 56, 57], "If": [5, 9, 10, 12, 15, 16, 18, 19, 26, 30, 31, 32, 35, 37, 38, 39, 40, 42, 43, 45, 46, 48, 49, 50, 51, 52, 54, 56, 57], "you": [5, 7, 9, 10, 12, 15, 16, 18, 19, 24, 26, 29, 30, 31, 32, 35, 36, 37, 38, 39, 40, 41, 42, 43, 45, 46, 49, 50, 51, 52, 54, 55, 56, 57], "suggest": [5, 16], "feedback": [5, 55], "love": [5, 12], "hear": [5, 12, 30], "As": [7, 9, 11, 15, 16, 21, 31, 32, 33, 42, 45, 49, 50, 51, 52, 54, 55], "time": [7, 8, 9, 10, 15, 18, 21, 29, 30, 31, 38, 40, 43, 45, 49, 50, 51, 52, 54, 57], "12": [7, 11, 15, 21, 40], "januari": [7, 45], "state": [7, 8, 10, 12], "transit": [7, 30, 51], "present": [7, 9, 11, 15, 21, 31, 32, 35, 42, 46, 48, 50, 51, 52, 54], "go": [7, 16, 42, 45, 50, 51, 52, 54, 55, 56], "futur": [7, 10, 11, 18, 19, 26, 31, 45, 54], "cover": [7, 26, 39, 42], "doc": [7, 26, 48, 54], "move": [7, 8, 9, 10, 18, 19, 31, 40, 49, 51, 52, 57], "singl": [7, 9, 10, 15, 16, 21, 27, 30, 31, 33, 35, 38, 39, 42, 43, 46, 48, 50, 51, 52, 53, 54], "resourc": [7, 12, 18, 53], "cross": [7, 15, 45], "materi": [7, 43, 46, 54], "set": [7, 8, 9, 11, 16, 18, 21, 31, 32, 37, 43, 44, 46, 50, 51, 52, 54, 56], "usag": [7, 17, 19, 20, 30, 37, 44, 49, 52, 55, 56, 57], "expect": [7, 10, 11, 16, 18, 24, 26, 30, 31, 32, 35, 40, 42, 45, 46, 49, 50, 51, 52, 54, 56], "topic": [7, 26, 36, 52, 53], "build": [7, 16, 26, 37, 44, 45, 51, 52, 56], "cach": [7, 19, 42, 50, 51, 52, 56], "expand": [7, 15, 18, 50, 57], "here": [7, 8, 11, 15, 16, 19, 21, 26, 29, 30, 32, 33, 34, 35, 39, 40, 41, 42, 43, 49, 50, 51, 52, 53, 54, 55, 56], "parallel": [7, 8, 17, 20, 24, 53, 57], "recycl": [7, 19], "old": [7, 16, 26], "why": [7, 10, 16, 45, 54], "discuss": [7, 10, 15, 16, 26, 30, 36, 45, 51, 52, 54, 55], "multipl": [7, 8, 10, 11, 15, 16, 18, 21, 24, 26, 30, 31, 45, 46, 50, 51, 52, 57], "deal": [7, 16, 49], "import": [7, 8, 10, 14, 15, 16, 18, 19, 21, 30, 32, 34, 38, 39, 42, 45, 49, 50, 52, 53, 54], "export": [7, 43, 50, 52, 54], "qzv": [7, 10, 15], "equival": [7, 24], "our": [7, 10, 15, 16, 18, 26, 30, 42, 45, 49, 50, 51, 53, 54, 55, 56], "render": [7, 42, 43, 54], "all": [7, 8, 9, 10, 11, 15, 16, 18, 19, 21, 24, 26, 29, 30, 31, 32, 39, 41, 42, 43, 45, 46, 48, 50, 51, 52, 54, 56, 57], "avoid": [7, 16, 19, 30, 38, 39, 42, 45, 51, 52, 54, 57], "need": [7, 8, 9, 10, 11, 16, 18, 24, 26, 30, 31, 33, 39, 40, 42, 43, 45, 46, 49, 50, 51, 52, 54, 55], "thing": [7, 11, 15, 16, 30, 42, 45, 50, 51, 52, 54], "filter": [7, 48], "tutori": [7, 26, 37, 40, 43, 44, 48, 51, 55], "isn": [7, 11, 16, 46, 51, 52, 54], "realli": [7, 12, 14, 54], "rather": [7, 15, 16, 18, 30, 38, 45, 50, 51, 52, 54], "approach": [7, 10, 15, 26, 38, 45, 51, 57], "ideal": [7, 16, 51, 52, 54], "fulli": [7, 15, 18, 45], "autom": [7, 42, 51, 57], "built": [7, 8, 10, 16, 26, 37, 45, 50, 51, 52], "pluginmanag": 7, "pictur": [7, 8], "dataset": [7, 32], "cancer": [7, 26], "intervent": 7, "help": [7, 10, 15, 16, 30, 35, 39, 40, 42, 45, 51, 52, 54, 55, 56], "blur": 7, "over": [7, 8, 9, 11, 15, 16, 21, 30, 33, 39, 51, 52], "To": [7, 8, 10, 11, 16, 18, 26, 30, 40, 42, 44, 45, 48, 50, 51, 52, 54, 56, 57], "add": [7, 16, 18, 21, 44, 56, 57], "driver": [7, 42, 54], "select": [7, 15, 16, 45], "sdk": [7, 8, 12, 14, 18, 24, 42, 52], "multi": 7, "so": [7, 10, 11, 15, 16, 21, 27, 30, 31, 32, 34, 35, 38, 39, 42, 43, 45, 46, 49, 50, 51, 52, 53, 54, 57], "templat": [7, 26, 44, 50, 55, 57], "instruct": [7, 10, 18, 26, 32, 37, 40, 54, 57], "littl": [7, 16, 39, 50, 51, 52], "spars": 7, "don": [7, 10, 16, 19, 34, 42, 45, 49, 50, 51, 52, 54, 55, 56], "fork": [7, 16], "branch": 7, "do": [7, 10, 15, 16, 18, 19, 21, 26, 29, 31, 32, 33, 34, 35, 39, 42, 43, 45, 49, 50, 51, 52, 54, 55, 57], "recommend": [7, 11, 16, 40, 43, 51, 52, 54, 56], "first": [7, 8, 11, 16, 18, 19, 26, 29, 33, 35, 37, 42, 44, 45, 49, 51, 54, 55, 56], "most": [7, 8, 10, 15, 16, 18, 26, 30, 38, 43, 45, 50, 51, 52, 54, 57], "recent": [7, 10, 16, 30, 51], "releas": [7, 21, 31, 40, 42], "creat": [7, 9, 11, 12, 15, 16, 18, 19, 26, 30, 31, 37, 38, 39, 40, 42, 43, 44, 45, 46, 49, 50, 51, 52, 53, 54, 55, 57], "switch": [7, 18], "Then": [7, 8, 9, 50, 51, 52, 54, 56], "clone": [7, 40], "repositori": [7, 26, 40, 42, 52, 56], "requir": [7, 8, 11, 15, 16, 18, 29, 31, 33, 35, 39, 40, 41, 42, 45, 48, 50, 51, 52, 54, 56], "git": [7, 40, 52], "com": [7, 15, 21, 39, 40], "cd": [7, 40], "pip": [7, 42, 56], "txt": [7, 45], "preview": 7, "mode": [7, 8, 11, 40, 46, 51, 56], "confirm": [7, 42, 49, 51, 52, 54, 56], "befor": [7, 8, 16, 18, 19, 30, 37, 38, 39, 42, 43, 49, 50, 51, 52, 54, 57], "make": [7, 9, 10, 11, 15, 16, 18, 21, 30, 31, 32, 35, 38, 40, 42, 45, 46, 48, 49, 50, 52, 54, 56, 57], "step": [7, 8, 10, 15, 18, 26, 37, 39, 44, 46, 49, 50, 51, 52, 53, 54, 55, 56], "dure": [7, 15, 19, 39, 42, 45, 51, 52, 56], "vastli": 7, "faster": [7, 8, 18], "than": [7, 8, 11, 15, 16, 30, 31, 40, 42, 43, 45, 46, 48, 49, 50, 51, 52, 54], "complet": [7, 8, 10, 15, 16, 26, 30, 34, 39, 50, 51, 52, 54, 57], "html": [7, 9, 35, 50], "them": [7, 8, 10, 12, 15, 16, 18, 21, 26, 31, 32, 42, 45, 49, 50, 51, 52, 54, 57], "iter": [7, 31, 46, 52], "until": [7, 16, 30, 50, 52, 54], "done": [7, 8, 15, 18, 30, 32, 39, 51, 52, 54], "m": [7, 42, 50, 51, 52, 54, 56], "server": [7, 45, 50], "abov": [7, 8, 15, 16, 18, 21, 32, 39, 40, 42, 50, 51, 52, 54, 56], "launch": 7, "open": [7, 10, 11, 15, 34, 40, 43, 45, 50, 51, 52, 54, 56], "localhost": 7, "8000": 7, "local": [7, 40, 42, 46, 52], "readi": [7, 8, 32, 49, 51, 52, 54, 56], "submit": 7, "pull": [7, 9, 21], "request": [7, 8, 10, 21, 30, 43, 46, 51, 52, 56], "usual": [7, 8, 16, 18, 39, 45], "wai": [7, 10, 11, 12, 15, 16, 18, 24, 30, 31, 40, 42, 45, 50, 51, 52, 54, 55, 56], "goal": [8, 16, 26, 30, 37, 45, 49, 50, 52, 54], "give": [8, 15, 16, 39, 42, 51, 54], "reader": [8, 26, 52], "high": [8, 15, 39, 51, 52, 53], "level": [8, 11, 15, 18, 37, 39, 43, 44, 45, 48, 50, 51, 52, 54, 56], "understand": [8, 10, 12, 15, 16, 26, 30, 49, 52], "inter": [8, 16, 52], "highest": 8, "three": [8, 11, 15, 27, 30, 42, 51, 52], "translat": [8, 54], "whose": [8, 15, 21, 42], "purpos": [8, 10, 16, 18, 19, 26, 43, 50, 52, 54, 56], "further": [8, 12, 15, 16, 18, 48], "below": [8, 9, 15, 18, 21, 31, 39, 48, 51], "domain": [8, 16, 38], "box": [8, 15, 21, 45], "arrow": [8, 21], "invok": [8, 12, 42, 46], "solid": 8, "direct": [8, 15, 16, 57], "depend": [8, 9, 15, 18, 19, 21, 30, 39, 40, 42, 43, 51], "dash": [8, 39], "dot": 8, "defer": 8, "point": [8, 9, 15, 19, 35, 48, 49, 51, 52], "illustr": [8, 9, 16, 21, 29, 52, 53], "restrict": [8, 40, 43, 48], "should": [8, 10, 11, 12, 15, 16, 18, 19, 24, 26, 30, 32, 33, 35, 39, 40, 42, 43, 45, 46, 48, 50, 51, 52, 54, 56, 57], "knowledg": [8, 52], "ahead": [8, 42], "instead": [8, 12, 16, 24, 30, 33, 39, 45, 48, 50, 52], "descript": [8, 9, 10, 15, 31, 32, 33, 35, 39, 45, 46, 48, 49, 50, 51, 52], "avail": [8, 9, 11, 18, 30, 38, 42, 43, 46, 51, 52, 53, 54, 56], "softwar": [8, 9, 10, 11, 15, 30, 32, 45, 46, 52, 57], "kit": 8, "glanc": [8, 10], "seem": [8, 16, 30, 52], "oner": 8, "directli": [8, 10, 12, 15, 18, 21, 24, 29, 30, 31, 32, 34, 42, 43, 49, 51, 52], "also": [8, 9, 11, 15, 16, 18, 21, 24, 26, 30, 31, 42, 43, 45, 46, 48, 49, 50, 51, 52, 53, 54, 57], "never": [8, 16, 34, 37, 45, 51, 52], "mean": [8, 9, 10, 12, 15, 16, 18, 26, 30, 38, 39, 46, 51, 52], "entir": [8, 9, 11, 12, 16, 43, 50], "decoupl": 8, "importantli": [8, 15, 52, 54], "alwai": [8, 9, 11, 12, 15, 16, 43, 48, 49, 50, 51, 52], "concern": [8, 15, 26, 30, 32, 51, 52, 56], "themselv": [8, 15, 42, 52], "both": [8, 11, 15, 16, 30, 38, 39, 42, 51, 52, 54, 56], "itself": [8, 9, 10, 15, 18, 31, 51, 52], "kei": [8, 15, 21, 31, 32, 39, 42, 45, 52, 54], "constraint": [8, 10], "coupl": [8, 45, 49, 51, 52], "rich": [8, 10, 16, 54], "dynam": [8, 12], "adapt": [8, 26, 49, 51, 54], "ui": [8, 16], "audienc": 8, "task": [8, 16, 37, 50, 57], "hand": [8, 15, 16, 30, 43, 45, 51], "figur": [8, 35, 45, 50, 51], "found": [8, 15, 18, 21, 46, 49, 50, 51, 52, 53, 56], "round": [8, 49], "surround": 8, "indic": [8, 15, 18, 30, 31, 32, 39, 40, 42, 46, 48, 50, 51, 52], "larger": 8, "grai": 8, "text": [8, 9, 10, 15, 33, 35, 39, 45, 48, 49, 50, 52, 53, 54, 56], "angl": 8, "bracket": 8, "packag": [8, 14, 15, 32, 39, 40, 46, 50, 51, 52, 54, 56], "observ": [8, 11, 16, 33, 45, 49, 50, 51, 52], "call": [8, 9, 10, 11, 12, 16, 18, 24, 29, 30, 31, 32, 33, 34, 35, 39, 42, 43, 45, 46, 50, 51, 53, 54, 56], "privileg": 8, "compar": [8, 35, 50, 51, 52], "none": [8, 11, 18, 24, 32, 33, 35, 42, 43, 46, 48, 50, 51, 52], "look": [8, 9, 11, 16, 18, 21, 30, 31, 33, 35, 37, 39, 42, 43, 46, 49, 50, 51, 52, 54, 56, 57], "now": [8, 10, 11, 16, 18, 21, 26, 40, 42, 49, 50, 51, 52, 54, 55, 56], "construct": [8, 11, 14, 16, 18, 24, 48], "relev": [8, 15, 21, 26, 30, 39, 40, 43, 51, 52, 54], "rough": 8, "seen": [8, 9, 11], "load": [8, 11, 18, 21, 30, 32, 39, 42, 43, 45, 46, 48, 50, 51, 52, 54, 56], "later": [8, 10, 51, 52], "turn": [8, 31, 52, 54], "caus": [8, 46], "introspect": 8, "manipul": [8, 9, 10, 48], "number": [8, 11, 15, 16, 18, 29, 32, 39, 40, 43, 46, 48, 52], "get": [8, 10, 15, 16, 18, 31, 34, 39, 40, 42, 45, 46, 50, 51, 52, 54, 56, 57], "better": [8, 10, 12, 15, 16, 30, 40, 49, 51], "start": [8, 15, 16, 30, 35, 39, 40, 46, 49, 50, 51, 52, 54, 55, 56, 57], "end": [8, 15, 31, 39, 46, 50, 51, 52, 55, 56, 57], "uml": 8, "top": [8, 15, 18, 50, 51, 52, 54, 56], "bottom": [8, 15, 51, 52, 54], "passag": 8, "non": [8, 10, 15, 18, 24, 32, 33, 42, 43, 46, 48, 51, 52], "amount": [8, 14], "vertic": 8, "column": [8, 16], "activ": [8, 15, 26, 30, 52, 56], "narrow": 8, "upon": 8, "actor": 8, "question": [8, 9, 11, 39, 42, 43, 51], "label": [8, 16, 18, 42], "parenthesi": 8, "argument": [8, 16, 21, 31, 42, 45, 51], "Not": [8, 16], "enumer": [8, 11, 31], "breviti": 8, "ha": [8, 9, 10, 11, 15, 16, 18, 21, 26, 30, 33, 39, 42, 43, 45, 48, 50, 51, 52, 56, 57], "four": [8, 52], "receiv": [8, 16, 33, 45, 51, 57], "It": [8, 9, 11, 12, 15, 16, 19, 21, 24, 26, 27, 30, 31, 33, 39, 42, 45, 49, 50, 51, 52, 54, 57], "locat": [8, 12, 18, 45], "shown": [8, 15, 18, 21, 31, 39], "much": [8, 10, 11, 16, 30, 31, 40, 42, 51, 52], "check": [8, 9, 11, 18, 21, 30, 40, 42, 43, 46, 49, 50, 51, 52, 54], "fail": [8, 18, 19, 30, 45, 46, 50, 51], "halfwai": 8, "veri": [8, 9, 11, 16, 18, 26, 30, 31, 32, 33, 35, 39, 50, 51, 52, 54], "though": [8, 10, 16, 21, 26, 30, 32, 40, 50, 51, 54], "necessarili": [8, 16, 19, 30], "same": [8, 10, 15, 16, 18, 21, 24, 30, 31, 33, 35, 38, 39, 42, 45, 48, 49, 50, 51, 53, 54], "final": [8, 15, 16, 18, 35, 39, 42, 43, 51, 52, 54, 57], "compat": [8, 9, 10, 24, 39, 45], "whatev": [8, 15, 31, 35, 50, 51, 56], "onc": [8, 10, 11, 16, 18, 32, 42, 49, 51], "finish": 8, "again": [8, 31, 38, 48, 49, 50, 52], "storag": [8, 51], "record": [8, 10, 11, 15, 21, 51, 52, 56, 57], "just": [8, 14, 15, 16, 18, 26, 30, 31, 40, 42, 43, 45, 49, 50, 51, 52, 54], "occur": [8, 11, 12, 15, 42, 52], "decid": [8, 45, 52], "save": [8, 9, 10, 11, 15, 19, 21, 43, 45, 48, 50, 52, 54], "each": [8, 9, 10, 15, 16, 21, 26, 30, 32, 33, 42, 43, 48, 50, 51, 52, 54, 57], "strictli": 8, "sort": [8, 30, 50], "onion": 8, "layer": 8, "note": [8, 15, 31, 41, 42, 49, 51, 52], "wait": [8, 18], "becom": [8, 11, 12, 16, 29, 51, 54], "inact": 8, "asynchron": 8, "case": [8, 9, 11, 12, 15, 16, 30, 31, 32, 40, 42, 43, 45, 48, 50, 51, 52, 54], "success": [8, 51, 52, 56], "less": [8, 26, 30, 46, 51], "right": [8, 16, 42, 45, 51, 52, 56, 57], "care": [8, 15, 29, 30, 42], "effect": [8, 15], "overal": [8, 21], "effort": [8, 15, 45], "store": [9, 11, 13, 19, 20, 21, 30, 46, 48, 50, 51, 52], "simpl": [9, 15, 16, 31, 39, 42, 50, 51, 52, 53, 56], "conveni": [9, 10, 16, 21, 43, 45, 46, 49, 50, 51], "serv": [9, 12, 26, 42], "repeat": [9, 16], "45c12936": 9, "4b60": 9, "484d": 9, "bbe1": 9, "98ff96bad145": 9, "featuret": [9, 29, 30, 32, 33, 42, 45, 56], "frequenc": [9, 29, 30, 32, 33, 42, 45, 56], "biomv210dirfmt": 9, "possibl": [9, 10, 15, 16, 19, 21, 30, 42, 45, 46, 49, 50, 51, 52, 54], "null": [9, 15], "impli": [9, 18, 51, 52], "schema": 9, "aptli": 9, "subdirectori": [9, 10, 15, 51], "implement": [9, 16, 31, 42, 45, 48, 51, 52, 57], "small": [9, 11, 49, 52, 54], "static": [9, 12], "websit": [9, 15, 21, 39, 46, 52], "asset": [9, 39, 40, 46], "determin": [9, 10, 15, 16, 29, 32, 43, 48, 50, 52], "current": [9, 11, 12, 15, 16, 21, 26, 31, 40, 42, 46, 48, 53], "public": [9, 11, 24, 42, 45, 51], "self": [9, 10, 11, 15, 16, 45, 49, 50, 51, 52, 54], "referenti": 9, "duplic": [9, 15, 19, 54, 56], "simplifi": [9, 15, 39, 41, 46, 49, 51, 53], "track": [9, 10, 13, 20, 21, 45], "fig": [9, 15, 21], "close": [9, 10, 16, 48, 51], "previous": [9, 21, 26, 51, 53], "up": [9, 12, 16, 18, 21, 31, 37, 42, 43, 44, 46, 49, 50, 51, 56], "simpli": [9, 15, 16, 18, 31, 43, 45, 52], "ad": [9, 11, 16, 21, 30, 32, 33, 35, 38, 42, 46, 49, 50, 51, 52, 54, 55], "merg": [9, 42, 48], "know": [9, 11, 16, 26, 30, 42, 45, 50, 51, 52, 54], "ancestor": [9, 21], "twice": 9, "ignor": [9, 10, 45, 52], "problem": [9, 10, 30, 45, 51], "captur": [9, 21, 42, 57], "tree": [9, 24, 30, 51], "ubiquit": 9, "understood": 9, "huge": [9, 30, 52], "varieti": 9, "additon": 9, "random": 9, "extract": [9, 10, 15], "linear": 9, "tar": 9, "out": [9, 11, 14, 16, 30, 43, 45, 50, 51, 52, 54, 56], "larg": [9, 15, 30, 32, 51, 52, 57], "mani": [9, 10, 11, 15, 16, 21, 30, 32, 35, 38, 42, 43, 51, 52], "core": [9, 12, 14, 15, 16, 19, 21, 33, 43, 46, 52], "_ziparch": 9, "manag": [9, 12, 15, 18, 19, 40, 45, 46, 51, 52], "zipfil": 9, "everi": [9, 10, 11, 15, 35, 52, 54, 57], "standard": [9, 10, 52], "enough": [9, 16, 42], "pars": [9, 21, 30], "rest": [9, 18], "intention": [9, 50], "ini": 9, "serial": [9, 48, 51], "configur": [9, 11, 17, 20, 53], "discourag": 9, "situat": [9, 11, 16, 19], "reformat": 9, "updat": [9, 10, 15, 16, 26, 40, 54], "g": [9, 10, 11, 12, 15, 21, 24, 26, 30, 33, 35, 38, 39, 42, 43, 45, 48, 51, 54, 56, 57], "consist": [9, 21, 43], "break": [9, 11, 16, 18, 54], "backward": [9, 31, 38, 57], "integ": [9, 11, 16, 31, 48], "string": [9, 10, 16, 21, 24, 32, 39, 43, 45, 46, 48, 50, 51, 52, 54], "evolv": [9, 21], "dispatch": [9, 16, 18, 21], "appropri": [9, 12, 21, 29, 30, 33, 39, 42, 52], "logic": [9, 11, 46], "histor": [9, 21], "0": [9, 11, 15, 16, 26, 31, 33, 40, 42, 46, 50, 51, 52], "had": [9, 16, 30, 50, 51], "hadn": 9, "yet": [9, 10, 16, 31, 42, 51, 52, 56], "been": [9, 16, 21, 26, 29, 31, 45, 48, 51, 52, 56, 57], "parser": [9, 21], "doen": 9, "easi": [9, 16, 42, 51, 52], "runtim": [9, 14, 15, 51], "scheme": [9, 15, 19, 48], "complex": [9, 15, 16, 39, 42, 50], "ensur": [9, 11, 12, 18, 40, 42, 43, 45, 46, 50, 51, 52, 54], "abl": [9, 10, 11, 15, 16, 21, 38, 40, 50, 51, 52, 54, 57], "older": [9, 15, 30], "encod": [9, 10, 48], "_archiv": [9, 21], "section": [10, 15, 16, 18, 21, 26, 45, 48, 49, 50, 51, 52, 54, 55], "synonym": [10, 16, 30], "clarifi": [10, 16], "languag": [10, 14, 15, 16, 30], "haven": [10, 16, 45, 51, 52], "review": [10, 15, 16, 49, 50, 51, 52], "persist": [10, 11, 15], "accomplish": [10, 26, 33], "impact": [10, 15, 30, 32, 52], "facet": 10, "order": [10, 11, 15, 16, 18, 24, 31, 42, 46, 48, 52], "demonstr": [10, 52, 56], "certain": [10, 48], "aspect": [10, 14, 15, 20, 41, 51, 52], "highlight": 10, "achiev": [10, 14, 30, 37, 45, 52, 57], "motiv": [10, 30], "contraint": 10, "20": [10, 15, 30], "year": [10, 52], "proof": 10, "eas": [10, 15], "trust": [10, 51, 52], "decis": [10, 16, 30], "made": [10, 18, 21, 30, 42, 43, 51, 52], "solut": 10, "seek": [10, 12], "address": [10, 30, 50, 51, 52], "solv": [10, 30], "lift": 10, "choos": [10, 12, 15, 30, 38, 43], "believ": 10, "scientist": 10, "compos": [10, 11, 48, 53], "reus": [10, 19, 24], "advanc": [10, 18, 19, 31], "art": 10, "fair": [10, 52], "principl": 10, "insid": [10, 16, 18, 21, 32, 42, 51], "zip": [10, 15, 16, 42], "permit": [10, 16], "alongsid": [10, 21], "fasta": [10, 11, 30, 51, 52], "plain": [10, 16], "person": [10, 16, 54], "might": [10, 11, 16, 30, 31, 39, 40, 42, 43, 46, 51, 52], "roughli": 10, "assum": [10, 18, 45, 48, 52], "sens": [10, 16, 30, 50], "entiti": [10, 51], "per": [10, 11, 15, 18, 30, 50], "fastq": [10, 11, 30, 51], "sometim": [10, 45, 52], "altern": [10, 18, 52], "could": [10, 15, 16, 27, 30, 31, 32, 39, 42, 45, 50, 51, 52, 54], "invent": 10, "rule": [10, 15, 16, 31], "difficult": [10, 12, 30], "reason": [10, 15, 18, 30, 45, 51], "newick": [10, 30, 51], "deliv": 10, "qza": [10, 15, 30, 31, 42, 51, 52, 54], "intern": [10, 18, 30, 31, 43, 51, 54], "unzip": [10, 15], "util": [10, 14, 15, 43, 51, 52], "winzip": 10, "7zip": 10, "even": [10, 15, 16, 30, 33, 42, 45, 50, 51, 52], "challeng": [10, 51], "inconveni": 10, "fix": [10, 16, 45, 51], "destin": [10, 29, 31], "addition": [10, 12, 16, 30, 43, 54], "advantag": 10, "incred": 10, "wide": [10, 39], "arrai": [10, 42], "often": [10, 15, 16, 18, 30, 34, 45, 50, 52, 54, 57], "back": [10, 15, 16, 45, 49, 50, 51, 52, 54, 55, 57], "docx": 10, "epub": 10, "maintain": [10, 42], "anatomi": [10, 13, 15, 20], "yaml": [10, 21, 40], "around": [10, 31, 52], "prevent": [10, 11, 15, 38, 51], "error": [10, 11, 30, 45, 48, 51, 52], "due": [10, 31], "accident": [10, 15, 30], "misus": 10, "confus": [10, 18, 30], "place": [10, 11, 31, 41, 46, 51, 52], "worri": [10, 16, 42, 56], "filenam": [10, 11, 15, 21, 46, 51], "conflict": 10, "anyth": [10, 12, 16, 18, 19, 26, 30, 31, 32, 35, 42, 46, 50, 51, 52, 54], "els": [10, 30, 31, 42, 51], "known": [10, 12, 16, 30, 32, 46], "carri": [10, 16, 30], "abstract": [10, 15, 16, 24, 48, 54], "composit": [10, 15, 16, 46], "adequ": 10, "share": [10, 15, 21, 24, 57], "necessari": [10, 11, 16, 18, 43], "learn": [10, 26, 29, 41, 52, 54, 57], "notabl": [10, 15], "prior": [10, 15, 19, 21, 31, 33, 43], "involv": [10, 16], "creation": [10, 15, 56], "citat": [10, 15, 21, 32, 33, 35, 39, 45, 50, 54, 56], "decentr": [10, 13, 20, 21], "doesn": [11, 15, 16, 30, 32, 40, 41, 50, 51, 52, 54], "opinion": 11, "simplest": 11, "fileformat": 11, "typic": [11, 29, 30, 38, 43, 51, 52], "bit": [11, 16, 18, 39, 50, 51, 52], "initi": [11, 19, 26, 30, 42, 50, 51, 52, 57], "declar": [11, 30], "fly": 11, "goe": [11, 15], "corrupt": 11, "invalid": [11, 30, 45, 51, 52], "gotcha": 11, "keep": [11, 15, 16, 33, 38, 50], "minim": [11, 36, 40, 45, 51], "limit": [11, 15, 16, 38], "subset": 11, "10": [11, 15, 21, 26, 46, 52], "snif": 11, "min": [11, 51], "max": [11, 18, 51], "definit": [11, 16, 27, 31, 35, 42, 46, 51, 52, 54], "focu": [11, 15, 26, 40, 42, 51], "_validate_": [11, 36, 45, 51], "intsequenceformat": 11, "interest": [11, 15, 16, 26, 43, 55], "equal": [11, 16], "previou": [11, 15, 39, 49, 50, 51, 52], "plu": 11, "def": [11, 29, 31, 32, 33, 34, 35, 42, 43, 45, 49, 50, 51, 52, 54], "_validate_n_int": 11, "n": [11, 40], "fh": [11, 34, 46, 50, 51], "previous_v": 11, "idx": 11, "bail": 11, "try": [11, 16, 18, 19, 49, 50, 51, 54, 56], "val": [11, 42], "int": [11, 16, 31, 32, 33, 46, 48], "rstrip": 11, "except": [11, 12, 15, 16, 18, 33, 35, 50, 51, 52], "typeerror": [11, 16, 24], "valueerror": [11, 51], "rais": [11, 16, 18, 24, 51], "validationerror": [11, 24, 46, 51], "f": [11, 42, 51], "expos": [11, 42, 43], "record_map": 11, "format_inst": 11, "temp_dir": [11, 50], "shouldn": [11, 30, 51, 52], "otherwis": [11, 18, 31, 43, 46, 48], "astut": 11, "notic": [11, 18, 30, 32, 51], "option": [11, 15, 18, 19, 24, 39, 42, 46, 48, 56], "although": [11, 43], "highli": [11, 45, 52, 54], "skip": [11, 42, 51], "anti": [11, 44, 47, 51], "pattern": [11, 44, 47, 51], "hoc": [11, 46], "presenc": [11, 46], "part": [11, 12, 18, 20, 26, 31, 36, 41, 45, 50, 51, 52, 54, 55], "aim": [11, 15], "basic": [11, 15, 16, 18, 31, 42, 51, 52], "special": [11, 15, 16, 52], "busi": [11, 45], "tsv": [11, 15, 35, 42, 48], "etc": [11, 15, 16, 18, 21, 32, 39, 43], "dnafastaformat": [11, 52], "biom": [11, 29, 30, 42, 52], "gzip": 11, "fastqgzformat": 11, "accur": [11, 15], "member": [11, 16, 24, 46], "emppairedenddirfmt": 11, "forward": [11, 52, 54, 57], "gz": 11, "revers": 11, "barcod": [11, 43], "underli": [11, 16, 33, 34, 42, 46, 50, 52], "semat": [11, 51], "unlik": [11, 15, 16, 39, 51, 53], "differenti": [11, 16, 21], "model": [11, 14, 15, 16, 45, 51], "compon": [11, 21, 26], "demultiplex": [11, 30], "One": [11, 16, 30, 51, 52, 57], "studi": [11, 15, 43, 48], "5000": 11, "watch": 11, "casavaoneeightsinglelanepersampledirfmt": 11, "illumina": 11, "casava": 11, "v1": [11, 21], "8": [11, 15, 21, 40, 46, 50, 52], "filecollect": 11, "_": [11, 18, 19, 32, 39, 51, 52], "_l": 11, "9": [11, 15, 21], "_r": 11, "_001": 11, "set_path_mak": 11, "sequences_path_mak": 11, "sample_id": [11, 42], "barcode_id": 11, "lane_numb": 11, "read_numb": 11, "s_": 11, "s_l": 11, "03d_r": 11, "d_001": 11, "those": [11, 15, 26, 29, 35, 37, 42, 43, 45, 46, 48, 49, 51, 52, 54], "factori": [11, 16, 24, 46, 49, 54], "quickli": [11, 30, 51, 54], "remov": [11, 18, 19, 43, 51, 52], "evil": 11, "extra": [11, 16, 45, 46, 52], "dnasequencesdirectoryformat": [11, 21], "singlefiledirectoryformat": [11, 51], "aren": [11, 16, 21, 45, 52], "registr": [11, 15, 29, 31, 39, 41, 42, 43, 52, 54], "sampledata": [11, 30, 33, 35, 42], "pairedendsequenceswithqu": 11, "offer": [12, 21, 43], "particularli": 12, "deep": [12, 15, 16], "answer": 12, "warn": [12, 31, 51, 52, 54, 56], "think": [12, 16, 30, 43, 49, 51, 52], "robust": [12, 16], "alloc": 12, "synchron": 12, "filesystem": 12, "excacerb": 12, "lifetim": 12, "unkown": 12, "tie": 12, "automat": [12, 15, 16, 32, 33, 35, 51, 54], "destroi": 12, "raii": 12, "handl": [12, 15, 29, 31, 43, 45, 48, 49], "collector": 12, "destructor": 12, "clean": 12, "push": 12, "issu": [12, 15, 30, 39, 42, 51, 55], "off": [12, 16, 45, 51], "destruct": 12, "path": [12, 18, 30, 31, 35, 39, 42, 45, 46, 49, 50, 52, 54, 56], "multiprocess": 12, "sy": [12, 15], "_exit": 12, "exit": [12, 18, 24, 30, 46, 48, 52, 56], "child": 12, "normal": [12, 15, 16, 33, 48, 51, 52], "cleanup": 12, "confound": 12, "fortun": [12, 31], "juggl": 12, "architectur": [13, 20], "overview": [13, 20], "garbag": [13, 20, 45], "metaprogram": [13, 20], "signific": [14, 21], "properti": [14, 43, 46, 50, 51], "swap": [14, 16], "last": [14, 16, 45, 50, 51], "minut": [14, 30, 49, 50, 51, 52], "show": [14, 16, 21, 42, 52, 56, 57], "decor": [14, 16, 34, 51], "everywher": 14, "descriptor": [14, 16, 38], "protocol": 14, "latebindingattribut": 14, "hook": [14, 46, 50], "metaclass": 14, "directory_format": 14, "eval": 14, "skd": 14, "parse_typ": [14, 24], "signatur": [14, 24, 32, 35, 51, 52], "rewrit": 14, "integr": [15, 42], "notion": 15, "central": [15, 43, 49], "whenev": [15, 21], "hold": [15, 16], "disassoci": 15, "simpler": [15, 16], "outcom": [15, 30, 42, 43, 45, 52], "png": [15, 35], "graph": 15, "email": 15, "colleagu": 15, "mi": 15, "wrong": [15, 30, 50, 51], "inaccur": [15, 26], "outdat": [15, 26, 30], "script": 15, "inadvertantli": 15, "subsequ": [15, 27, 32, 43, 52, 53], "viewer": [15, 50], "actual": [15, 16, 18, 30, 31, 42, 43, 50, 51, 52, 54], "With": [15, 21, 49, 51], "prospect": 15, "plan": [15, 21, 30, 42, 45, 51, 55], "paragraph": 15, "recreat": 15, "alreadi": [15, 16, 19, 30, 37, 42, 45, 51, 52, 56, 57], "forget": [15, 16, 52, 55], "download": [15, 40, 45, 56], "won": [15, 45, 50, 51, 52], "hard": [15, 16, 18, 30, 38, 51], "imposs": [15, 30], "discov": [15, 30, 52, 54], "reliabl": 15, "manual": [15, 31, 42, 51], "want": [15, 16, 18, 19, 26, 30, 31, 35, 38, 40, 42, 43, 50, 51, 52, 54, 56, 57], "intermedi": [15, 19, 27, 51], "reduc": [15, 32, 45, 51], "o": [15, 42, 52, 54, 56], "cli": 15, "team": [15, 26, 40], "manuscript": 15, "research": [15, 26], "consumm": [15, 52], "valuabl": 15, "reproduct": 15, "transpar": 15, "mainten": 15, "repair": 15, "technic": [15, 18, 39, 50, 52], "among": [15, 51], "benefit": [15, 45, 51, 54], "analys": [15, 54], "relianc": 15, "incomplet": [15, 45, 53], "incomprehens": 15, "who": [15, 26, 40, 45, 51, 54, 57], "ran": [15, 50, 54], "q2view": 15, "bring": [15, 16, 52], "theoret": 15, "pleas": [15, 26, 42, 45, 51, 52], "feel": [15, 45, 51, 54], "free": [15, 39, 45, 51, 52], "touch": [15, 52], "llm": 15, "easier": [15, 16, 21, 49, 51, 52], "ever": [15, 16, 35, 49], "event": [15, 52], "bug": [15, 45], "problemat": [15, 45], "hardwar": 15, "investig": 15, "programat": 15, "correct": [15, 42, 45], "By": [15, 19, 32, 42, 43, 52], "agnost": 15, "across": [15, 18, 21, 32, 45, 52, 53], "variou": [15, 16, 20, 26, 48], "prefer": [15, 16, 30, 39, 42, 51, 56], "compromis": [15, 16], "rel": [15, 45, 51, 52], "outer": 15, "few": [15, 16, 29, 30, 33, 35, 38, 41, 46, 50, 51, 57], "cleric": 15, "parent": [15, 24], "massiv": 15, "size": [15, 52], "blue": [15, 21], "icon": [15, 21], "appear": [15, 16, 45, 52], "remain": [15, 16, 21, 26], "hous": 15, "respect": [15, 19, 21, 30, 46, 48, 52], "abbrevi": 15, "live": [15, 39, 51], "titl": [15, 50, 52], "6": [15, 52], "That": [15, 16, 18, 30, 45, 50, 51, 52, 54, 55], "bib": [15, 21, 32, 39, 52], "bibtex": [15, 32, 39, 52], "passthrough": 15, "regardless": [15, 30, 48], "stuff": 15, "ll": [15, 16, 26, 30, 37, 40, 42, 45, 49, 50, 51, 52, 53, 54, 56, 57], "dive": [15, 16], "broken": [15, 26, 54], "link": [15, 35, 42, 48, 51, 52], "tab": [15, 50], "click": [15, 52], "squar": 15, "circl": [15, 16, 49], "3611a0c1": 15, "e5c5": 15, "4308": 15, "ac92": 15, "ebb5968ebafb": 15, "04": 15, "21t14": 15, "42": 15, "16": 15, "469998": 15, "07": 15, "00": 15, "21": 15, "080381": 15, "durat": 15, "second": [15, 16, 18, 33, 44, 50, 51, 54, 57], "610383": 15, "microsecond": 15, "datetim": 15, "iso": 15, "8601": 15, "timestamp": 15, "field": [15, 16, 24, 45, 46, 51, 52], "v4": [15, 21], "element": [15, 16, 18, 39, 43], "separ": [15, 32, 39], "alia": [15, 21], "displai": [15, 39, 42, 50, 52, 56], "inner": 15, "reflect": [15, 30], "experi": [15, 40, 54], "full": [15, 18, 21, 26, 41, 50, 52, 54], "chain": [15, 49, 51, 53], "termin": [15, 27, 35, 40], "redund": 15, "alias": 15, "real": [15, 16, 42, 44, 56, 57], "unweighted_unifrac_emperor": 15, "metric": [15, 29, 32, 33, 39], "phylogenet": [15, 30, 32, 33, 51, 52], "rememb": [15, 16, 24, 46, 52], "chose": [15, 52], "noth": 15, "couldn": [15, 45], "ref": [15, 21], "divers": [15, 27, 32, 33, 35, 38, 39, 42, 53], "core_metrics_phylogenet": 15, "tabl": [15, 27, 29, 30, 32, 33, 35, 42, 43, 45, 46, 51, 52, 56], "34b07e56": 15, "27a5": 15, "4f03": 15, "ae57": 15, "ff427b50aaa1": 15, "phylogeni": [15, 29, 30, 32, 51], "a10d5d44": 15, "62c7": 15, "4322": 15, "afb": 15, "c9811bcaa3e6": 15, "sampling_depth": [15, 33], "1103": 15, "n_jobs_or_thread": 15, "2adb9f00": 15, "a692": 15, "411d": 15, "8dd3": 15, "a6d07fc80a01": 15, "custom": [15, 18, 21], "tag": [15, 21, 39], "express": [15, 16, 24, 42, 54], "easili": [15, 18, 30, 54], "distinct": [15, 16, 33, 52], "default": [15, 18, 19, 32, 43, 48, 51, 52, 54, 56], "assign": [15, 16, 21, 30, 42, 43, 46, 52, 54], "uncommon": [15, 45], "log": [15, 33], "characterist": [15, 21], "platform": 15, "virtual": 15, "machin": [15, 16, 45, 51], "vm": 15, "client": 15, "site": [15, 43, 52], "global": [15, 38, 52], "working_set": 15, "pkg_resourc": 15, "587": 15, "macosx": 15, "x86_64": 15, "conda": [15, 18, 42], "forg": 15, "feb": 15, "38": 15, "clang": 15, "q2": [15, 21, 27, 29, 30, 34, 38, 39, 40, 41, 42, 43, 50, 51, 52, 54, 56], "zipp": 15, "xopen": 15, "dada2": [15, 38], "alabast": 15, "7": [15, 18, 56], "wrap": [15, 32, 33, 38], "fine": [15, 40, 45, 56], "grain": 15, "mind": [15, 16, 38, 51, 54], "hide": 15, "ten": 15, "behind": [15, 16, 49], "five": 15, "fifteen": 15, "scope": [15, 24, 42, 54], "dag": 15, "tell": [15, 18, 39, 51, 52, 56], "87058ae3": 15, "e168": 15, "4e2f": 15, "a416": 15, "81b130d538c3": 15, "next": [15, 18, 35, 39, 45, 51, 52, 54, 55, 56, 57], "let": [15, 16, 18, 26, 33, 42, 45, 49, 50, 51, 52, 54, 56, 57], "drill": 15, "down": [15, 16, 18, 51], "2adb9": 15, "find": [15, 16, 18, 26, 30, 33, 35, 37, 39, 45, 46, 49, 52, 54, 57], "neither": [15, 16], "node": [15, 51], "nor": 15, "pcoa": [15, 32, 33], "visibl": 15, "emperor": [15, 33, 39], "plot": [15, 33, 35], "93224813": 15, "ed5d": 15, "42b5": 15, "a983": 15, "cd4015db31da": 15, "custom_ax": 15, "ignore_missing_sampl": 15, "fals": [15, 24, 34, 46, 51, 52], "ignore_pcoa_featur": 15, "mirror": 15, "arbitrari": [15, 45, 51], "travers": 15, "algorithm": [15, 30, 32, 52, 57], "port": [15, 26], "happen": [15, 16, 30, 32, 51], "unfamilar": 16, "suppos": [16, 50, 52], "utensil": 16, "imagin": [16, 31, 42], "mine": [16, 51, 54], "intellig": 16, "grasp": 16, "consider": [16, 38, 48], "ask": 16, "blith": 16, "tear": 16, "paper": [16, 52], "shred": 16, "mission": 16, "pencil": 16, "formal": [16, 53], "sai": [16, 30], "unshred": 16, "blank": [16, 48], "pen": 16, "accord": [16, 42], "refus": 16, "mismatch": [16, 50, 52], "constrain": 16, "fundament": [16, 52, 57], "lot": [16, 30, 39, 42, 45, 49, 50, 51, 54], "aris": [16, 30, 51], "freedom": [16, 51], "strict": 16, "power": [16, 42, 51, 52, 54], "great": [16, 42, 51, 54], "ture": 16, "cost": [16, 45], "ultim": [16, 54, 56, 57], "awai": [16, 45, 51], "imped": 16, "comprehens": 16, "good": [16, 39, 43, 50, 51, 52, 54, 55], "fuzzi": 16, "indistinct": 16, "world": [16, 57], "peopl": 16, "grammar": 16, "semantictyp": [16, 31, 46, 51], "spoon": 16, "chalk": 16, "register_semantic_typ": [16, 51], "awar": [16, 30, 45, 51], "dozen": 16, "straight": [16, 52, 54], "talk": 16, "broad": 16, "categori": 16, "far": [16, 32], "dine": 16, "field_nam": [16, 46], "field_memb": [16, 46], "And": [16, 43, 51, 54, 57], "cours": [16, 52], "explain": 16, "sinc": [16, 30, 35, 38, 45, 49, 50, 51, 52, 57], "silli": [16, 51, 56], "mix": [16, 57], "gross": 16, "traceback": 16, "stdin": 16, "home": [16, 18], "workspac": 16, "py": [16, 21, 39, 42, 49, 50, 51, 54], "68": 16, "__getitem__": 16, "_validate_field_": 16, "arg": [16, 18, 51, 52], "184": 16, "variant": [16, 30, 46], "varfield": 16, "menu": 16, "print": [16, 18, 42, 54], "combinator": 16, "satisfi": 16, "vocabulari": [16, 48], "ourselv": [16, 52], "obvious": 16, "true": [16, 19, 24, 46, 48, 52], "organ": [16, 26, 40, 51], "hierarchi": 16, "seper": 16, "someth": [16, 18, 30, 40, 43, 45, 50, 51, 52, 54, 57], "knife": 16, "variant_of": [16, 46], "earlier": [16, 31, 51, 52, 53], "invoc": 16, "ve": [16, 32, 37, 42, 51, 52, 56], "knive": 16, "belong": [16, 18], "kitchen": 16, "wouldn": [16, 18, 45, 52], "cook": 16, "steak": 16, "eat": 16, "chef": 16, "stori": 16, "spatula": 16, "pastrybag": 16, "pastri": 16, "bag": 16, "me": [16, 45, 50, 51, 52, 54, 56], "happi": [16, 54, 55], "birthdai": 16, "cake": 16, "suit": [16, 41, 54], "frost": 16, "flower": 16, "other_plugin": 16, "main": [16, 18, 48, 50, 51], "match": [16, 21, 38, 39, 40, 46, 48, 50, 52], "trick": 16, "sleev": 16, "bool": [16, 31, 46], "float": [16, 46, 48, 51, 52], "str": [16, 24, 29, 33, 34, 35, 43, 45, 46, 48, 49, 50, 51, 54], "essenti": [16, 31, 39, 45, 51], "unicod": 16, "capit": 16, "counterpart": 16, "metadatacolumn": [16, 43, 46, 48], "numer": [16, 46, 48], "categor": [16, 46, 48], "Of": 16, "unless": [16, 18, 21, 33, 39, 40], "assert": [16, 42, 46], "banana": 16, "bound": 16, "possess": 16, "predic": 16, "Thats": 16, "anywai": 16, "boolean": [16, 52], "whether": [16, 30, 51, 52], "instanc": [16, 31, 32, 39, 42, 43, 51, 52], "dropdown": 16, "predetermin": 16, "variabl": [16, 18, 21, 24, 46, 50, 52, 54], "appl": [16, 40], "pear": 16, "grape": 16, "modulo": 16, "head": [16, 46, 50], "inspect": 16, "harder": 16, "checkbox": [16, 52], "mouth": 16, "best": [16, 45, 51, 52], "dialog": [16, 45], "programmat": 16, "transfer": 16, "to_ast": [16, 24], "json": [16, 24], "friendli": [16, 39, 52], "dump": 16, "indent": 16, "sort_kei": 16, "proport": 16, "inclusive_end": [16, 52], "leav": [16, 30, 50], "attach": 16, "cut": 16, "fillet": 16, "fish": 16, "pare": 16, "fruit": 16, "cutleri": 16, "uninterest": 16, "nomenclatur": 16, "lack": 16, "granular": 16, "perfect": 16, "extol": 16, "virtu": 16, "adopt": [16, 45, 51, 52], "consensu": 16, "slow": [16, 30, 32, 51, 52], "anyon": [16, 51], "recogn": [16, 52], "explicitli": [16, 31, 45], "sharp": 16, "exclud": [16, 39], "dull": 16, "substitut": 16, "supertyp": 16, "anywher": [16, 39, 43], "suffic": [16, 50], "test": [16, 26, 37, 39, 40, 44, 45, 55, 56, 57], "inequ": 16, "wherev": 16, "obviou": 16, "soup": 16, "come": [16, 27, 29, 30, 45, 49, 51, 52, 53, 54, 55, 57], "relationship": [16, 30], "unrel": 16, "mechan": [16, 45], "reserv": 16, "hash": 16, "evalu": [16, 18], "sophist": 16, "concis": 16, "extension": 16, "matter": [16, 32], "lengthi": 16, "sharp_fillet": 16, "dull_par": 16, "fanci": 16, "unabl": 16, "smaller": 16, "sharpen": 16, "intuit": [16, 52], "enforc": [16, 48], "consequ": 16, "unadorn": 16, "practic": [16, 45, 50, 51], "probabl": [16, 30, 42, 45, 51], "everyon": [16, 45], "simultan": [16, 18], "spork": 16, "nonetheless": 16, "somedai": 16, "invert": 16, "syntax": [16, 24, 31, 32, 52], "compound": 16, "bundl": 16, "nice": [16, 37, 44, 54], "resumpt": [17, 20], "administr": [18, 19], "slate": [18, 19, 26], "parsl": 18, "basi": [18, 30, 52], "suppli": 18, "vendor": 18, "toml": 18, "attempt": [18, 19, 42, 43, 51, 52], "psutil": 18, "cpu_count": 18, "written": [18, 21, 31, 35, 38, 39, 45, 48, 50, 51, 54], "strategi": [18, 38], "executor": 18, "threadpoolexecutor": 18, "max_thread": 18, "highthroughputexecutor": 18, "htex": 18, "max_work": 18, "localprovid": 18, "executor_map": 18, "some_act": 18, "parsel": 18, "adhoc": 18, "cluster": [18, 30], "setup": [18, 39, 46], "scale": [18, 50], "map": [18, 24, 32, 46, 48, 52, 54], "briefli": [18, 41, 51, 52], "job": [18, 30, 46], "thread": [18, 46], "ground": 18, "worker": 18, "tomlkit": 18, "dictionari": [18, 24, 31, 32, 39, 42, 46, 54], "middl": 18, "under": [18, 21, 26, 40, 45, 49, 52, 54], "beneath": 18, "unmap": 18, "instanti": [18, 24, 31, 32, 43, 51, 52, 54], "flag": [18, 19], "prioriti": [18, 45], "qiime2_config": 18, "filepath": [18, 46, 51], "conda_prefix": 18, "after": [18, 30, 40, 51, 52, 54, 56, 57], "referenc": [18, 31, 52], "overrid": [18, 46], "On": [18, 31, 51], "linux": [18, 40], "maco": [18, 40], "librari": [18, 32, 39, 42, 51, 52], "appdir": 18, "xdg": 18, "vari": [18, 32, 39, 45, 51], "take": [18, 21, 29, 30, 32, 33, 35, 38, 48, 49, 50, 51, 52, 53, 54], "parallel_config": 18, "get_config_from_fil": 18, "Or": [18, 52, 56], "elsewher": [18, 45], "path_to_config": 18, "parallelconfig": 18, "liter": [18, 42], "action_executor_map": 18, "your_qiime2_act": 18, "sure": [18, 30, 40, 42, 49, 51, 56], "_result": 18, "result1": 18, "result2": 18, "someexcept": 18, "block": [18, 42, 51], "eventu": 18, "resolv": 18, "proceed": 18, "lead": [18, 30, 45, 51], "caught": 18, "outsid": [18, 52], "tri": [18, 45, 51], "did": [18, 49, 51, 52], "concess": 18, "rerun": 19, "calcul": [19, 27, 39], "pool": 19, "poll": 19, "recycle_": 19, "sha1": 19, "plugin_act": 19, "succe": 19, "wish": [19, 42, 51], "past": [19, 49, 52], "guarante": [19, 45], "usabl": 19, "statement": [19, 42, 51, 52], "cache_path": 19, "create_pool": 19, "guid": [20, 26, 36, 40, 42, 44, 53, 54], "explan": [20, 26, 30, 36, 44, 51], "trait": 21, "diagram": 21, "v0": 21, "wild": 21, "alpha": [21, 27, 33, 35, 39, 42], "supersed": 21, "24": 21, "octob": 21, "2016": 21, "archiveformat": 21, "commit": [21, 38, 51, 54, 56], "bdc8a": 21, "introduc": [21, 30], "inherit": [21, 52], "modifi": [21, 52], "__init__": [21, 51], "predecessor": 21, "human": [21, 32, 50, 51, 52], "whole": [21, 45, 52], "root_uuid": 21, "ancestor_uuid": 21, "greater": [21, 52], "2017": 21, "changelog": 21, "4389a0b": 21, "alon": 21, "e072706": 21, "684b8b7": 21, "v2": 21, "variad": 21, "2018": 21, "00a294c": 21, "some_plugin": 21, "demultiplexed_seq": 21, "singlelanepersamplepairedendfastqdirfmt": 21, "q2_type": [21, 32, 52], "feature_data": [21, 52], "_transform": [21, 49, 51], "dnaiter": [21, 51, 52], "software_entri": 21, "fragment": 21, "insert": [21, 24, 46, 50, 52], "f95f324": 21, "checksum": 21, "md5sum": 21, "md5": 21, "414": 21, "md": [21, 43], "5a7118c14fd1bacc957ddf01e61491b7": 21, "333fd63a2b4a102e58e364f37cd98b74": 21, "4373b96f26689f78889caeb1fbb94090": 21, "faith_pd": 21, "cat1": 21, "jsonp": 21, "7a40cff7855daffa28d4082194bdf60": 21, "f6105891": 21, "2c00": 21, "4886": 21, "b733": 21, "6dada99d0c81": 21, "ae0d0e26da5b84a6c0722148789c51e0": 21, "v5": 21, "pend": [21, 41, 51], "submodul": [24, 46, 52], "add_plugin": 24, "act": [24, 54], "namespac": [24, 38], "tupl": [24, 32, 33], "namedtupl": 24, "attribut": [24, 31], "resultcollect": 24, "typeexpress": 24, "Will": 24, "parse_format": 24, "format_str": 24, "type_from_ast": 24, "ast": 24, "dict": [24, 31, 48, 52], "implementationerror": 24, "uninitializedpluginmanagererror": 24, "dai": 26, "canon": 26, "dev": [26, 40, 42, 50, 51, 52, 56], "deprec": 26, "date": 26, "throughout": [26, 52], "thorough": 26, "evelop": 26, "w": [26, 45, 46, 50], "ith": 26, "q": 26, "iim": 26, "dwq2": [26, 30, 39, 50, 51, 52, 54, 56], "split": [26, 30, 42], "yourself": [26, 31, 39, 43, 45, 56], "similarli": [26, 30, 51, 52], "target": [26, 37, 46, 54, 57], "lab": [26, 56], "book": [26, 33, 52, 54], "explor": [26, 35, 39, 50, 53, 54], "aid": 26, "scratch": 26, "seri": [26, 35, 48, 54], "thank": [26, 55], "misialq": 26, "nih": 26, "nation": 26, "institut": 26, "informat": 26, "technolog": 26, "grant": 26, "1u24ca248454": 26, "01": [26, 52], "daf2019": 26, "207342": 26, "chan": 26, "zuckerberg": 26, "czi": 26, "daf": 26, "advis": 26, "silicon": [26, 40], "vallei": 26, "foundat": 26, "doi": 26, "37921": 26, "862772dbrrej": 26, "funder": 26, "13039": 26, "100014989": 26, "myst": 26, "markdown": 26, "alfr": 26, "p": [26, 42, 50, 52], "sloan": 26, "cc": 26, "BY": 26, "nc": 26, "nd": 26, "flavor": 27, "rarefi": [27, 33, 51], "depth": 27, "thu": [27, 35], "incorpor": 27, "q2_divers": [29, 32, 33, 35, 39], "beta_phylogenet": [29, 32], "skbio": [29, 32, 34, 50, 51, 52, 54], "treenod": 29, "distancematrix": [29, 32, 33, 34, 51], "examin": 29, "register_funct": [29, 31, 32, 33, 35, 42, 43, 45, 50, 51, 52, 54], "choic": [29, 30, 32, 46, 56], "beta": [29, 32, 33, 39], "phylogenetic_metr": 29, "distance_matrix": [29, 32, 33], "begin": [29, 48, 51, 52, 57], "life": 29, "coerc": 29, "convers": 29, "overload": 30, "concept": [30, 52], "articl": [30, 51, 52, 54], "disambigu": 30, "commonli": [30, 43, 52], "third": 30, "frequent": [30, 54], "conclud": 30, "phrase": 30, "ram": 30, "unroot": [30, 51], "iq": 30, "effici": [30, 51], "familiar": [30, 39, 42, 43, 51, 56], "successfulli": [30, 42, 54], "independ": [30, 51], "regard": [30, 32], "program": 30, "delai": 30, "notif": [30, 57], "frustrat": [30, 45], "miss": [30, 43, 45, 48], "my": [30, 42, 45, 49, 50, 51, 52, 54, 56, 57], "weekend": 30, "ok": [30, 45, 50, 51], "hope": 30, "mondai": 30, "morn": 30, "left": 30, "fridai": 30, "wors": 30, "inappropri": 30, "messag": [30, 45, 48, 52, 56], "loudli": 30, "went": [30, 50], "told": 30, "quietli": 30, "realiz": [30, 46], "misinterpret": 30, "incorrect": 30, "quiet": [30, 52, 56], "failur": [30, 45, 51, 52], "detect": [30, 51], "everyth": [30, 40, 42, 45, 49, 50, 51, 52, 56], "wast": 30, "hour": 30, "publish": [30, 52, 57], "exemplifi": 30, "qualiti": [30, 52], "qual": 30, "sequenceswithqu": 30, "count": [30, 32, 50], "bacteri": 30, "genera": 30, "panda": [30, 35, 43, 48], "datafram": [30, 43, 45, 48], "duplicate_t": [30, 52], "pd": [30, 35, 43, 45, 48], "discoveri": [30, 45], "potenti": 30, "treat": [30, 48], "especi": 30, "video": 30, "sorri": 30, "singlednasequ": [30, 49, 51, 54], "singular": 31, "es": 31, "dummy_plugin": 31, "example_funct": 31, "int_list": 31, "singleint": 31, "int_dict": 31, "bool_list": 31, "bool_dict": 31, "NOT": 31, "fact": [31, 52], "reach": [31, 42, 45, 51], "incompat": [31, 57], "forum": [31, 39, 45, 51, 52, 54, 55], "wrapper": 31, "de": 31, "facto": 31, "correspond": [31, 32, 48, 51, 52], "foo": 31, "bar": 31, "strip": 31, "gave": 31, "empti": [31, 45], "os": [31, 50], "item": [31, 52], "mypi": 32, "ordinationresult": 32, "number_of_dimens": 32, "adher": 32, "contract": 32, "pcoaresult": [32, 33], "rang": [32, 33, 46, 51, 52], "input_descript": [32, 33, 35, 45, 50, 52], "distanc": [32, 33, 43, 51], "matrix": [32, 33, 51], "parameter_descript": [32, 33, 35, 43, 45, 50, 52], "dimens": 32, "eigenvector": 32, "eigenvalu": 32, "influenc": 32, "eigendecomposit": 32, "scipi": 32, "eigh": 32, "exact": 32, "manner": [32, 43], "matric": 32, "fast": 32, "heurist": 32, "fsvd": 32, "suffer": 32, "degre": 32, "accuraci": 32, "loss": 32, "magnitud": 32, "output_descript": [32, 33, 35, 45, 52], "princip": 32, "legendrelegendr": 32, "halko2011": 32, "readabl": [32, 50], "stitch": 33, "ctx": 33, "get_act": 33, "make_artifact": 33, "view_typ": [33, 49], "import_data": [33, 42, 49, 54], "core_metr": 33, "n_job": 33, "feature_t": [33, 42, 45], "emperor_plot": 33, "rarefied_t": 33, "append": 33, "observed_otu": 33, "shannon": 33, "pielou_": 33, "dm": 33, "jaccard": 33, "braycurti": 33, "beta_result": 33, "pcoa_result": 33, "jaccard_emperor": 33, "observed_otus_vector": 33, "alphadivers": [33, 35, 42], "shannon_vector": 33, "evenness_vector": 33, "jaccard_distance_matrix": 33, "bray_curtis_distance_matrix": 33, "jaccard_pcoa_result": 33, "bray_curtis_pcoa_result": 33, "bray_curtis_emperor": 33, "total": [33, 46], "sklearn_n_jobs_descript": 33, "vector": [33, 35, 42], "otu": 33, "pielou": 33, "brai": 33, "curti": 33, "short": [34, 50], "convent": [34, 39, 42, 51, 52, 54], "plugin_setup": [34, 39, 42, 50, 51, 54], "lsmatformat": 34, "register_transform": [34, 43, 49, 51], "_1": [34, 43, 51], "ff": [34, 49, 51, 54], "lsmat": 34, "_2": [34, 49, 51], "verifi": [34, 50], "analyt": [35, 51], "statist": [35, 39], "output_dir": [35, 43, 50], "extens": [35, 36, 51], "textual": 35, "alpha_group_signific": 35, "alpha_divers": 35, "comparison": 35, "kruskal1952us": 35, "abil": [36, 51], "unitl": 36, "comfort": [37, 40, 56, 57], "plai": [37, 44, 53], "collis": 38, "toler": 38, "deploi": [38, 54], "offend": 38, "concurr": 38, "emploi": [38, 50], "circular": 38, "3rd": 38, "parti": 38, "establish": 38, "compabl": 38, "cutadapt": [38, 43], "taxa": 38, "subcommand": 38, "exclus": [38, 42, 46, 53], "setuptool": 39, "anaconda": 39, "pypi": 39, "straightforward": 39, "connect": 39, "100": 39, "standalon": 39, "quit": 39, "bigger": [39, 50], "__version__": [39, 52], "short_descript": [39, 46], "space": 39, "punctuat": 39, "uppercas": 39, "charact": [39, 48, 50, 51, 52], "underscor": [39, 42], "brief": [39, 51, 52], "user_support_text": [39, 46], "tracker": [39, 55], "stackoverflow": 39, "mail": 39, "habit": 39, "monitor": 39, "entry_point": 39, "suitabl": 40, "window": 40, "subsystem": 40, "wsl": 40, "assit": 40, "miniconda": 40, "copi": [40, 49, 52, 56], "wget": 40, "raw": [40, 51], "githubusercont": 40, "yml": 40, "env": [40, 52], "q2dev": 40, "rm": [40, 52], "ubuntu": 40, "conda_subdir": 40, "osx": 40, "64": 40, "config": 40, "subdir": 40, "info": [40, 56], "18": 40, "dev0": 40, "15": [40, 54], "g8ac7e3": 40, "g7cf7a7a": 40, "g1827eab": 40, "gregcaporaso": 40, "miniconda3": [40, 52], "var": 40, "visit": 40, "oppos": [40, 51], "stage": [40, 51, 52], "hack": [40, 42], "sake": 40, "grab": 40, "ci": 40, "recip": 40, "meta": [40, 50], "blob": 40, "pytest": [40, 42], "flake8": 40, "okai": 40, "placehold": 41, "har": [41, 46], "repetit": 41, "testpluginbas": [41, 42, 46, 50, 51, 52, 54], "sapienn": 41, "upda": 42, "inject": 42, "executionusag": 42, "disregard": 42, "face": [42, 51, 54], "artifactapiusag": [42, 54], "side": [42, 46], "unnecessarili": 42, "numpi": 42, "np": [42, 48], "ft1_factori": 42, "o1": 42, "o2": 42, "s1": [42, 52], "s2": [42, 52], "s3": 42, "prefix": [42, 46], "reimplement": 42, "meet": [42, 54], "feature_table_merge_exampl": 42, "feature_table1": 42, "init_artifact": [42, 54], "feature_table2": 42, "ft2_factori": 42, "merged_t": 42, "usageact": [42, 54], "plugin_id": [42, 54], "action_id": [42, 54], "usageinput": [42, 54], "usageoutputnam": [42, 54], "proxi": 42, "beyond": 42, "meaning": [42, 45], "identity_with_metadata_column_get_mdc": 42, "variadic_input_simpl": 42, "feature_table_merge_three_tables_exampl": 42, "q2_feature_t": 42, "i_tabl": 42, "keyword": 42, "three_tabl": 42, "wonder": 42, "execute_exampl": [42, 54], "usagevari": 42, "smoke": 42, "observed_features_exampl": 42, "ft": 42, "unpack": 42, "usageoutput": 42, "a_div_vector": 42, "diversity_lib": 42, "observed_featur": 42, "obs_feat_vector": 42, "assert_output_typ": 42, "easiest": [42, 55, 56], "unittest": [42, 46], "dedic": 42, "flexilib": 42, "properli": 42, "clunki": [42, 50, 51, 52], "exp": 42, "assert_has_line_match": 42, "cleaner": 42, "pretend": 42, "wrote": [42, 49, 50, 51, 53], "came": 42, "latest": 42, "reinstal": 42, "refresh": [42, 50, 51, 52, 56], "curiou": 42, "overlap_method": 42, "feature_table3": 42, "overlap": 42, "sum": [42, 51], "clever": 42, "infer": [42, 43, 52], "ag": 43, "elev": 43, "bodi": [43, 50, 51], "ph": 43, "unifi": 43, "consum": [43, 45], "longitudin": 43, "volatil": 43, "tabul": 43, "regroup": 43, "partit": 43, "pivot": 43, "subject": 43, "verif": 43, "my_viz": 43, "df": [43, 51], "to_datafram": [43, 48], "demux": 43, "emp": 43, "numericmetadatacolumn": [43, 48], "categoricalmetadatacolumn": [43, 48], "cell": 43, "numeric_md_col": 43, "column_typ": 43, "categorical_md_col": 43, "euclidean": 43, "elig": 43, "cast": [43, 48, 54], "utlit": 43, "amongst": 43, "has_missing_valu": 43, "drop_missing_valu": 43, "filter_column": 43, "queri": 43, "get_id": 43, "excit": [43, 54], "opportun": [43, 45], "cool_project": 43, "interestingdataformat": 43, "searchabl": 43, "sortabl": 43, "cool": [43, 45, 49, 52], "immutablemetadata": 43, "obtain": [43, 48], "conclus": [44, 57], "recur": 45, "ineffect": 45, "risk": 45, "counterproduct": 45, "decemb": 45, "speak": 45, "pai": 45, "promis": 45, "somewher": 45, "y": 45, "replay": 45, "weird": 45, "continu": [45, 51], "prototyp": [45, 52], "extern": 45, "worth": [45, 52, 57], "my_act": 45, "taxonomi": [45, 52], "an_input_filepath": 45, "an_output_filepath": 45, "inf": 45, "outf": 45, "dummi": 45, "featuredata": [45, 50, 51, 52], "dummy_output": 45, "circumv": 45, "circumst": 45, "correctli": [45, 50], "upload": 45, "unreli": 45, "broadli": [45, 54], "downstream": 45, "unambigu": [45, 51], "confid": 45, "workflow": [45, 53, 57], "expertis": [45, 54], "upfront": 45, "mynewformat": 45, "remot": 45, "costli": 45, "crash": 45, "burn": 45, "obscur": [45, 49, 51], "gone": 45, "walk": [45, 57], "neg": [45, 52], "differec": 45, "bad": [45, 51], "phone": 45, "app": 45, "buggi": 45, "realiti": 45, "meaningless": 45, "misinform": 45, "major": [45, 50, 51], "repercuss": 45, "retract": [45, 52], "scientif": 45, "clinic": [45, 52], "misdiagnos": 45, "blame": 45, "big": [45, 54], "But": [45, 51, 52], "project_nam": 46, "citation_text": 46, "variantfield": 46, "privat": [46, 51, 52], "is_semantic_typ": 46, "inclus": 46, "typemap": 46, "typematch": 46, "citationrecord": 46, "get_available_cor": 46, "n_less": 46, "methodnam": 46, "runtest": 46, "testcas": 46, "helper": [46, 49, 51, 54], "test_dir_prefix": 46, "temporari": [46, 52], "dir": [46, 52, 56], "assertregisteredsemantictyp": [46, 51], "semantic_typ": 46, "assertsemantictyperegisteredtoformat": 46, "exp_format": 46, "get_data_path": [46, 51, 52], "get_transform": [46, 49], "from_typ": [46, 52], "to_typ": [46, 52], "deliber": 46, "machineri": [46, 51], "condit": [46, 52], "tranform": 46, "runner": 46, "__super__": 46, "overridden": 46, "teardown": 46, "transform_format": [46, 51], "source_format": 46, "mutual": 46, "ob": 46, "assert_no_nans_in_t": 46, "nan": [46, 48], "reset": 46, "column_missing_schem": 48, "default_missing_schem": 48, "tabular": 48, "natur": [48, 54, 57], "focus": [48, 52], "roundtripp": 48, "pound": 48, "comment": 48, "row": 48, "spec": 48, "retriev": 48, "gain": 48, "preserv": 48, "insdc": 48, "lower": 48, "header": 48, "dtype": 48, "vs": [48, 56], "omit": 48, "missing_schem": 48, "docstr": [48, 52], "treatment": [48, 52], "metadatafileerror": 48, "include_suffix": 48, "role": 49, "_exampl": [49, 54], "sentenc": 49, "_create_seq_artifact": [49, 54], "seq": [49, 51, 52, 54], "converst": 49, "scene": 49, "infrequ": 49, "refactor": 49, "trivial": 49, "tend": [49, 54], "recal": [49, 51], "aritfact": 49, "seq1_factori": [49, 54], "aaccggttggccaa": [49, 54], "seq1": [49, 51, 52, 54], "seq2_factori": [49, 54], "aaccgctggcgaa": [49, 54], "seq2": [49, 51, 52, 54], "hood": [49, 54], "singlerecorddnafastadirectoryformat": [49, 51], "delet": [49, 52, 56], "test_transform": [49, 51], "test_dna_to_single_record_fasta_simple1": 49, "in_": 49, "accggtggaaccggtaacacccac": [49, 51, 52], "tx": 49, "trip": 49, "assertequ": [49, 51, 52], "test_dna_to_single_record_fasta_simple2": 49, "accggtaaccggttaacacccac": [49, 51, 52], "lesson": [50, 52], "tabularmsa": [50, 51, 52], "minimum": 50, "flexibl": [50, 51, 54], "luckili": 50, "scikit": [50, 51, 52], "bio": [50, 51, 52], "__repr__": 50, "crude": 50, "vizual": 50, "_visual": 50, "q2_dwq2": [50, 51, 52, 54], "summarize_align": 50, "msa": [50, 51, 52, 54], "join": [50, 55], "_html_templat": 50, "repr": 50, "doctyp": 50, "lang": 50, "en": 50, "charset": 50, "utf": 50, "viewport": 50, "width": 50, "devic": 50, "style": 50, "pad": 50, "20px": 50, "font": 50, "famili": 50, "courier": 50, "monospac": 50, "pre": 50, "viusal": 50, "hint": [50, 51, 52, 54], "sweet": 50, "replac": [50, 52, 54], "test_visu": 50, "summarizealignmenttest": 50, "test_simple1": [50, 51, 52], "aligned_sequence1": [50, 52], "aaaaaaaaggtggcctttttttt": [50, 52], "aligned_sequence2": [50, 52], "aaaaaaaagg": [50, 52], "ggcctttttttt": [50, 52], "assertin": 50, "nw_align": [50, 51, 52, 54], "tricker": 50, "fragil": 50, "substr": 50, "bunch": [50, 52, 56], "stuck": [50, 51], "alignedsequ": [50, 52], "summar": [50, 53, 54], "nw": [50, 52, 53], "stat": 50, "25": [50, 54], "accggtggaaccgg": [50, 52], "taacacccac": [50, 52], "accggt": [50, 52], "aaccggttaacacccac": [50, 52], "mention": [50, 51, 52, 54], "longer": [50, 51, 52], "80": 50, "spend": 50, "nicer": 50, "mayb": 50, "color": 50, "nucleotid": [50, 52], "gap": [50, 52], "encount": 51, "ecosystem": 51, "suboptim": 51, "weren": 51, "ones": [51, 52], "nexu": 51, "inher": 51, "bowtie2index": 51, "No": 51, "brackendb": 51, "symmetr": 51, "alignedproteinsequ": 51, "identfii": 51, "alignedrnasequ": 51, "april": [51, 55], "explanatori": 51, "opaqu": 51, "meantim": 51, "strug": 51, "background": [51, 52], "unnecessari": 51, "_types_and_format": 51, "singlerecorddnafastaformat": [51, 54], "succeed": 51, "whatsoev": 51, "extrem": 51, "maxim": 51, "trade": 51, "perciev": 51, "against": 51, "sneak": 51, "entireti": 51, "presum": 51, "creator": 51, "offens": 51, "tediou": 51, "prone": 51, "bore": 51, "mistak": 51, "digress": 51, "get_sequence_id": 51, "io": 51, "unrecognizedformaterror": 51, "_confirm_single_record": 51, "disabl": 51, "iupac": 51, "control": 51, "seq_num": 51, "_confirm_acgt_onli": 51, "n_char": 51, "validation_seq": 51, "validation_seq_len": 51, "len": 51, "non_definite_chars_count": 51, "acgt": 51, "validation_level_to_n_char": 51, "50": 51, "__all__": 51, "reorgan": 51, "register_format": 51, "artifactclass": 51, "register_artifact_class": 51, "toward": [51, 54], "modif": 51, "jargon": 51, "reciev": 51, "demutiplex": 51, "put": [51, 52], "global_pairwise_align_nucleotid": [51, 52], "_transform_singlerecorddnafastaformat_to_dna": 51, "_3": 51, "_4": 51, "importlib": 51, "import_modul": 51, "mostli": 51, "test_types_and_format": 51, "singlednasequencetest": 51, "test_semantic_type_registr": 51, "singlerecorddnafastaformattest": 51, "thermophili": 51, "rrna": 51, "fn": 51, "fp": 51, "test_invalid_default_valid": 51, "assertraisesregex": 51, "171": 51, "test_invalid_max_valid": 51, "test_invalid_min_valid": 51, "singlednasequencetransformertest": 51, "test_single_record_fasta_to_dna_simple1": 51, "test_single_record_fasta_to_dna_simple2": 51, "14": 51, "23": [51, 52], "51": 51, "hopefulli": 51, "conceptu": 51, "diff": 51, "test_method": [51, 52], "test_simple2": [51, 52], "oversight": 51, "_method": [51, 52], "gap_open_penalti": [51, 52], "gap_extend_penalti": [51, 52], "match_scor": [51, 52], "mismatch_scor": [51, 52], "biopython": 51, "blast": 52, "genom": 52, "assembl": 52, "molecular": 52, "environment": 52, "evolut": 52, "score": 52, "penalti": 52, "incur": 52, "counter": 52, "adjust": 52, "accordingli": 52, "convei": 52, "copyright": 52, "bsd": 52, "licens": 52, "ultipl": 52, "equenc": 52, "lignment": 52, "odd": 52, "stem": 52, "reassign": 52, "varriabl": 52, "unus": 52, "unusu": 52, "workaround": 52, "nearli": 52, "paperpil": 52, "endnot": 52, "googl": 52, "scholar": 52, "favorit": 52, "needleman1970gener": 52, "saul": 52, "christian": 52, "journal": 52, "biologi": 52, "volum": 52, "elsevi": 52, "bibtext": 52, "needleman1970": [52, 54], "inclusive_start": 52, "aligned_sequ": [52, 54], "fall": 52, "lookup": 52, "prompt": [52, 56], "post": 52, "miscellan": [52, 56], "unspecifi": [52, 56], "verbos": [52, 56], "stdout": [52, 56], "stderr": [52, 56], "silenc": [52, 56], "golden": [52, 56], "ipython": [52, 54], "session": 52, "lib": 52, "python3": 52, "implic": 52, "angri": 52, "someon": 52, "medic": 52, "41": 52, "seriou": 52, "convinc": [52, 54], "reconsid": 52, "antipattern": 52, "shortli": [52, 57], "nwaligntest": 52, "sequence1": 52, "sequence2": 52, "aaaaaaaaggggcctttttttt": 52, "clear": [52, 56], "game": 52, "hypothes": 52, "minor": 52, "variat": 52, "edg": 52, "boundari": 52, "increas": 52, "revis": 52, "17": 52, "report": 52, "said": 52, "pain": 52, "assertnotequ": 52, "test_alt_match_scor": 52, "aaaattt": 52, "aaaaggttt": 52, "aaaa": 52, "ttt": 52, "test_alt_gap_open_penalti": 52, "tt": 52, "aaaag": 52, "gttt": 52, "test_alt_gap_extend_penalti": 52, "001": 52, "test_alt_mismatch_scor": 52, "aaa": 52, "attt": 52, "shape": 52, "peek": [52, 54], "cat": 52, "smith": 52, "waterman": 52, "sw": 52, "local_pairwise_align_nucleotid": 52, "computation": 53, "expens": 53, "dissemin": 54, "abstractli": 54, "shell": 54, "q2galaxi": 54, "documentat": 54, "honor": 54, "tempfil": 54, "am": 54, "remind": 54, "myself": 54, "incident": 54, "bother": 54, "usagedriv": 54, "addion": 54, "nw_align_example_1": 54, "dwq2_action": 54, "assess": 54, "test_exampl": 54, "usageexampletest": 54, "06": 54, "guidelin": 54, "modestli": 54, "laptop": 54, "credit": 54, "popular": 54, "fun": 54, "folk": 54, "13": 55, "cookiecutt": [55, 56], "gh": 56, "fill": 56, "75": 56, "editor": 56, "poke": 56, "congratul": 56, "earli": 57, "quot": 57, "tranch": 57, "substanti": 57, "temptat": 57, "immedi": 57, "caveat": 57, "suffici": 57, "progress": 57, "necessit": 57, "guidanc": 57}, "objects": {"qiime2.metadata": [[48, 0, 1, "", "CategoricalMetadataColumn"], [48, 0, 1, "", "Metadata"], [48, 0, 1, "", "MetadataColumn"], [48, 0, 1, "", "MetadataFileError"], [48, 0, 1, "", "NumericMetadataColumn"]], "qiime2.plugin": [[46, 0, 1, "", "BinaryFileFormat"], [46, 0, 1, "", "Bool"], [46, 0, 1, "", "Categorical"], [46, 0, 1, "", "Choices"], [46, 0, 1, "", "CitationRecord"], [46, 0, 1, "", "Citations"], [46, 0, 1, "", "Collection"], [46, 0, 1, "", "DirectoryFormat"], [46, 0, 1, "", "End"], [46, 0, 1, "", "Float"], [46, 0, 1, "", "Int"], [46, 0, 1, "", "Jobs"], [46, 0, 1, "", "List"], [46, 0, 1, "", "Metadata"], [46, 0, 1, "", "MetadataColumn"], [46, 0, 1, "", "Numeric"], [46, 0, 1, "", "Plugin"], [46, 0, 1, "", "Properties"], [46, 0, 1, "", "Range"], [46, 0, 1, "", "SemanticType"], [46, 0, 1, "", "Set"], [46, 0, 1, "", "Start"], [46, 0, 1, "", "Str"], [46, 0, 1, "", "TextFileFormat"], [46, 0, 1, "", "Threads"], [46, 0, 1, "", "TypeMap"], [46, 0, 1, "", "TypeMatch"], [46, 0, 1, "", "ValidationError"], [46, 0, 1, "", "Visualization"], [46, 0, 1, "", "get_available_cores"], [46, 1, 0, "-", "testing"]], "qiime2.plugin.testing": [[46, 2, 1, "", "TestPluginBase"], [46, 0, 1, "", "assert_no_nans_in_tables"]], "qiime2.plugin.testing.TestPluginBase": [[46, 3, 1, "", "assertRegisteredSemanticType"], [46, 3, 1, "", "assertSemanticTypeRegisteredToFormat"], [46, 3, 1, "", "get_data_path"], [46, 3, 1, "", "get_transformer"], [46, 4, 1, "", "package"], [46, 3, 1, "", "setUp"], [46, 3, 1, "", "tearDown"], [46, 4, 1, "", "test_dir_prefix"], [46, 3, 1, "", "transform_format"]], "qiime2.sdk": [[24, 0, 1, "", "Action"], [24, 0, 1, "", "Artifact"], [24, 0, 1, "", "Citations"], [24, 0, 1, "", "Context"], [24, 0, 1, "", "ImplementationError"], [24, 0, 1, "", "Method"], [24, 0, 1, "", "Pipeline"], [24, 0, 1, "", "PluginManager"], [24, 0, 1, "", "Result"], [24, 0, 1, "", "ResultCollection"], [24, 0, 1, "", "Results"], [24, 0, 1, "", "UninitializedPluginManagerError"], [24, 0, 1, "", "ValidationError"], [24, 0, 1, "", "Visualization"], [24, 0, 1, "", "Visualizer"], [24, 0, 1, "", "parse_format"], [24, 0, 1, "", "parse_type"], [24, 0, 1, "", "type_from_ast"]]}, "objtypes": {"0": "py:function", "1": "py:module", "2": "py:class", "3": "py:method", "4": "py:attribute"}, "objnames": {"0": ["py", "function", "Python function"], "1": ["py", "module", "Python module"], "2": ["py", "class", "Python class"], "3": ["py", "method", "Python method"], "4": ["py", "attribute", "Python attribute"]}, "titleterms": {"list": 0, "work": 0, "cite": 0, "index": 1, "glossari": 2, "back": 3, "matter": 3, "distribut": [4, 40], "develop": [4, 5, 6, 16, 18, 20, 23, 24, 26, 40, 44, 45, 46, 51], "document": [5, 7], "doc": 6, "user": 7, "plan": 7, "refactor": 7, "contribut": [7, 26, 40], "current": 7, "qiim": [8, 10, 18, 19, 26, 27, 39, 40, 41, 48, 57], "2": [8, 10, 18, 19, 21, 26, 27, 39, 40, 41, 57], "architectur": 8, "overview": [8, 39], "detail": 8, "compon": 8, "diagram": 8, "follow": 8, "A": [8, 43, 52, 57], "command": [8, 18, 19, 31, 54], "through": [8, 18, 19], "summari": 8, "anatomi": 9, "an": [9, 16, 31, 39, 50, 51, 52], "archiv": [9, 21], "The": [9, 15, 18, 24, 31, 46, 48], "most": 9, "import": [9, 51], "file": [9, 11, 15, 18, 30, 43, 51], "metadata": [9, 10, 43, 46, 48], "yaml": [9, 15], "data": [9, 10, 15, 30, 42, 54], "goe": 9, "In": 9, "proven": [9, 10, 15], "why": [9, 15], "zip": 9, "rule": 9, "identifi": 9, "how": [10, 17, 29, 37, 38, 41, 43], "store": 10, "goal": 10, "storag": 10, "access": 10, "transfer": 10, "input": [10, 24, 31, 45, 46, 54], "valid": [10, 11, 36, 45], "type": [10, 11, 16, 27, 30, 46, 51], "check": 10, "interoper": 10, "extens": 10, "format": [11, 21, 30, 36, 45, 46, 51], "directori": [11, 51], "text": 11, "binari": 11, "fix": 11, "layout": 11, "variabl": 11, "singl": 11, "associ": 11, "garbag": 12, "collect": [12, 31], "framework": [13, 20], "explan": [13, 28], "metaprogram": 14, "decentr": 15, "retrospect": 15, "track": 15, "captur": 15, "what": [15, 52], "action": [15, 24, 27, 31, 46, 50, 52], "execut": 15, "block": 15, "uniqu": 15, "id": 15, "environ": [15, 26, 40], "pipelin": [15, 18, 19, 33, 53], "exampl": [15, 41, 42, 54], "take": [15, 31], "awai": 15, "semant": [16, 30, 51], "primit": [16, 46], "visual": [16, 35, 43, 50], "analog": 16, "defin": [16, 36, 39, 42, 49, 51, 52, 54], "extend": 16, "refin": 16, "choic": 16, "interfac": [16, 18, 19, 23, 24, 31, 54], "note": [16, 18], "rang": 16, "properti": 16, "subtyp": 16, "union": 16, "intersect": 16, "guid": [17, 37, 57], "parallel": 18, "configur": 18, "usag": [18, 42, 54], "config": 18, "us": [18, 29, 31, 43, 51], "line": [18, 19, 31, 54], "cli": [18, 19, 31], "user_config_dir": 18, "site_config_dir": 18, "python": [18, 19, 31, 50, 52, 54], "3": [18, 19, 21, 52, 54], "api": [18, 19, 24, 31, 43, 46, 48, 52, 54], "resumpt": 19, "version": [21, 40], "agnost": 21, "guarante": 21, "0": 21, "1": 21, "4": 21, "5": 21, "6": 21, "7": 21, "refer": [22, 24, 25, 47], "pluginmanag": 24, "object": [24, 30, 31, 39, 46], "output": [24, 31, 43, 45, 46], "util": [24, 46], "function": [24, 32, 33, 35, 46, 50, 52], "citat": [24, 46, 52], "except": [24, 46, 48], "set": [26, 40], "up": [26, 40, 52], "your": [26, 39, 40, 50, 54, 56, 57], "statu": 26, "thi": [26, 52], "content": [26, 57], "acknowledg": 26, "get": 26, "help": [26, 43], "fund": 26, "licens": 26, "transform": [29, 34, 49, 51], "ar": 29, "plugin": [29, 38, 39, 40, 41, 44, 45, 46, 50, 52, 56, 57], "artifact": [30, 31, 43, 51], "class": [30, 48, 51], "put": 30, "togeth": 30, "regist": [31, 32, 33, 34, 35, 39, 42, 50, 51, 52, 54], "return": 31, "resultcollect": 31, "init": 31, "load": 31, "save": 31, "creat": [32, 33, 34, 35, 56], "method": [32, 52], "differ": 36, "level": 36, "To": 37, "plai": 38, "nice": 38, "other": [38, 40], "instanti": 39, "entri": 39, "point": 39, "instal": 40, "prerequisit": 40, "latest": 40, "tini": 40, "activ": 40, "conda": 40, "next": 40, "step": [40, 57], "build": [40, 57], "first": [40, 50, 52, 53, 57], "exist": 40, "amplicon": 40, "metagenom": 40, "test": [41, 42, 46, 49, 50, 51, 52, 54], "write": [42, 50, 52, 54], "factori": 42, "try": [42, 52], "out": 42, "comment": 42, "can": [42, 43], "provid": [42, 45], "context": 42, "column": [43, 48], "numer": 43, "categor": 43, "me": 43, "merg": 43, "drop": 43, "empti": 43, "normal": 43, "tsv": 43, "advanc": 43, "filter": 43, "sql": 43, "make": [43, 51], "viewabl": 43, "free": 43, "gener": 43, "from": [43, 49, 56], "anti": 45, "pattern": 45, "filepath": 45, "paramet": 45, "skip": 45, "semat": 46, "modifi": 46, "support": 46, "qiime2": 48, "add": [49, 50, 51, 52, 53, 54], "second": [49, 52], "tl": [49, 50, 51, 52, 54], "dr": [49, 50, 51, 52, 54], "skbio": 49, "dna": 49, "q2_dwq2": 49, "singlerecorddnafastaformat": 49, "unit": [49, 50, 51, 52], "new": [49, 51, 52], "transfom": 49, "option": [50, 51, 52, 54], "exercis": [50, 51, 52, 54], "discov": 51, "publicli": 51, "updat": 51, "nw": [51, 54], "align": [51, 52, 54], "real": 52, "pairwis": 52, "sequenc": 52, "wrapper": 52, "plugin_setup": 52, "py": 52, "call": 52, "q2cli": 52, "our": 52, "few": 52, "addit": 52, "wrap": 52, "displai": 54, "autom": 54, "tutori": [54, 57], "conclus": 55, "templat": 56, "tabl": 57}, "envversion": {"sphinx.domains.c": 2, "sphinx.domains.changeset": 1, "sphinx.domains.citation": 1, "sphinx.domains.cpp": 6, "sphinx.domains.index": 1, "sphinx.domains.javascript": 2, "sphinx.domains.math": 2, "sphinx.domains.python": 3, "sphinx.domains.rst": 2, "sphinx.domains.std": 2, "sphinx.ext.intersphinx": 1, "sphinx.ext.viewcode": 1, "sphinxcontrib.bibtex": 9, "sphinx": 56}})
\ No newline at end of file